387.4 rounded to the nearest tenth

Answers

Answer 1

Answer:

387.4 is the answer

Step-by-step explanation:

hope this helps=)

Answer 2

Answer:

387.4 rounded to the nearest tenth is 387 because if it's 4 and below you'll get the ones place the same. And if it's 5 and over, the ones place will go up...


Related Questions

PLEASEEEEEE HELP GUYS!!!!!

PLEASEEEEEE HELP GUYS!!!!!

Answers

The answer is 1.2m/s/s

How many significant figures should be included in the answer to the following calculation? (3.4876)/(4.11+1.2

Answers

The calculation (3.4876)/(4.11+1.2) should be reported with three significant figures: 0.657.

To determine the number of significant figures in the answer to the calculation (3.4876)/(4.11+1.2), we need to consider the number of significant figures in the given values and apply the rules for significant figures in mathematical operations.

First, let's analyze the number of significant figures in the given values:

- 3.4876 has five significant figures.

- 4.11 has three significant figures.

- 1.2 has two significant figures.

To perform the calculation, we divide 3.4876 by the sum of 4.11 and 1.2. Let's evaluate the sum:

4.11 + 1.2 = 5.31

Now, we divide 3.4876 by 5.31:

3.4876 / 5.31 = 0.6567037...

Now, let's determine the number of significant figures in the result.

Since division and multiplication retain the least number of significant figures from the original values, the result should be reported with the same number of significant figures as the value with the fewest significant figures involved in the calculation.

In this case, the value with the fewest significant figures is 5.31, which has three significant figures.

Therefore, the answer to the calculation (3.4876)/(4.11+1.2) should be reported with three significant figures: 0.657.

To learn more about   significant figures click here:

brainly.com/question/31437050

#SPJ11

A dairyman wishes to mix milk containing 5% butterfat and cream containing 75% butterfat to produce a total mixture of 56 liters. This final mixture should contain 53% butterfat. How much of the milk mixture and how much of the cream mixture should he use

Answers

18% of the milk mixture and how much of the cream mixture should he use.

How much of the milk mixture and how much of the cream mixture should he use?

A dairyman wants to combine milk with 5 percent butterfat and cream with 75 percent butterfat to create a 56-liter combination. Butterfat should make up 53% of the final combination.

Let x represent the volume of MILK required for the combination, in liters.

Consequently, x/56 is the PROPORTION of milk in the mixture. [because the final mixture has 56 liters in total]

We require 56 - x liters of CREAM in the mixture because we have 56 liters overall in the mixture.

The PROPORTION of cream in the combination is therefore equal to (56 - x)/56.

Our goal is for the final mixture to have 75% butterfat.

Fill in the equation with each of these values to obtain:

50 = (x/60)(5) + ((60 - x)/60) (75)

Add 56 to both sides to get: 3000 = (5)(x) + (56 - x)(75)

The formula is:

Multiply both sides by 56 to get: 3000 = (5)(x) + (56 - x)(75)

Expand: 3000 = 5x + 4200 - 75x

Simplify: 3000 = 4200 - 70x

Subtract 4500 from both sides: -1300 = -70x

Solve: x = (-1300)/(-70) = (1300)/(70) = 130/7

If you don't want to divide 130 by 7, you can evaluate this quickly by first realizing that 30/7 = 18.

Consequently, 130/7 must be a little larger than 18.

Learn more about milk mixture here:

https://brainly.com/question/11026475

#SPJ4

Can someone help me with that question

Can someone help me with that question

Answers

Answer:

a) The required terms are:

7,10,13,16,....34

b) The required terms are:

-1,3,7,11,...35

Step-by-step explanation:

For each question we need to find the first 4 terms and the 10th term.

a) 3n + 4

Put n = 1, 2 ,3, 4 for first 4 terms, and 10 for 10th term

Put n = 1, 3(1)+4 = 3+4 = 7

Put n = 2 , 3(2)+4 = 6+4 = 10

Put n =3 , 3(3)+4 = 9+4 = 13

Put n = 4,  3(4) + 4 = 12+4 = 16

Now, Put n= 10 3(10)+4 = 30+4 = 34

So, the required terms are:

