Option A, The junction between one neuron and the next, or between a neuron and an effector is called a synapse.
A synapse is a junction between two neurons or between a neuron and an effector (such as a muscle or gland) that enables the transmission of signals from one cell to another. The neurons communicate with each other through the release of chemical substances called neurotransmitters, which diffuse across the synaptic cleft and bind to specific receptors on the postsynaptic cell. A dendrite is a branch-like structure on a neuron that receives signals from other neurons and synapse conducts them to the cell body. A neurotransmitter is a chemical substance that is released by neurons and that acts as a messenger between neurons or between a neuron and an effector. A ventricle is a fluid-filled cavity in the brain that produces and circulates cerebrospinal fluid.
Learn more about neuron here:
https://brainly.com/question/27274584
#SPJ4
Humans are dependent on _______ for their food supply. a. water b. biomass c. fossil fuels d. timber please select the best answer from the choices provided a b c d
For their food supply, humans are reliant on biomass.
Option b is correct
Defining biomass?Biomass is organic material that is renewable and comes from both plants and animals.
For their food supply, humans are reliant on biomass. Biomass is the organic material created by living things as part of their natural life cycles. When one organism is consumed by another in a food chain to get food and energy, the biomass is passed from one organism to the next. Since humans are hetrotrophic organisms, they are reliant on plants and animals for both their food and energy needs. Food is a type of biomass that is passed from living thing to living thing along the food chain.
To know more about biomass visit:-
https://brainly.com/question/21525417
#SPJ4
ding, haocheng, et al. likelihood-based tests for detecting circadian rhythmicity and differential circadian patterns in transcriptomic applications. briefings in bioinformatics 22.6 (2021): bbab224.
The study by Ding, Haocheng, et al. (2021) proposed likelihood-based tests for identifying circadian rhythmicity and differential circadian patterns in transcriptomic applications.
These tests are designed to analyze gene expression data and determine whether genes exhibit rhythmic patterns over a 24-hour cycle. The likelihood-based approach provides a statistical framework to assess the significance of rhythmicity and detect differences in circadian patterns between conditions or treatments. By integrating statistical modeling and biological knowledge, these tests offer a valuable tool for uncovering circadian regulatory mechanisms and understanding temporal gene expression dynamics in various biological systems.
Learn more about rhythmicity here:
https://brainly.com/question/29805772
#SPJ11
Nhóm thức ăn nào sau đây giàu chất đạm?
Answer:
đù việt nam
Explanation:
thịt lợn trứng gà sữa cá
HELPP IM BEING TIMED ILL GIVE BRAINLIEST ANSWER PLS. Describe the rate of changes caused by weathering and
erosion. What are the fast changes? What are the slow changes?
What causes changes in big areas? What causes changes in little
areas?
What problems can occur while your immune system fights the corona virus?
plz help me ASAP
From the provided choices, which color of light does the pigment chlorophyll absorb the most?
A) green
B) Orange
C) blue
D) yellow
A chronic inflammation of joints due to autoimmune destruction of articular cartilage is called...a) osteoarthritis b) rheumatoid arthritis c) osteoporosis d) brittle bone disease
The chronic inflammation of joints due to autoimmune destruction of articular cartilage is called rheumatoid arthritis.
Rheumatoid arthritis is a chronic inflammatory disorder that primarily affects the joints. It is an autoimmune disease in which the immune system attacks the synovial membrane, the lining of the joints, leading to chronic inflammation and destruction of articular cartilage. Unlike osteoarthritis.
which is caused by wear and tear of the joints, rheumatoid arthritis is a systemic disease that can affect other organs in the body, such as the lungs, heart, and eyes. It is important to diagnose and treat rheumatoid arthritis early to prevent irreversible joint damage and disability. Treatment options include medications, physical therapy, and lifestyle changes. A chronic inflammation of joints due to autoimmune destruction of articular cartilage is called b) rheumatoid arthritis.
To know more about rheumatoid arthritis visit:-
https://brainly.com/question/30130207
#SPJ11
although it is almost the same size as jupiter, saturn's gravity is about 2.5 times less, because of saturn's lower mass and density. true false
Although it is almost the same size as jupiter, saturn's gravity is about 2.5 times less, because of saturn's lower mass and density. False.
Saturn's gravity is not about 2.5 times less than Jupiter's. In fact, Saturn's gravity is actually stronger than Jupiter's despite its lower mass and density.
