A survey found that 52% of middle school students needed extra help in class.
If a total of 300 students took the survey, how many students said they
needed extra help in class?
There were
students that said they needed extra help in class.

Answers

Answer 1

Answer:

Your answer is 156

Step-by-step explanation:

300*.52=156


Related Questions

6th grade math help me pleaseeee

6th grade math help me pleaseeee

Answers

Answer:

Top left

Step-by-step explanation:

Look at the numbers it's going through. The x axis is the one going side to side, y is up and down

Find the length of the size not given when the hypotenuse is c and the legs are a and b

Find the length of the size not given when the hypotenuse is c and the legs are a and b

Answers

Take into accoun that the Pythagorean theorme is given by:

c² = a² + b²

8.

a = ?, b = 18, c = 30

solve the equation for a:

c² = a² + b²

a² = c² - b²

a = √(c² - b²) replace the values of c and b

a = √(30² - 18²)

a = √(900 - 324)

a = √(576)

a = 24

9.

c= ?, a = 5, b = 12

replace the values of b and a:

c = √(a² + b²)

c = √(5² + 12²)

c = √(25 + 144)

c = √(169)

c = 13

10.

b = ?, a = 6, c = 10

solve the equation for b:

b = √(c² - a²)

b = √(10² - 6²)

b = √(100 - 36)

b = √(64)

b = 8

will mark brainlist to the correct person who does the step by step correctly and also the correct answer

A city just opened a new playground for children in the community. An image of the land that the playground is on is shown.
What is the area of the playground?

900 square yards

855 square yards

1,710 square yards

1,305 square yards

will mark brainlist to the correct person who does the step by step correctly and also the correct answerA
will mark brainlist to the correct person who does the step by step correctly and also the correct answerA

Answers

Answer:

answer choice C

Step-by-step explanation:

The playground is a rectangle.

To find the area of a rectangle, we use the formula:

Area = Length x Width

The length is 25 yards.

The width is 68 yards.

Plugging these into the area formula:

Area = 25 x 68 = 1,700 square yards

Of the options, the closest choice is:

1,710 square yards

The area is 1,710 square yards.

enter the factor under the radical
\((a - b) \sqrt{a - b} \)

Answers

\(\\ \rm\longmapsto (a-b)\sqrt{a-b}\)

\(\\ \rm\longmapsto (a-b)(a-b)^{\frac{1}{2}}\)

\(\\ \rm\longmapsto (a-b)^{1+\dfrac{1}{2}}\)

\(\\ \rm\longmapsto (a-b)^{\dfrac{3}{2}}\)

Answer:

\(\dashrightarrow \: { \tt{(a - b) \sqrt{a - b} }} \\ \\ \dashrightarrow \: { \tt{ {(a - b)}^{1} {(a - b)}^{ \frac{1}{2} } }}\)

• from law of indices:

\({ \boxed{ \rm{ ({x}^{n} )( {x}^{m} ) = {x}^{(n + m)} }}}\)

therefore:

\(\dashrightarrow \: { \tt{ {(a - b)}^{(1 + \frac{1}{2} )} }} \\ \\ \dashrightarrow \: { \tt{ {(a - b)}^{ \frac{3}{2} } }}\)

Find the distance between A(6,2) and B(1,-4)

Answers

Answer:

7.8102496759067

Step-by-step explanation:

(For 160,000 it takes 18ms to sort each half. Then merging together the two sorted halves with 80,000 numbers in each of them takes 40-218 = 4 ms. For 320,000 elements, it will take 240 to sort each half and 24 to merge the sorted halves with 160,000 numbers in each, for the total of 240+8 = 88 ms.)

Answers

For a larger input size of 320,000 elements, it will take 240 ms to sort each half and 24 ms to merge the sorted halves, resulting in a total time of 264 ms.

The given information describes the time required for sorting and merging operations on two different input sizes. For 80,000 elements, it takes 18 ms to sort each half, resulting in a total of 36 ms for sorting. Merging the two sorted halves with 80,000 numbers in each takes 40 - 18 = 22 ms.

When the input size is doubled to 320,000 elements, the sorting time for each half increases to 240 ms, as it scales linearly with the input size. The merging time, however, remains constant at 4 ms since the size of the sorted halves being merged is the same.