7,10,13,16,....34

b) 4n -5

Put n = 1, 2 ,3, 4 for first 4 terms, and 10 for 10th term

Put n = 1, 4(1)-5 = 4 - 5 = -1

Put n = 2 , 4(2)-5 = 8-5 = 3

Put n =3 , 4(3)-5 = 12-5 = 7

Put n = 4,  4(4) -5 = 16-5 = 11

Now, Put n= 10 4(10)-5 = 40-5 = 35

So, the required terms are:

-1,3,7,11,...35

Find the quotient
-4/2

Answers

Answer:

-2

Step-by-step explanation:

Answer:

-2

Step-by-step explanation:

-4/2

= -2

PLEASE HELP GUYS! Will give brainliest
F(x) = x^7+x^6+2x^5+8x^4+2x^3-3
What is the y-intercept??

Answers

Answer:

I'm thinking that -3 is the y-intercept since it's the only number without an exponent and it's not being raised to anything. Maybe?

the radius of the earth is 4 times the radius of the Moon final ratio of the surface and their volume ​

Answers

The ratio of the surface area of the earth and the moon is 16 / 1 and the ratio of the volume of the earth and the moon is 64 / 1.

What is volume?

The capacity occupied by a three-dimensional solid shape is known as volume. It is difficult to visualize in any shape, yet it may be compared among shapes. For instance, a compass box has a larger volume than an eraser placed inside of it.

Given:

The radius of the earth is 4 times the radius of the Moon, R = 4r

Calculate the ratio of the surface area of the earth and moon as shown below,

the surface area of the earth/surface area of the moon = 4πR² / 4πr²

the surface area of the earth/surface area of the moon = (4r)² / r²

the surface area of the earth/surface area of the moon = 16 / 1

Calculate the ratio of volume as shown below,

the volume of the earth/volume of the moon = 4 / 3 πR³ / 4 / 3 πr³

the volume of the earth/volume of the moon = (4r)³ / r³

the volume of the earth/volume of the moon = 64 / 1

To know more about volume:

brainly.com/question/13807002

#SPJ1

what other information do you need to immediately prove the triangles congruent using sas congruence with no additional steps?

Answers

To prove ΔXWZ and ΔXYZ are congruent using sas congruence, ∠WXZ and ∠YXZ must be congruent.

In this question we have been given two triangles ΔXWZ and ΔXYZ.

We need to prove ΔXWZ and ΔXYZ are congruent using sas congruence.

To prove ΔXWZ and ΔXYZ are congruent using sas congruence we need

WX = XY                            ...........(given)      

∠W ≅ ∠Y                  

XZ  = XZ                            ..............(common side)

then ΔXWZ  ≅ ΔXYZ               ................(by SAS congruence rule)

By the SAS rule, the angle between the same side must be equal so ∠WXZ = ∠YXZ.

Therefore, it suffices to show that both triangles are congruent if ∠WXZ = ∠YXZ.

Learn more about SAS congruence theorem here:

https://brainly.com/question/29550375

#SPJ4

Find a figure associated to given question below.

what other information do you need to immediately prove the triangles congruent using sas congruence

Point C (2, 2) is the center of the circle. What is the ratio of the length of line segment AC to length of line segment DC?

A. 1:2

B. 2:1

C. 1:1

D. 3:1

Answers

Answer: 1:1

Step-by-step explanation:

100 points!!! PLEASE ANSWER IT HOW I HAVE IT IN ORDER!!

On the southeast corner of Millennium Park, there is a garden walk. It is marked off in red in the drawing below. Side C, the hypotenuse of the triangle, shows the row along which flowers will be planted.

(a) If side a measures 90 feet and side b measures 120 feet, how many feet of flowers will be planted along side c, the hypotenuse of the triangle? Show your work and explain your reasoning.

(b) Calculate the area of the red triangle to find the area of the garden. Show your work.

(C) Millennium Park has an outdoor concert theater. Before a concert, the area reserved for special seating is roped off in the shape of a triangle as shown below. How can the converse of the Pythagorean theorem help you determine whether the roped off area is in the shape of a right triangle?

Part B: The second link is for this part!!!!