Saturn's mass is significantly lower than Jupiter's, which means it exerts less gravitational force overall. However, when comparing the surface gravity, which is the force experienced by an object on the planet's surface, Saturn's gravity is about 91% of Jupiter's.
The reason for this is that although Saturn is less massive, it is also smaller in size compared to Jupiter. The surface gravity depends not only on mass but also on the radius of the planet. Since Saturn has a smaller radius than Jupiter, the gravitational force at its surface is relatively stronger.
Learn more about Saturn's gravity
https://brainly.com/question/949998
#SPJ4
What are 2 ways in which the conifer trees are adapted to survive in the taiga (check all that apply)?
The plants have pine needles so they do not need to do photosynthesis.
The needles keep the plants from losing water, but still allow them to do photosynthesis.
The needles keep snow from piling up too high.
Answer: The needles keep the plants from losing water, but still allow them to do photosynthesis.
Explanation:
Conifer trees in the taiga biome have needles instead of leaves, which are coated in wax to reduce water loss. This adaptation is important for survival in the taiga's harsh conditions. The needles also have a smaller surface area, which reduces water loss through evaporation.
However, it's the shape of the tree, not the needle, that helps to shed snow and ice, preventing them from accumulating on branches and potentially breaking them.
gary and diane are preparing a garden. As part of their work, they must prepare the soil and plant 100 flowers. it would take diane 10 hours to prepare the soul and 12 hours for planting.
1. how much time would it take the two to complete the garden if they divide the soil prepration equally and the planting equally?
2. how much time would it take the two to complete the garden if they use compararive advantage and specialize in soil preparation or planting?
1. Time taken by Gary and Diane to complete the garden if they divide the soil preparation equally and the planting equally is 32 hours.
2. Time taken by the two to complete the garden if they use comparative advantage and specialize in soil preparation or planting is 34 hours.
1. To calculate the time taken by Gary and Diane to complete the garden, let's write the time taken by Gary to prepare the soil to be x hours. So, the time taken by Diane to prepare the soil will also be x hours. As given, Diane can plant 100 flowers in 12 hours. Thus, Diane can plant 25 flowers in 3 hours. Therefore, the time is taken by Diane to plant 100 flowers
= (100/25) × 3 = 12 hours.
Now, the time taken by Gary to plant 100 flowers will also be 12 hours. Therefore,
total time taken by both Gary and Diane to complete the garden = Time taken for soil preparation + Time taken for planting
= 2x + 12 hours = (2 × 10) + 12
= 32 hours
2. To calculate the time taken by the two to complete the garden if they use comparative advantage and specialize in soil preparation or planting, we know that Diane can prepare the soil in 10 hours while Gary can prepare the soil in 20 hours. Therefore, Diane should prepare the soil. Now, the time is taken by Diane to prepare the soil = 10 hours. Diane can plant 100 flowers in 12 hours while Gary can plant 100 flowers in 24 hours. Therefore, Gary should plant the flowers.
Now, the time is taken Gary to plant the flowers = 24 hours. Therefore,
total time taken by both Gary and Diane to complete the garden = Time taken for soil preparation + Time taken for planting
= 10 + 24
= 34 hours
Learn more about comparative advantage: https://brainly.com/question/7780461
#SPJ11
A forklift uses 1023 N to raise a box 34 m. How much work is done by the forklift?
Question 11 options:
347 joules
34 joules
3,782 joules
34,782 joules
Answer: 347 joules
Explanation: yup im no done plz save me
A forklift uses 1023 N to raise a box 34 m. The work done by the forklift is 34782 joules. Hence option D is correct.
What is Work done?Work done is defined as the division of the force component that is in the direction of the displacement by the displacement's magnitude (d). When an object is moved over a specific distance by an external force, the quantity of energy delivered to it is known as work. It is a scalar quantity. Because it depends on the net distance traveled, regardless of the direction, work is classified as a scalar.
Work done can be calculates as
Work done = Force x displacement
Gives Force = 1023 N
Displacement = 34 m
So, work done = 1023 x 34
= 34783 joules
Thus, a forklift uses 1023 N to raise a box 34 m. The work done by the forklift is 34782 joules. Hence option D is correct.
To learn more about work done, refer to the link below:
https://brainly.com/question/13662169
#SPJ6
What is the role of RuBP? How is RuBP regenerated?
Answer: RUBP Regeneration refers to the cyclical process where the photosynthetic enzyme Rubisco fixes carbon dioxide into the sugars that fuel plant growth and productivity. Only one-sixth of the PGA carbon is converted to sugar—the rest of the carbon is used to recycle RuBP as the cycle continues.