Thus, the total time for sorting and merging 320,000 elements is the sum of the sorting time (240 ms) and the merging time (4 ms), resulting in a total of 264 ms.

Therefore, based on the given information, the total time required for sorting and merging 320,000 elements is 264 ms.

Learn more about total time here:

https://brainly.com/question/951637

#SPJ11

a new cell phone is introduced into the market. it is predicted that sales will grow logistically. the manufacturer estimates that they can sell a maximum of 100 thousand cell phones.after 28 thousand cell phones have been sold, sales are increasing by 10 thousand phones per month.find the differential equation describing the cell phone sales, where y(t) is the number of cell phones (in thousands) sold after t months.

Answers

The differential equation describing the cell phone sales is \(\frac{{dy}}{{dt}} = 0.5357 \cdot y(t) \cdot \left(1 - \frac{{y(t)}}{{100}}\right)\).

Based on the given information, the cell phone sales growth is logistic, with a carrying capacity of 100 thousand units. When 28 thousand cell phones have been sold, the rate of sales increase is 10 thousand units per month.

The logistic growth differential equation is given by:

\(\frac{dy}{dt} = k \cdot y(t) \cdot \left(1 - \frac{y(t)}{M}\right)\)

where dy/dt is the rate of change in sales, y(t) is the number of cell phones sold after t months, k is the growth rate, and M is the carrying capacity.

In this case, y(t) = 28, dy/dt = 10, and M = 100. To find k, we can plug these values into the equation:

10 = \($k \cdot 28 \cdot \left(1 - \frac{28}{100}\right)$\)

Solving for k:

k ≈ 0.5357

Therefore, the differential equation describing the cell phone sales is:

\(\frac{{dy}}{{dt}} = 0.5357 \cdot y(t) \cdot \left(1 - \frac{{y(t)}}{{100}}\right)\)

Learn more about differential equation: https://brainly.com/question/18760518

#SPJ11

7. Find the measure of <1. Justify your answer

7. Find the measure of &lt;1. Justify your answer

Answers

Answer:

3rd option

Step-by-step explanation:

∠ 1 and 75° are corresponding angles and are congruent , so

∠ 1 = 75°

Suppose two utilites, People's Electric and Muricipal Energy, each produce 900 tons of pollution per year. The government has a goal of eliminating haf the pclution, and, in turn, provides 450 pollution permits to each utlity. A pollution permit is required to legally produce a ton of poliubon. However, the tao utities are allowed to trade permas. Suppose the cost of eliminating one ton of pollution for People's Electric is $400 and the cost of eliminating a ton of polution for Municipal Energy is $350. The total cost of each utility eliminating 450 tons of pollution is $ (Enter your response as a whole number)

Answers

The total cost of each utility eliminating 450 tons of pollution is $180,000.

To calculate the total cost for each utility to eliminate 450 tons of pollution, we need to multiply the cost per ton of pollution elimination by the number of tons each utility needs to eliminate.

For People's Electric, the cost of eliminating one ton of pollution is $400. So, to eliminate 450 tons, the total cost would be 450 tons * $400/ton = $180,000.

For Municipal Energy, the cost of eliminating one ton of pollution is $350. Again, to eliminate 450 tons, the total cost would be 450 tons * $350/ton = $157,500.

Therefore, the total cost for each utility to eliminate 450 tons of pollution is $180,000 for People's Electric and $157,500 for Municipal Energy.

The cost calculation is based on the given information that each utility is provided with 450 pollution permits by the government. These permits allow them to legally produce a ton of pollution. By setting a limit on the number of permits, the government aims to reduce pollution by half. The utilities have the option to trade permits with each other.

In this scenario, People's Electric has a higher cost of eliminating pollution per ton compared to Municipal Energy ($400 vs. $350). It means that People's Electric would find it more expensive to reduce pollution through internal measures like investing in cleaner technology or implementing environmental initiatives. On the other hand, Municipal Energy has a lower cost, indicating that they have relatively more cost-effective methods for pollution reduction.

Given these costs, it is more beneficial for People's Electric to purchase permits from Municipal Energy rather than eliminating the pollution themselves. By purchasing permits, People's Electric can meet the pollution reduction target at a lower cost. Conversely, Municipal Energy can generate additional revenue by selling their permits.