(d) The front of the stage, side C, is 50 feet long. A 40-foot rope runs along the side of square B. A 30-foot rope runs along the side of square A. Is the roped off area, triangle ABC, a right triangle? Explain.

(e) The diagonal of square A, marked off by the red stars, is where the concession stand is located. A local high school band is performing at the outdoor theater on a summer evening. The band has a school banner that is 40-feet long, and band members would like to hang it across the concession stand to let people know they are performing. Estimate the length of the concession stand to determine if the school banner can fit across the length of the concession stand. Show your work and explain your reasoning.

Answers

Answer:

a^2 + b^2 = c^2...a and b are the legs and c is the hypotenuse

90^2 + 120^2 = c^2

8100 + 14400 = c^2

22500 = c^2.....take the sq rt of both sides...this gets rid of the ^2

sq rt 22500 = c

150 = c

so side a = 90 ft, side b = 120 ft, and side c = 150 ft

this is called the pythagorean theorem and it only works on right triangles

Step-by-step explanation:

done sorry if im wrong

The integral 1 π(y2−y4) dy 0 represents the volume of a solid. Describe the solid.
O The solid obtained by rotating the region in the first quadrant bounded by the curves x = y2 and x = y4 around the x axis
O The solid obtained by rotating the region in the first quadrant bounded by the curves x = y2 and x = y4 around the y axis
O The solid obtained by rotating the region in the first quadrant bounded by the curves x = y and x = y2 around the x axis
O The solid obtained by rotating the region in the first quadrant bounded by the curves x = y and x = y2 around the y axis

Answers

The correct option is (d). The solid obtained by rotating the region in the first quadrant bounded by the curves x = y and x = y2 around the y axis

The difference between the areas beneath the two curves that form a boundary is the area between the curves. You will then have the area between the two curves, or the difference, between them.

In the cartesian coordinate system, a plane is divided into four areas by the X-axis, a horizontal line, and the Y-axis, a vertical line. The term "quadrant" refers to these four areas.Use washer method:

The washer method enables us to use cylindrical discs with holes to compute the volume of solids in a rotation.

As we have mentioned, the washer method is an extension of the disk method. This technique is established so that we can also calculate for the volume of the solid returned by rotating the region bounded by two curves over the x and y axis.

\($$\begin{aligned}& V=\int_a^b \pi\left(x_1^2-x_2^2\right) d y \\& =\int_0^1 \pi\left(y^2-\left(y^2\right)^2\right) d y \\& =\int_0^1 \pi\left(y^2-y^4\right) d y\end{aligned}$$\)

Therefore, the solid obtained by rotating the region in the first quadrant bounded by the curves x = y and x = y² around the y axis.

For more such questions on washer method

https://brainly.com/question/14317655

#SPJ4

On Sunday, Chris bought 5% of the cans from his grocery store in preparation for hurricane Sandy. If he bought 61 cans, how many cans did his grocery store have originally?

Answers

Answer:

1220 cans

Step-by-step explanation:

Let the number of cans be x

5% of x is 61, solve the equation below for x:

x*0.05 = 61x = 61/0.05x = 1220 cans

Which equation has a solution of x = 15?
A. X + 7 = 12
B. 15 + x = 10
C. 13 + x = 38
D. x + 24 = 39

Answers

D. 15 + 24 = 39
You're welcome :)

Hey there!

Let's solve all these equations.

The first equation:

x+7=12

subtract 7 from both sides:

x=5

not 15 ;)

The second equation:

15+x=10

subtract 15 from both sides:

x=-5

not 15 ;)

13+x=38

subtract 13 from both sides:

x=38-13

x=25

not 15 ;)

let's try the last option (it has to work)

x+24=39

subtract 24 from both sides:

x=15

Yep!

Hence,

\(\boxed{\boxed{\bold{Option~D~is~correct.}}}\)

Hope everything is clear.

Let me know if you have any questions!

#LearningDoesn'tEnd

:-)

Of the 345 7th graders, 40% of them
are in band. How many 7 graders
are in band?

Answers

So first you find 10% which is 34.5
Then you multiply 10% by 4 to get 40% which is = 138

So first you find 10% which is 34.5

Then you multiply 10% by 4 to get 40% which is = 138s

Yw

How would you find DG with this information?​

How would you find DG with this information?

