5,11,0,-3, and -3/2 in order form least to greatest

Answers

Answer 1

Answer:

-3, -3/2, 0, 5, 11

Step-by-step explanation:

-3/2 = -1.5

-3, -3/2, 0, 5, 11

Answer 2

Answer:

-3, -3/2, 0, 5, 11

Step-by-step explanation:


Related Questions

What is 0.55 hectometers expressed in decimeters?a.550 dmb.5.5 dmc.55 dmd.0.00055 dmwhat is 0.55 hectometers expressed in decimeters? a.550 dmb.5.5 dmc.55 dmd.0.00055 dm brainly

Answers

The value of 0.55 hectometers expressed in decimeters is 550 decimeters. The result is obtained by using the concept of unit ladder system.

How the unit ladder method works?

The common length units are kilometers to milimeter. The conversion can be described in a unit ladder system as follows.

km (kilometers)

  hm (hectometers)

     dam (decameters)

        m (meters)

           dm (decimeters)

              cm (centimeters)

                  mm (millimeters)

Every time the length unit goes down, it is multiplied by ten. Every time the length unit goes up, it is divided by ten.

We have 0.55 hectometers. Express that value in decimeters!

From hectometers to decimeters, it goes down 3 times. So,

0.55 hectometers = 0.55 × 10 × 10 × 10 decimeters

0.55 hectometers = 0.55 × 1000 decimeters

0.55 hectometers = 550 decimeters

Hence, 0.55 hectometers is equal to 550 decimeters.

Learn more about length conversion here:

brainly.com/question/23883224

#SPJ4

strengths and limitations of visually interpreting histograms

Answers

Therefore, visually interpreting histograms can be a powerful tool for data analysis, but it is important to be aware of their strengths and limitations.

Histograms are an effective way to display data graphically. They are used to show how often certain values or ranges of values appear in a data set. Visual interpretation of histograms has many strengths and limitations. Some of the strengths of visually interpreting histograms are that they are easy to read and understand, they provide a clear picture of how the data is distributed, and they can help identify outliers or gaps in the data. However, some of the limitations of visually interpreting histograms are that they can be influenced by the number of bins chosen, the way the data is grouped, and the choice of the scale used. Therefore, it is important to carefully consider these factors when interpreting a histogram. In conclusion, visually interpreting histograms can be a powerful tool for data analysis, but it is important to be aware of their strengths and limitations.

Therefore, visually interpreting histograms can be a powerful tool for data analysis, but it is important to be aware of their strengths and limitations.

To know more about statement visit :

https://brainly.com/question/27839142

#SPJ11

X =
In the diagram below, ZHDA and ZADR are supplementary.
(7x-3)°
(2r-6)°
H
D
What is the value of r?
R

X =In the diagram below, ZHDA and ZADR are supplementary.(7x-3)(2r-6)HDWhat is the value of r?R

Answers

The numerical value of x in the supplementary angle is 21.

What is the numerical value of x?

The supplementary angles are simply angles having the summation of 180 degrees.

From the diagram:

Angle HDA = ( 7x - 3 ) degrees

Angle ADR = ( 2x - 6 ) degrees

Since, angle HDA and angle ADR are supplementary angles, their sum will equal 180 degrees.

Hence:

Angle HDA + Angle ADR = 180

Plug in the values and solve for x:

( 7x - 3 ) + ( 2x - 6 ) = 180

7x - 3 + 2x - 6 = 180

Collect and add like terms

7x + 2x - 6 - 3 = 180

9x - 9 = 180

9x = 180 + 9

9x = 189

Divide both sides by 9

x = 189/9

x = 21

Therefore, the value of x is 21.

Learn about complementary angles here:

brainly.com/question/20728641

#SPJ1

The map shows the location of the mall, library, and school in the city; Brittany travels from the school to the mall and then from the mall to the library. Alice traveled directly from the school to the library. How many more miles to Britney travel than Alice? A. 8 miles B. 9 miles C. 10 miles D. 12 miles

Answers

Answer:A) 8 miles

Step-by-step explanation:

8 miles

Which two phrases convey unease in the excerpt? excerpt adapted from the count of monte cristo

Answers

The two phrases that convey unease in the excerpt from "The Count of Monte Cristo" are "trembling voice" and "shudder ran through the assembly."

The phrase "trembling voice" suggests unease as it implies fear or anxiety, indicating that the speaker is not confident or composed. The use of the word "trembling" evokes a sense of vulnerability or apprehension. This phrase suggests that something unsettling or concerning is happening, leading to unease among the characters.