Explanation:
Some engineers are creating models of several unicellular organisms. What would all the models have in common?
Answer:
They would all have one cell with smaller parts to do different jobs within the cell.
Explanation:
a pneumonectomy is a surgical procedure sometimes indicated for treatment of non-small-cell lung cancer. a pneumonectomy involves removal of:
A pneumonectomy is a surgical procedure that involves the removal of an entire lung. This is sometimes indicated for the treatment of non-small-cell lung cancer, which is a type of cancer that affects the lungs.
The goal of the pneumonectomy procedure is to remove the cancerous tissue and prevent the spread of the disease. It is important to note that a pneumonectomy is a major surgery and carries significant risks, including complications such as infection, bleeding, and difficulty breathing. However, for some patients with non-small-cell lung cancer, pneumonectomy may be the best option for achieving a cure or prolonging survival.
Learn more about pneumonectomy: https://brainly.com/question/28520026
#SPJ11
What do we call it when we communicate about how we communicate?
We call how we communicate metacommunication.
What is metacommunication?A secondary communication that describes the intended interpretation of a piece of information is known as meta-communication. It is predicated on the notion that the same message conveyed through various meta-communications might signify completely different things, including their opposite, as in irony.
A secondary expression of intent, known as metacommunication, can either support or contradict what you're expressing out loud. In other words, it refers to the signals you convey to others through your body language.
Learn more about metacommunication here:
https://brainly.com/question/6001873
#SPJ1
Helppp
Why should people be concerned about the extinction of a species?
A. The extinction of a species upsets the balance of ecosystems.
B. The extinction of a species can be reversed with captive breeding.
C. The extinction of a species is an opportunity for new species to
emerge.
D. The extinction of a species increases overall biodiversity.
Answer:
A. The extinction of a species upsets the balance of ecosystems
Explanation:
Hope this helps! mark brainliest plz <3
*PLEASE ANSWER!!!* ASAP
The natural sonar function provided by a dolphin’s paralimbic node is comparable to
a.) mouths for a primate.
b.) feet for a primate.
c.) eyes for a primate.
Answer:
C, eyes of a primate
Explanation:
While dolphins can use their eyes, the sonar (also known as echolocation) can help dolphins detect things from farther away and maneuver in dark locations.
Please let me know if I'm wrong, have a nice day. :)
hey could someone help me with this immediately!! i will mark u brainiest if u don’t guess or leave a link!!!
Answer:
Chemical energy changes into thermal energy and light energy
Answer:
chemical energy changes into thermal energy and light energy
Which statement best describes an organ? A. Different types of tissues work together to carry out a function. B. Cells of one type work together to carry out a function. OC. This is the simplest level of organization of life OD. This is the most complex level of organization of life
Explanation:
The statement that best describes an organ is:
A. Different types of tissues work together to carry out a function.
An organ is a structure composed of different types of tissues that work together to perform a specific function in an organism. Organs are more complex than cells and tissues, but they are not the most complex level of organization in life. The most complex level of organization would typically refer to systems or organisms as a whole.
Which particles orbit around the nucleus?
Answer:
Negative Charged Particles which are Electrons.
Answer:
Electrons
Explanation:
What are electrons:Electrons are particles charge of negatively electricity.
Want to learn more visit this link.https://brainly.ph/question/11763549
With the consumption of the third brownie you gain a marginal utility of ___ utils.
With the consumption of third brownie we gain a marginal utility of 5 utils.
In economics, the term marginal utility means that the additional or extra benefit that a customer gets from buying an extra unit of the service. This is used by economists to evaluate and determine the rate of selling of a specific product by the consumer.
During 19th century, the concept of Marginal utility was grew by economists to analyze and explain the fundamental economic reality of price. The standard rule for marginal utility is:
Marginal utility= total utility difference/ quantity of goods difference.