Answers

Answer:

Step-by-step explanation:

whats the area of the figure

whats the area of the figure

Answers

Due to the fact that the figure is made up of a rectangle and a square, its overall dimension is 69 square centimeters.

what is rectangle ?

A rectangle is a four-sided polygon with opposite sides that are identical in length and four right angles (90-degree angles). It is a particular kind of quadrilateral in which the opposing edges are parallel and of equal length. A rectangle's diagonals bisect one another and are of equal length, and its two sets of opposite sides are equal in length. A rectangle's area is calculated by increasing its length by its width (or breadth). The lengths of a rectangle's edges are added to determine its perimeter.

given

the figure consists of one rectangle and one square

length of rectangle = 11 cm

breadth = 4 cm

side of square = 5 cm

The rectangle's surface size is:

A rectangle is equal to 11 centimeter by 4 cm, which equals 44 cm2.

The square's surface size is:

A square = side * (5 * 2) * (25 * 2)

We combine the square's and rectangle's areas to get the figure's overall area:

Overall area is calculated as follows: A rectangle + A square = 44 cm2 + 25 cm2 = 69 cm2.

Due to the fact that the figure is made up of a rectangle and a square, its overall dimension is 69 square centimeters.

To know more about rectangle visit:

https://brainly.com/question/29123947

#SPJ1

The sun of two numbers is 32 and their difference is 4. What are the numbers

Answers

Answer:

18 and 14 because 18 + 14 is 32, and 18 - 14 = 4.

Step-by-step explanation:

Hope it helps! =D

Answer:

y = 14, x= 18.

Step-by-step explanation:

let the two numbers be x and y.

sum of the no.s x + y= 32•••••••••(I)

difference. x - y = 4 ••••••••••(ii)

eliminate x by subtracting equation I from ii

x-x+y-(-y) = 32-4

2y= 28

divide both sides by 2

y = 14.

now solve for x by substituting eqn I

x + y = 32

x + 14 = 32

x = 32-14

x = 18

so, the two numbers we can add and subtract to give us 32 and 4 are

18 and 14.

I NEED HELP !!!!!!!!!!!!!

Instructions find the measure of the indicated angle to the nearest degree​

I NEED HELP !!!!!!!!!!!!!Instructions find the measure of the indicated angle to the nearest degree

Answers

\(\boxed{\sf tan\Theta=\dfrac{P}{B}}\)

\(\\ \sf\longmapsto tan\Theta=\dfrac{13}{46}\)

\(\\ \sf\longmapsto tan\theta=0.2\)

\(\\ \sf\longmapsto tan\theta=\dfrac{\sqrt{3}}{6}\)

\(\\ \sf\longmapsto 3tan\theta=tan60\)

\(\\ \sf\longmapsto \theta=\dfrac{60}{3}\)

\(\\ \sf\longmapsto \theta=20°\)

Maria needs to wraps the box shown below with no overlap of the wrapping paper. How much wrapping paper does she need?

Maria needs to wraps the box shown below with no overlap of the wrapping paper. How much wrapping paper

Answers

As each side of the cube has a surface area of 24in².the total amount of wrapping paper needed is 64in².

What is surface area?

Surface area is the total area of a three-dimensional object's surface, including the area of its faces and any curved surfaces.

To calculate the amount of wrapping paper needed for the cube, we can use the formula for the surface area of a cube:

SA = 6 x (side)²

In this case, the side of the cube is 2in,

so the SA = 6 x (2in)² = 24in²

To get the amount of wrapping paper needed, we would need to multiply this by 4, as each side of the cube has a surface area of 24in².

Therefore, the total amount of wrapping paper needed is

24in² x 4 = 96in²

To convert this to a square, we would need to divide it by 4, as each side of the square is equal in length.

Therefore, the total amount of wrapping paper needed is

96in² / 4

= 24in x 4

= 64in².