The phrase "shudder ran through the assembly" also conveys unease. The word "shudder" implies a sudden, involuntary movement or reaction, often associated with fear or discomfort. The fact that it runs through the entire assembly suggests a collective feeling of unease or disturbance. This phrase indicates that something unsettling or unsettling news has been shared, causing an uncomfortable and uneasy atmosphere among the people present.

To learn more about phrases: -brainly.com/question/1445699#SPJ11

What is the area of this figure?

What is the area of this figure?

Answers

Answer:

24

Step-by-step explanation:

Rect = 3*4 = 12

Rect 2 = 1*6 = 6

Triangle = (6-3)*1/2*4 = 6

6 + 6 + 12 = 24

Can someone please answer this please

Can someone please answer this please

Answers

D) (3,3)
E) (-5,0)
F) (-2,2)

what is the average rate of change of the function g(t) over the interval from t = a to t = b?

Answers

Average rate of change gives us the slope of the secant line that connects the two points on the graph of g(t) corresponding to t = a and t = b. This can help us understand how quickly the function is changing over the interval and can be useful in many applications.

How to find the average rate of change of a function g(t) over the interval from t = a to t = b?

We need to use the formula:

average rate of change = (g(b) - g(a))/(b - a)

Here, g(b) represents the value of the function at t = b and g(a) represents the value of the function at t = a.

We can use this formula to calculate the average rate of change of g(t) over the given interval. Just substitute the values of g(a), g(b), a, and b into the formula and simplify the expression to get the answer.

Learn more about average rate of change.

brainly.com/question/28744270

#SPJ11

what property does 5(a) = a(5) belong to?

Associative Property

Commutative Property

Inverse Property

Identity Property

Answers

Answer:

Commutative Property for Multiplication

Answer:

Commutative Property for Multiplication

Step-by-step explanation:


Find the x- and y-intercepts of the graph of x — 6y= 15. State each answer as an
integer or an improper fraction in simplest form.

Answers

Answer:

x-int = (15,0)

y-int = (0, -5/2)

Step-by-step explanation:

I did this by hand and then checked my work w a calculator. Hope this helps! :)

how can you find dictance between points and cordinte plances

Answers

Answer:

Distance = \(\sqrt{(x^{2}-x,)^{2} +(y^{2} -y,)^{2}\)

"Demetrius' local cell phone company charges for how much data he uses each month. The first 10 GB of data he uses costs $3 per GB. Once he exceeds the 10 GB, the company then charges $15 for each GB after. "

"Demetrius' local cell phone company charges for how much data he uses each month. The first 10 GB of
"Demetrius' local cell phone company charges for how much data he uses each month. The first 10 GB of
"Demetrius' local cell phone company charges for how much data he uses each month. The first 10 GB of
"Demetrius' local cell phone company charges for how much data he uses each month. The first 10 GB of

Answers

Given:

The first 10 GB of data costs $3 per GB.

After exceeds 10 GB, the company charges $15 for each GB.

Required:

We need to find the function for the given situation.

Explanation:

Let x be the number of GB that "Demetrius' used.

Let f(x) be the cost.

The first 10 GB of data costs $3 per GB.

\(\text{The first 10 Gb can be written as }0\leq x\leq10.\)\(f(x)=3x\text{ if }0\leq x\leq10.\)

After exceeding 10 GB, the company charges $15 for each GB

\(After\text{ exceeding 10 GB can be written as }x>!0\)\(f(x)=15x\text{ if }x>10\)

Final answer:

\(f(x)=\begin{cases}{3x\text{ if }0\leq x\leq10.} \\ {15x\text{ if }x>10.}\end{cases}\)

I need to show
My work

I need to showMy work

Answers

The expression 5/6 +(1/6 +2/7) follows the associative property of addition. So, the correct option is A.

What is associative property of addition?

The associative property of addition states that the sum of three or more numbers remains the same irrespective of how the numbers are grouped.