To learn more about marginal utility click here:
https://brainly.com/question/15561406
#SPJ4
In humans, the ability to roll up the sides of the tongue into a U-shape is controlled by one gene. Ability to roll the tongue is dominant to the inability to roll it. If two people who can roll their tongues each had one parent who could not, what is the probability that they will have a child who cannot roll his/her tongue
Answer:
25%
Explanation:
male
can roll tongue - cannot roll tongue
female
can roll tongue - cannot roll tongue
If they have a child, the possible combinations are:
1)
father's gene: can roll tongue
mother's gene: can roll tongue
RESULT = THE CHILD WILL BE ABLE TO ROLL HIS/HER TONGUE
2)
father's gene: can roll tongue
mother's gene: cannot roll tongue
RESULT = THE CHILD WILL BE ABLE TO ROLL HIS/HER TONGUE
3)
father's gene: cannot roll tongue
mother's gene: can roll tongue
RESULT = THE CHILD WILL BE ABLE TO ROLL HIS/HER TONGUE
4)
father's gene: cannot roll tongue
mother's gene: cannot roll tongue
RESULT = THE CHILD WILL NOT BE ABLE TO ROLL HIS/HER TONGUE
apply what you know about cooling rates to explain differences in crystal sizes
The rate of cooling is inversely proportional to the crystal size. The faster the cooling rate, the smaller is the crystal size and the slower the cooling rate, the larger is the crystal.
Rate of cooling can be defined as the elimination or removal of the high temperature from any object. This removal and be slow and gradual, therefore slow rate of cooling; or it cab quick and instant, therefore, fast rate of cooling.
Crystals are the solid components whose molecules are arranges in a regular fashion, giving it an ideal 3 dimensional pattern. They are symmetrical in nature. The examples of crystals are sugars, salt, etc.
To know more about crystals, here
brainly.com/question/1212769
#SPJ1
Part C
This simulation shows only the changes in energy that cause the motion of the skateboarder. What energy
transformations are going on within the skateboarder's body during this process?
As the skateboarder moves, several energy transformations take place within their body. Some of the energy transformations include:
1. Chemical energy to kinetic energy: When the skateboarder pushes off the ground, the energy stored in the chemical bonds of their muscles is converted into kinetic energy, which is responsible for their motion.
2. Kinetic energy to gravitational potential energy: As the skateboarder moves up a ramp, their kinetic energy is converted into gravitational potential energy.
3. Gravitational potential energy to kinetic energy: When the skateboarder moves down the ramp, the gravitational potential energy is converted back into kinetic energy.
4. Kinetic energy to thermal energy: As the skateboarder moves, they also experience frictional forces which convert some of their kinetic energy into thermal energy.
5. Chemical energy to thermal energy: The continuous movement of the skateboarder requires the energy stored in their muscles to be converted into thermal energy, which is released as heat.
I hope that the assistance I provided was helpful.
The motion of the skateboarder is powered by energy transformations that occur within their body. As the skateboarder moves, their body converts stored chemical energy (from food) into kinetic energy, which is the energy of motion. This conversion happens through a series of complex biochemical processes that occur within the skateboarder's muscles.
When the skateboarder pushes off the ground, their leg muscles contract, converting chemical energy stored in the form of ATP (adenosine triphosphate) into kinetic energy as the legs move and the skateboarder accelerates. As the skateboarder continues to move, the muscles in their body work together to maintain balance and control, converting chemical energy into kinetic energy and potential energy as the skateboarder jumps, turns, and performs tricks.
Additionally, the skateboarder's body also experiences other forms of energy transformation during this process. For example, as the skateboarder moves, their body generates heat through metabolic processes, which is a form of thermal energy. The skateboarder also loses energy through friction with the ground and air resistance, which is converted into heat and sound energy.
In summary, the motion of the skateboarder is powered by a series of complex energy transformations that occur within their body. These transformations involve the conversion of stored chemical energy into kinetic and potential energy, as well as the generation of heat and sound energy through friction and air resistance.
monosaccharides and amino acids are the smallest components of carbohydrates and proteins are water-soluble nutrients that get absorbed by enterocytes and then get transported through what?
Taking in monosaccharides, amino acids, dipeptides, tripeptides, lipids, electrolytes, vitamins, and water. In the small intestine, hormones and electrolytes work to facilitate the absorption of glucose, amino acids, lipids, and vitamins.
Proteins. Prior to absorption, they are broken down into tiny peptides and amino acids. In the stomach and the large intestine, their chemical deterioration is continuing. Trypsin and chymotrypsin are two proteolytic enzymes that are released by the pancreas and break proteins down into smaller peptides. One amino acid is divided at a time by carboxypeptidase, an enzyme found in the pancreas brush boundary.
Carbohydrates. Monosaccharides, or simple sugars, are produced when some carbohydrates are broken down (e.g., glucose ). Some carbohydrates (especially starch) are converted to oligosaccharides by pancreatic amylase. Intestinal bacteria will handle additional undigested carbs in the large intestine.