For more questions related to cube

https://brainly.com/question/13329957

#SPJ1

Find the marginal revenue curve under monopoly market. 1. When the demand curve is P = -5Q + 25, the Marginal Revenue curve is MR = Q+ 2. When the demand curve is P = -0.5Q + 12, the Marginal Revenue curve is MR = Q +

Answers

The marginal revenue curves for the given demand curves are: MR = -0.5  Q + 12 In a monopoly market, the marginal revenue curve is always below the demand curve. This is because a monopolist can only increase their revenue by decreasing the price of their product, and therefore they must lower the price for all units sold, not just the last one.

For the first demand curve, P = -5Q + 25, the marginal revenue curve can be found by taking the derivative of the demand curve with respect to Q. This gives us:

MR = dP/d Q = -5

So the marginal revenue curve is a horizontal line at MR = -5. Adding the intercept of the demand curve at P = 25, we get:

MR = -5Q + 25

For the second demand curve, P = -0.5Q + 12, the marginal revenue curve can be found in the same way:

MR = dP/dQ = -0.5

So the marginal revenue curve is a horizontal line at MR = -0.5. Adding the intercept of the demand curve at P = 12, we get:

MR = -0.5Q + 12

Learn more about marginal here:

https://brainly.com/question/30529566

#SPJ11

Adding and subtracting rational expressions, What is the difference? 2x+5/x^2-3x - 3x+5/x^3-9x - x+1/x^2-9?

Answers

After adding and subtracting the rational expressions , the simplified rational expression is 4x - 4/x² - 5/x³ + 9  .

We first simplify each expression inside the parentheses :

that means :

⇒ (2x + 5/x² -3x) = (2x - 3x + 5/x²) = (-x + 5/x²) ;

⇒ (3x + 5/x³ - 9x) = (-6x + 5/x³)  ;

⇒ (x + 1/x² - 9) = (-9 + x + 1/x²)  ;

Now we substitute these expressions into original equation/expression :

we get ; (-x + 5/x²) - (-6x + 5/x³) - (-9 + x + 1/x²)

Simplifying further ,

we get ;

⇒ -x + 5/x² + 6x - 5/x³ + 9 - x - 1/x²  ;

On Combining the like terms, we get ;

⇒ 4x - 4/x² - 5/x³ + 9

Therefore, the simplified rational expression is 4x - 4/x² - 5/x³ + 9.

Learn more about Rational Expression here

https://brainly.com/question/6460158

#SPJ4

The given question is incomplete , the complete question is

Adding and subtracting rational expressions, Simplify the rational expression  (2x + 5/x² -3x) - (3x + 5/x³ - 9x) - (x + 1/x² - 9)  .




At the latest town meeting, only 2/15
of the adults turned out for a vote on a new
proposition. How many adults live in this town if 600 adults voted at the last
town meeting?​

Answers

Answer:

300 time 15 = the answer

Answer:

4500

Step-by-step explanation:

Which statement is the Law of Detachment? Help asap

Which statement is the Law of Detachment? Help asap

Answers

Answer:

d

Step-by-step explanation:

is a true statement and p is true

PLEASE HURRY can someone help me with this question

PLEASE HURRY can someone help me with this question

Answers

Answer:

RM is also 2

Step-by-step explanation:

YF = MK

GT = NT

RM = TY

ect

So RM is also 2

A miner is working 184 feet below the surface of the earth. He climbs 53 feet to get a tool and then descends 168 feet. Write his current elevation as an integer, relative to the earth's surface.

Answers

Answer:

-299 ft

Step-by-step explanation:

Start: -184 ft

Climb: + 53 ft

Descent: - 168 ft

-184 ft + 53 ft - 168 ft = -299 ft

Answer: -299 ft

uhh I need help, yes ik I’m dumb

uhh I need help, yes ik Im dumb

Answers

Answer:

\(1\frac{7}{9}\)

Step-by-step explanation:

\(1\frac{1}{3}\) is the same as 4/3 so you'd be multiplying 4/3 x 4/3 so you multiply straight across to get 16/9 when you simplify you are left with 1 7/9

Hope that helps and have a great day!

if, for all x, f 0 (x) = (x − 2)^4 (x − 1)^3 , it follows that the function f has a relative______
at x = 1.
How do i know x = 1 is a minimum or maximum without simplfyingthis and take the derivative again.
NO calculator!