A) 5/6 +(1/6 +2/7)

5/6 +(1/6 +2/7) =(5/6 +1/6) +2/7

⇒ 5/6 +(7/42 +12/42) = 6/6 +2/7

⇒ 5/6 +19/42 = 1+2/7

⇒ 35/42 +19/42= (7+2)/7

⇒ (35+19)/42 =9/7

⇒ 54/42 =9/7

⇒ 9/7 =9/7

LHS=RHS

This expression follows the associative property of addition

B) 3.1+(-5.89+5.89)

3.1+(-5.89+5.89)=(3.1+(-5.89))+5.89

⇒ 3.1+0=(3.1-5.89)+5.89

⇒ 3.1=-2.79+5.89

⇒ 3.1=3.1

C) (3/4 ×4/3)×6

This expression follows the associative property of multiplication

D) (2/9 +5/9)-4/5

The expression does not follow the associative property of addition

Expression follows associative property is 5/6 +(1/6 +2/7). Therefore, option A is the correct answer.

Learn more about the associative property of addition here:

https://brainly.com/question/28762453.

#SPJ1

A ________ arrangement is a formal, equilateral triangular design. a. Grid b. Radial c. Symmetrical d. Triangular

Answers

Answer:

SYMMETRICAL DESIGN: A formal, equilateral triangular design. ROUND DESIGNS: Do not require a focal point. HOOK METHOD: Wiring technique in which the wire is inserted through the flower and a small hook is formed in the wire before it is pulled back into the flower.

Step-by-step explanation:

A triangular arrangement is a formal, equilateral triangular design. Option D

What is a triangular arrangement?

A formal, equilateral triangle pattern is referred to as a triangular arrangement. It entails arranging components or things in a configuration that resembles an equilateral triangle.

In a variety of disciplines, including art, architecture, and landscaping, this arrangement is used. All three sides of the equilateral triangle are identical in length, and all three angles are 60 degrees.

As the equilateral triangle is seen as a stable and aesthetically beautiful shape, the triangular arrangement is frequently employed to establish balance, harmony, and aesthetic appeal in a design.

Learn more about triangular arrangement at: https://brainly.com/question/30417639

#SPJ4

The following diagram shows part of a circle with centre O and radius 4 cm. Chord AB has a length of 5cm and AOB = 0​

Answers

The value of θ is 1.35 radians. The solution has been obtained by using trigonometry.

What is trigonometry?

The field of mathematics known as trigonometry is responsible for studying the sides, angles, and connections of the right-angle triangle.

We are given a circle with centre O and radius 4 cm. The length of chord AB is given as 5cm.

In triangle AOB, we will draw a perpendicular bisector on the chord AB.

Using trigonometry,

We know that sin Ф = opposite side/hypotenuse

So, in the newly formed triangle,

⇒sin Ф = AD/OA

⇒sin Ф = (5/2) / 4

⇒sin Ф = 5/8

⇒sin Ф = sin (0.675)

⇒Ф = 0.675

So,

θ = 2 * 0.675

θ = 1.35 radians

Hence, the value of θ is 1.35 radians.

Learn more about trigonometry from the given link

https://brainly.com/question/13729598

#SPJ1

The complete question has been attached below.

The following diagram shows part of a circle with centre O and radius 4 cm. Chord AB has a length of

Jonathan forgot his math homework on the kitchen table and left for school without it. He biked at the speed of 15 mph. His mother saw the homework when he was already 1 mile from home, and started chasing him. She drove at a speed of 25 mph and caught him at the school entrance. How far is the school from Jonathan's home?

Answers

Answer:

2.5 miles

Step-by-step explanation:

Let the distance be x

Then Jonathan biked for

x/15 hours

His mother drew for

x/25 hours

The time difference is

1/15 hours

So we have

x/15 - 1/15 = x/25(x - 1)/15 = x/2515x = 25x - 2525x - 15x = 2510x = 25x = 25/10x = 2.5 miles

birthdays of 10 members of a club are assumed to be independently and uniformly distributed over the twelve months of the year. let z be the number of months in which at least one member has a birthday. find e(z).

Answers

E(z),the expected value of z in which at least one member has a birthday in 12 months is (11/12)^10

Define the random variable Zi’s as

\(Z_{i}\)= 1 : if no member of the club has a birthday in the month

   = 0: otherwise   for, i =1,2, ......,12 .

Now, we have,

= P (\(Z_{i}\) =1) .

=p( no member of the club has a birthday in month i).

= p, say.

Now, there are a total of 10 members in the club and their birthdays are assumed to be independently and uniformly distributed over the 12 months of the year. So, there are 12 possible choices of months for each of the 10 members for their birthday. Thus, the total no. of exhaustive mutually exclusive and equally likely no. of ways of birthdays 12^10.