Learn more about monosaccharides here:
https://brainly.com/question/13416862
#SPJ4
If you were a subject in a scientific study measuring body fatness, the scientists might assess your body composition using any of a variety of anthropometric measurements. Click and drag to match each measurement technique to its description.
Any of a number of anthropometric measurements may be used to evaluate your body composition if you were a participant in a scientific study to determine your body fatness. The location of extra body fat can significantly impact health.
What is anthropometrics and why is it significant?Anthropometrics is the process of measuring the human body and offers designers with categorized data they may use. Anthropometrics aids designers in gathering useful data, such as head circumferences when building a safety.
which are the human body and offers categorized data?Anthropometrics is the process of measuring the human body and offers designers with categorized data they may use. Anthropometrics assists designers in gathering useful data, such as head circumferences for creating a safety helmet.
To know more about anthropometric measurements visit;
https://brainly.com/question/28205500
#SPJ4
Any of a number of anthropometric measurements may be used to evaluate your body composition if you were a participant in a scientific study to determine your body fatness. The location of extra body fat can significantly impact health.
What is anthropometrics and why is it significant?Anthropometrics is the process of measuring the human body and offers designers with categorized data they may use. Anthropometrics aids designers in gathering useful data, such as head circumferences when building a safety.
Which are the human body and offers categorized data?Anthropometrics is the process of measuring the human body and offers designers with categorized data they may use. Anthropometrics assists designers in gathering useful data, such as head circumferences for creating a safety helmet.
To know more about anthropometric measurements visit;
brainly.com/question/28205500
#SPJ4
the sequence of part of an mrna transcript is 5′−augagcaacagcaagagugcggcacuguccacagag−3′ what is the sequence of the dna coding strand?
The sequence of the DNA coding strand can be determined by using the base pairing rules of DNA. DNA coding strand of mRNA transcript 5′-AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG-3′ is 5′-CTCTGTGGACAGTGCCGCAC TCTTGCTGTTGCTCAT-3′.
To determine the sequence of the DNA coding strand, we need to remember the base-pairing rules in DNA: adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C).
The mRNA sequence is given as 5′-AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG-3′.
To obtain the DNA coding strand sequence, we can first determine the complementary RNA sequence by replacing each RNA base with its complementary base.
Complementary RNA sequence: 5′-AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG-3′
Complementary DNA sequence: 3′-UACUCGUUGUCGUUCUCACACCGUGACAGGUGUCUC-5′
Note that RNA uses uracil (U) instead of thymine (T), so we used uracil in the complementary RNA sequence.
The DNA coding strand is complementary to the mRNA, so we need to take the reverse complement of the complementary DNA sequence to get the DNA coding strand sequence.
Reverse complement: 5′-CTCTGTGGACAGTGCCGCAC TCTTGCTGTTGCTCAT-3′
Therefore, the sequence of the DNA coding strand is 5′-CTCTGTGGACAGTGCCGCAC TCTTGCTGTTGCTCAT-3′.
Learn more about base-pairing rules: https://brainly.com/question/14406120
#SPJ11
16. Which statement is not true of an ecosystem F. Organism develop adaptations to survive
G. Simbiosis is the same as competition
H. Populations often compete for the same food .
I. Populations the together to form a community
Answer:
G
Explanation:
Realiza la configuracion electronica,la CEE,grupo y periodo,de cada elemento,la estructura de lewis y la formula de sarrollada de los siguientes compuestos H2O
Answer:
1s2 2s2 2p4
Explicación:
1s2 2s2 2p4 es la configuración electrónica de la molécula de agua. En el agua, hay 10 electrones, dos de hidrógeno y ocho de oxígeno. La subcapa 2s contiene un máximo de 2 electrones, mientras que la capa 2p puede acomodar seis electrones. El átomo de hidrógeno pertenece al primer grupo y el átomo de oxígeno pertenece al sexto grupo de la tabla periódica. En la estructura de Lewis, un átomo de oxígeno está unido a dos átomos de hidrógeno en un ángulo de 104,45 grados. Existe un enlace covalente presente entre el hidrógeno y el átomo de oxígeno en el que ambos se vuelven estables. El oxígeno necesita dos electrones, por lo que forma enlaces con dos átomos de hidrógeno que tienen un electrón cada uno.
which process is directly used by autotrophs to store energy in glucose?
Answer:
Photosynthesis
Explanation:
yuh