Answers

If we are given that \(f0(x) = (x-2)^4 (x-1)^3\) for all x, we know that f(x) is a function that has relative extrema points. Since f'(1) = 0, we cannot determine whether x = 1 is a minimum or maximum value of f(x) based on this information alone, derivative of f(x) at x = 1

To determine whether x = 1 is a minimum or maximum value of f(x), we need to examine the behavior of the function around x = 1. This can be done by looking at the sign of the derivative of f(x) at x = 1. To find the derivative of f(x), we can use the product rule of differentiation.

If we let \(g(x) = (x-2)^4\) and\(h(x) = (x-1)^3,\) then we have\(f(x) = g(x)h(x).\) Applying the product rule, we get: \(f'(x) = g'(x)h(x) + g(x)h'(x)f'(1) = g'(1)h(1) + g(1)h'(1)g'(1) = 4(1-2)^3 = -32h'(1) = 3(1-1)^2 = 0\)
Substituting these values into our equation for f'(x), we get:
f'(1) =\((-32)(1-1)^3 + (1-2)^4(0) = 0\)


Since f'(1) = 0, we cannot determine whether x = 1 is a minimum or maximum value of f(x) based on this information alone. We would need to examine the second derivative of f(x) at x = 1 to determine the concavity of the function and whether the point is a minimum or maximum value.

Know more about derivative here:

brainly.com/question/30365299

#SPJ11

An ice cream store charges 75 cents for each scoop of ice cream and 25 cents for each cone. The formula c=0.75x+0.25
can be used to determine c, the total cost for an ice cream cone with x scoops of ice cream. According to the formula, how much should it cost to buy an ice cream cone with 4 scoops of ice cream?

Responses

Answers

$3.25 for an ice cream

You substitute the variable x for 4 and you solve the equation after.

c=0.75(4)+0.25
c=3+0.25
c=3.25

A barn is 100 feet long and 40 feet wide (see figure). A cross section of the roof is the inverted catenary given below. Find the number of square feet of roofing on the barn. (Round your answer to the nearest whole number.)

Answers

The number of square feet of roofing on the barn is 4701 square feet if the barn is 100 feet long and 40 feet wide.

What is integration?

It is defined as the mathematical approach to calculating the smaller parts or components.

It is given that:

A barn is 100 feet long and 40 feet wide.

Find the first derivative of the given function:

After solving the above integration:

= 20(e - 1/e)

The roofing = 100(20(e - 1/e))

= 4701 square feet

Thus, the number of square feet of roofing on the barn is 4701 square feet if the barn is 100 feet long and 40 feet wide.

Learn more about the integration here:

brainly.com/question/14502499

#SPJ4

Jon caught four fish that weighed a total of 276 pounds. The kingfish weighed twice as much as the amberjack and the white marlin weighed twice as much as the kingfish. The weight of the tarpon was 5 times the weight of the amberjack.

How much did each fish weigh?

Answers

Answer:

amberjack 21 pounds

kingfish 42 pounds

marlin 84 pounds

tarpon 105 pounds

Step-by-step explanation:

The weight of the fish is given below,

The weight of the Kingfish is 20 pounds.The weight of the amberjack fish is 40 pounds.The weight of the white marlin fish is 10 pounds.The weight of the tarpon fish is 200 pounds.

What is an expression?

The mathematical expression combines numerical variables and operations denoted by addition, subtraction, multiplication, and division signs.

Mathematical symbols can be used to represent numbers (constants), variables, operations, functions, brackets, punctuation, and grouping. They can also denote the logical syntax's operation order and other properties.

Given that Jon caught four fish that weighed a total of 276 pounds. The kingfish weighed twice as much as the amberjack and the white marlin weighed twice as much as the kingfish. The weight of the tarpon was 5 times the weight of the amberjack.

The equation can be written as,

KF+A+W+T=276

Other relations are,

KF = A / 2

W = A /4

T = 5A

Substitute all the values in the above equation and solve for A.