Again, if no member of the club has a birthday in month 'i'; then, all of their birthdays should be on the remaining (12 - 1) = 11 months of the year. So, there are possible choices of birthday months for each of the 10 members of the club. So, the no. of cases for the event (Zi=1) is 11^10.

So, p(\(Z_{i}\)=1) = Favorable no. of cases for Zi=1) / Total no. of all possible cases

= 11^10 / 12^10

By the classical definition of probability.

= (11/12)^10

p(\(Z_{i}\) = 1) = (11/12)^10

E(Zi).= (11/12)^10

Learn more about expected value Visit : brainly.com/question/17279079

#SPJ4

Consider the following data drawn independently from normally distributed populations: (You may find it useful to appropriate table: z table or t table)
xˉ1 = −17.1
s1^2 = 8.4
n1=22
​xˉ2 = −16.0
s2^2 = 8.7
n2 = 24

a. Construct the 90% confidence interval for the difference between the population means. Assume the population va unknown but equal. (Round final answers to 2 decimal places.)
confidence interval is __ to __

Answers

The 90% confidence interval for the difference in the population means is -2.51 to 0.31

Calculating the 90% confidence interval for the population mean difference  

From the question, we have the following parameters that can be used in our computation:

xˉ₁ = −17.1

s₁² = 8.4

n₁ = 22

​xˉ₂ = −16.0

s₂² = 8.7

n₂ = 24

Calculate the pooled variance using

P = (df₁ * s₁² + df₂ * s₂²)/df

Where

df₁ = 22 - 1 = 21

df₂ = 24 - 1 = 23

df = 22 + 24 - 2 = 44

So, we have

P = (21 * 8.4 + 23 * 8.7)/44

P = 8.56

Also, we have the standard error to be

SE = √(P/n₁ + P/n₂)

So, we have

SE = √(8.56/22 + 8.56/24)

SE = 0.86

The z score at 90% CI is 1.645, and the CI is calculated as

CI =  (x₁ - x₂) ± z * SE

So, we have

CI = (-17.1 + 16.0) ± 1.645 * 0.86

This gives

CI = -1.1 ± 1.41

Expand and evaluate

CI = (-2.51, 0.31)

Hence, the confidence interval is -2.51 to 0.31

Read more about confidence interval at

https://brainly.com/question/15712887

#SPJ1

please helppppppp :(((

please helppppppp :(((

Answers

Answer:

y = 1/2x - 1

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDASEquality Properties

Algebra I

Slope Formula: \(m=\frac{y_2-y_1}{x_2-x_1}\)

Slope-Intercept Form: y = mx + b

m - slope b - y-intercept

Step-by-step explanation:

Step 1: Define

Find points from the graph.

x-intercept (2, 0)

y-intercept (0, -1)

Step 2: Find slope m

Substitute:                    \(m=\frac{-1-0}{0-2}\)Subtract:                       \(m=\frac{-1}{-2}\)Simplify:                        \(m=\frac{1}{2}\)

Step 3: Write linear equation

y = 1/2x - 1

Answer:

its y = 1/2 x - 1

Step-by-step explanation:

why did math tutor delete my question?!?!??!

please help on a test!!!

Solve the system using inverse
matrices.
5x – 4y = 3
(2x + 3y = 38

please help on a test!!! Solve the system using inversematrices.5x 4y = 3(2x + 3y = 38

Answers

Answer:(7, 8)

Step-by-step explanation:

a symbol used to name one or more parts of a whole or asset or a location on the number line is a

Answers

Answer:

Fraction is the answer

In the diagram, ABCD ~ EFGH . Find the area of ABCD.

In the diagram, ABCD ~ EFGH . Find the area of ABCD.

Answers

Answer:

150 in ^2

Step-by-step explanation:

150 inches





llllllllllllllllllllllllllllllllllllllllllll

Mr Mushnik is 47, his twin brothers are 56 and his twin sisters are 59.
What will the sum of their ages be in 17 years time?

Answers

Answer:

362 is the answer

Step-by-step explanation:

The sum of their ages be in 17 years time is 362 years.

Given that, Mr.Mushnik is 47, his twin brothers are 56 and his twin sisters are 59.

What is the average?

The average value in a set of numbers is the middle value, calculated by dividing the total of all the values by the number of values. When we need to find the average of a set of data, we add up all the values and then divide this total by the number of values.

In 17 years time:

Mr.Mushnik age is 47+17=64

Twin brothers are 2(56)+2(17)

=112+34=146

Twin sisters are 2(59)+2(17)

= 118+34=152

Sum of their ages = 64+146+152

= 362

Therefore, the sum of their ages be in 17 years time is 362 years.