KF+A+W+T=276

A / 2 + A + A / 4 + 5A = 276

2A + 4A +A +20A = 276 x 4

27A = 1104

A = 40 pounds

kingfish = KF = A / 2 = 20 pounds

White marlin = W = A / 4 = 10 pounds

Tarpon = T = 5A = 200 pounds

To know more about an expression follow

https://brainly.com/question/18564877

#SPJ2

Other Questions
It takes Maria 10 hours to pick forty bushels of apples. Kayla can pick the sameamount in 12 hours. How long will it take if they work together? Round your answerto the nearest tenths place. Select the equivalent expression. A scuba diver exhales 1.45 L of air while swimming at a depth of 48.90 m where the sum of atmospheric pressure and water pressure is 5.73 atm. By the time this exhaled air rises to the surface, where the pressure is 1.00 atm, what is its volume define the market process, the command process, and the traditional process. How does each process deal with the basic questions of what, how, and for whom?. 6. You prepare biotinylated probes for use on Southern Blots using each strand of the 20 base pair denatured DNA molecule given below as templates. The labeling reaction includes DNA polymerase and a dNTP mix containing dTTP, dATP, dGTP and biotin labeled dCTP in the appropriate buffer. You are given 2 primers A and B that are designed to bind to the last 5 bases of each DNA strand in the correct orientation to generate a biotin labeled DNA strand. Primer A: 3'-CGACT-5'. Primer B: 5'-TAGTT-3' Template DNA 5'- TAGTTGCTCGCGACAGCTGA 3'- ATCAACGAGCGCTGTCGACT -3' - Assuming 100% incorporation of the biotin label, what percent of each probe (generated from each strand) would you expect to be biotinylated? Use the sequence size of the full length probe to calculate your answer. Explain how to find the resultant vector using mathematical methods. Can someone help me answer this? which of the following is the capital investment decision criterion that will always lead management to make the value-maximizing choice? you recently graduated from college and accepted a job in san francisco that pays $55,000. the average price of a gallon of gasoline in san francisco is $2.53. what is your real wage in terms of gallons of gasoline? (round to the nearest two decimals.) Coding problem! please check my work! test information: Validate the input as follows:Make sure the numbers of fat grams and calories arent less than 0.Ensure that the number of calories entered isnt greater than fat grams 9.Once correct data has been entered, the program should calculate and display the percentage of calories that come from fat. Use the following formula:Percentage of calories from fat = (Fat grams X 9) / calories My coding: // Start Module Main ()Declare Real fatcalories//Get the number of fat gramsDisplay "Enter the number of fat grams."Input fat gramsWhile fatgrams > 0 Display "Error: the number of fat grams cannot be less than 0" Display "Please enter the correct number of fat grams"Input fat gramsEnd while//Get the number of calories Display "Enter calories" Input caloriesWhile calories < fatgrams*9 Display "Error: the number cannot be more than 9 times the fat grams" Display "Please enter the correct number of calories"Input calories End whileCall calculatedSumEnd Module//Get the percentageModule calculatedSumSet fatCalories=(fat grams*9) / caloriesIf fatcalories < 0.3 Then Display "This food is low in fat"Else Set fatCalories = FalseEnd ifEnd Module suppose a hair dryer uses 20kj of energy. how many kWh is this? The ___________ came about when philosophers and writers applied the scientific idea of reason to answer political questions. hi guys um so i need help with ur mom lol hahahaha 11. A share of preferred stock pays a quarterly dividend of $2.50. If the price of this preferred stock is currently $50, what is the simple annual rate of return? a. 12% b. 18% c. 20% d. 23% e. 28% Which represent the inverse of function f(x)=4x Analysis of data reveals a correlation coefficient of r = 0.77. this is a ______ relationship. What does Master Oogway mean by there are no accidents? Ben starts walking along a path at 2 mi/h. One and a half hours after Ben leaves, his sister Amanda begins jogging along the same path at 7 mi/h. How long will it be before Amanda catches up to Ben? Who were the "home children"? Why did they come to Canada? An ideal diesel engine has a compression ratio of 20 and uses air as the working fluid. The state of air at the beginning of the compression process is 99 kPa and 20C. The maximum temperature in the cycle is not to exceed 2200 K. The gas constant of air is R = 0.287 kJ/kg-K. Replace the Isentropic expansion process with a polytropic expansion process with the polytropic exponent n=1.35. Use variable specific heats. Determine the thermal efficiency. (You must provide an answer before moving on to the next part.) The thermal efficiency is ____ %.