To learn more about an average visit:

https://brainly.com/question/11195029.

#SPJ2

Explain the difference for the equation between the vertical asymptotes and the holes.

Answers

The difference in the equation between the vertical asymptotes and the holes is explained below.

A hole is a place on the graph where the function's value is not defined. When a rational function's numerator and denominator have a common factor, they cancel when simplified. The deleted value leaves a gap in the graph.

Asymptotes are imaginary lines that are very close to the whole graph of a function or a segment of the graph. An asymptote is a line that a function's graph approaches when x or y approaches positive or negative infinity. Asymptotes are classified into three types: vertical, horizontal, and oblique. When a factor in the denominator does not cancel, a vertical asymptote is produced.

To learn more about asymptotes, visit :

https://brainly.com/question/4084552

#SPJ9

PLEASE ONLY ANSWER IF YOU CAN EXPLAIN IT AND ITS !100% RIGHT ILL GIVE $% POINTS

PLEASE ONLY ANSWER IF YOU CAN EXPLAIN IT AND ITS !100% RIGHT ILL GIVE $% POINTS

Answers

Answer:

A.

Step-by-step explanation:

Graphed.

4.27 Working backwards, one-sided. You are given the following hypotheses: H0 :μ=30
HA :μ>30
We know that the sample standard deviation is 10 and the sample size is 70. For what sample mean would the p-value be equal to 0.05? Assume that all conditions necessary for inference are satisfied.

Answers

The population mean is greater than 30.To determine the sample mean that would result in a p-value of 0.05, we need to work backwards from the given significance level.

First, we need to find the test statistic. Since the alternative hypothesis is one-sided (μ>30), we will use a one-sample z-test. The test statistic is calculated as:

z = (xbar - μ) / (s / sqrt(n))

where xbar is the sample mean, μ is the hypothesized population mean under the null hypothesis, s is the sample standard deviation, and n is the sample size.

Since we want the p-value to be equal to 0.05, we need to find the z-score that corresponds to a one-tailed area of 0.05. Using a standard normal distribution table or calculator, we find that this z-score is 1.645.

Substituting this value into the formula for the test statistic, we get:

1.645 = (xbar - 30) / (10 / sqrt(70))

Solving for xbar, we get:

xbar = 30 + 1.645 * (10 / sqrt(70))

xbar = 31.77

Therefore, the sample mean that would result in a p-value of 0.05 is 31.77. This means that if we were to obtain a sample mean of 31.77 or higher, we would reject the null hypothesis at a significance level of 0.05 in favor of the alternative hypothesis that the population mean is greater than 30.

learn more about sample mean here: brainly.com/question/17514579

#SPJ11

Consider a random variable X that denotes a random delivery time anywhere between 9 am and 10 am . X would reasonably be

Answers

X is a continuous uniform random variable with a mean of 9.5 am and a variance of 1/12.

How to find the expected value of X?

Since X denotes a random delivery time anywhere between 9 am and 10 am, X is a continuous random variable that follows a uniform distribution.

The uniform distribution is a probability distribution where all values between a lower bound (a) and an upper bound (b) have equal probability.

In this case, a = 9 am and b = 10 am, so the probability density function of X can be expressed as:

f(x) = 1/(b-a) = 1/(10-9) = 1

for 9 ≤ x ≤ 10, and f(x) = 0 otherwise.

The expected value or mean of X can be calculated as the average of the lower and upper bounds:

E[X] = (a + b)/2 = (9 + 10)/2 = 9.5 am

The variance of X is given by:

\(Var[X] = (b - a)^2/12 = (10 - 9)^2/12 = 1/12\)

Therefore, X is a continuous uniform random variable with a mean of 9.5 am and a variance of 1/12.

Learn more about random variable.

brainly.com/question/17238189

#SPJ11

Christians money from his job increased from 12 hour to 21 hour what is the percent increase

Answers

The percent increase of christian's hourly wage has increased by 75%.

To calculate the percent increase in the Christian's money from his job, you would use the formula:

percent increase = [(new value - old value) / old value] x 100.
In this case, the old value was $12 per hour and the new value is $21 per hour. So, the percent increase would be:
percent increase = [(21 - 12) / 12] x 100
percent increase = (9 / 12) x 100
percent increase = 0.75 x 100
percent increase = 75%
Therefore, the percent increase in Christian's money from his job is 75%.
The percent increase in Christian's hourly wage, you can use the following formula:
Percent increase = [(New wage - Old wage) / Old wage] x 100
In this case, the old wage is 12 dollars per hour and the new wage is 21 dollars per hour.
Percent increase = [(21 - 12) / 12] x 100
Percent increase = (9 / 12) x 100
Percent increase = 0.75 x 100
Percent increase = 75%
For similar question on percent:

https://brainly.com/question/31323953

#SPJ11

Can someone please help me!!!

Can someone please help me!!!

Answers

Answer:

Rotation

Step-by-step explanation:

Id say rotation if you are looking at each figure as its own, then each one is rotating by 180 degrees.  

Please help!!!!!
Suppose you toss 10 coins randomly at the board below and that all coins stay on the board. Find the probability as a fraction of landing in the shaded region.

A. 1/9
B. 8/9
C. 2/3

Please help!!!!!Suppose you toss 10 coins randomly at the board below and that all coins stay on the

Answers

Answer: B

Step-by-step explanation:

The area of the larger square is 9^2 = 81, and the area of the smaller square is 3^2 = 9. This means the area of the shaded region is 81-9=72. Hence, the desired probability is 72/81 = 8/9.

Other Questions
How can Gulliver's Travels be political?. PLEASE SOLVE I DESPERATELY NEED HELP!!! Solve the system of equations by graphing. which major promotion category uses catalogs, direct mail, e-mail, mobile marketing and social media? A binary classifier's accuracy is frequently a poor-quality measurement of its positive predictive ability. True. False what are two likey results of mitosis in an earthworm i need help pls ahhhhh The concept of green streets was noted as an opportunity to better steward water in neighborhoods and roadside areas. The concept is being used in Portland, Oregon and Los Angeles, California. Additio 1. For each independent situation, determine: USE Support test, Gross Income Test, Relationship Test.The filing status of the taxpayerThe number of dependents the taxpayer can claim -3x + 4 = -29what does x= ? why are earthquakes different in New Madrid than in California. A line a slope of 4 andincludes the points (-5,7) and(w-9). What is the value ofw? Are bond market price adjustments reflecting a companys deteriorating credit quality likely to lead, lag or coincide with Rating Agencies Actions? Briefly explain. https://corporatefinanceinstitute.com/resources/knowledge/finance/rating-agency/ Find the circumference of a circle with diameter, d = 7.18m.Give your answer rounded to 2 DP. NO LINKS!!! URGENT HELP PLEASE!!!! NO MULTIPLE-CHOICE!!!!!!1. Find the maximum area for a rectangle perimeter of 120 meters. Make your answer convincing by including these things: a. Sketches of rectangles with a perimeter of 120 meters (Include rectangles that do not have the maximum area and the rectangle you think does have the maximum area.) b. A table of lengths and areas for rectangles with a perimeter of 120 meters (Use increments of 5 meters for the lengths.)c. A graph of the relationship between length and area. Explain how each piece of evidence supports your answer. Chemical bonds are likely to form when_____ 6. You prepare biotinylated probes for use on Southern Blots using each strand of the 20 base pair denatured DNA molecule given below as templates. The labeling reaction includes DNA polymerase and a dNTP mix containing dTTP, dATP, dGTP and biotin labeled dCTP in the appropriate buffer. You are given 2 primers A and B that are designed to bind to the last 5 bases of each DNA strand in the correct orientation to generate a biotin labeled DNA strand. Primer A: 3'-CGACT-5'. Primer B: 5'-TAGTT-3' Template DNA 5'- TAGTTGCTCGCGACAGCTGA 3'- ATCAACGAGCGCTGTCGACT -3' - Assuming 100% incorporation of the biotin label, what percent of each probe (generated from each strand) would you expect to be biotinylated? Use the sequence size of the full length probe to calculate your answer. Whats the answer? Because I am complete confused in this phase, loose ends are tied and the project is transitioned to a daily work environment. select one: a. define b. measure c. analyze d. improve/design e. control/verify hutchinson-gilford progeria is an exceedingly rare human genetic disorder in which there is very early senility and death, usually from coronary artery disease, at an average age of 13 years. patients, who look very old even as children, do not live to reproduce. which of the following sta Approximately how far from the vertical beam should the lower end of the support beam be placed along the horizontal floor? 3. 0 meters 3. 4 meters 3. 9 meters 4. 4 meters.