This permit trading mechanism allows for cost efficiency in achieving the government's pollution reduction goal. The total cost for each utility is determined by multiplying the cost per ton of pollution elimination with the number of tons they need to eliminate.

Learn more about the Pollution

brainly.com/question/23857736

#SPJ11

If g(x)= 2x +8x-1 what is g(-3)

A) -7
B) 11
C) 28
D)7

Answers

Answer =-31

Step-by-step explanation:

Greetings !

Firstly, write down the given expression

\(g(x) = 2x + 8x - 1\)

simplify it to be more accurate where 2+8=10

\(g(x) = 10x - 1\)

plug in -3 in the value of x and simplify the expression

\(g( -3 ) = 10( - 3) - 1 \\ g( - 3) = - 30 - 1\)

Thus, subtract the numbers

\(g( - 3) = - 31\)

Hope it helps!

Suppose int i = 5, which of the following can be used as an index for array double[] t=new double[100]? A. i B. I +6.5 C.1 + 10 D. Math.random() * 100 E. (int)(Math.random() * 100))

Answers

The options that can be used as indices for the array are option A (i) and option E ((int)(Math.random() * 100)).

To determine which expressions can be used as an index for the array double[] t = new double[100], let's evaluate each option :

A. i: Since i is an integer variable with a value of 5, it can be used as an index because it falls within the valid index range of the array (0 to 99).

B. I + 6.5: This expression adds 6.5 to the variable i. Since array indices must be integers, this expression would result in a double value and cannot be used as an index.

C. 1 + 10: This expression evaluates to 11, which is an integer value and can be used as an index.

D. Math.random() * 100: The Math.random() function returns a double value between 0.0 (inclusive) and 1.0 (exclusive). Multiplying this value by 100 would still result in a double value, which cannot be used as an index.

E. (int)(Math.random() * 100): By multiplying Math.random() by 100 and casting the result to an integer, we obtain a random integer between 0 and 99, which falls within the valid index range and can be used as an index.

Learn more About array from the given link

https://brainly.com/question/28061186

#SPJ11

Math 4th 11-4 I need answers for 11-4 can you please help?

Answers

To make the table of 7, using the table of 4 and 3, we add the value of both table consecutively.

We have to make the table of 7, using table of 4 and 3.

As we know the table of 3 is:

3  6  9  12  15  18  21  24  27  30

As we know the table of 4 is:

4  8  12  16  20  24  28  32  36  40

To from the table of 7 using the table of 4 and 3 we add the consecutive value of both table respectively.

3 + 4    6 + 8    9 + 12    12 + 16    15 + 20    18 + 24    21 + 28    24 + 32      27 + 36    30+40

Now simplify

7    14    21    28    35    42    49    56    63    70

To learn more about addition link is here

brainly.com/question/29560851

#SPJ4

The complete question is:

Math 4th 11-4: Help bunty to make the table of 7, using table of 4 and 3.

The number of four friends walked to school , who walks the shortest distance to school?

Answers

Answer: they didn’t give you any numbers ?

Step-by-step explanation:

Find the missing side. Round to the nearest tenth.

Find the missing side. Round to the nearest tenth.

Answers

Answer:

Solution given:

relationship between base and hypotenuse is given by sin angle

sin angle =b/h

cos55=16/x

x=16/cos55°=27.89=28 is your answer .

a team of 7 construction workers worked together to build 3 sheds in 10 days. how much of a shed did each of them build?

Answers

Answer: The correct answer is that each construction worker built 3/7 of (each) shed. Or 0.429 of (each) shed.

Step-by-step explanation: This is correct because you would do 3 / 7 = 3/7. You would do the amount of sheds they built, divided by the number of workers that build it. They built a shed about every 3 days. Or 3 1/3 days to be exact.

As the project progresses, the actual finish times (AFs) of completed activities will determine
the earliest start and earliest finish times for the remaining activities in the network diagram, as well as the total slack.

Answers

As the project progresses, the actual finish times (AFs) of completed activities play a crucial role in determining various aspects of the project schedule.

The AFs are used to calculate the earliest start and earliest finish times for the remaining activities in the network diagram. These calculations are based on the dependencies between activities and the actual durations of completed activities.

By considering the AFs, the project team can determine the earliest possible start and finish times for the remaining activities, taking into account the sequence of activities and any imposed constraints. This information helps in managing the project schedule and identifying any potential delays or critical paths.

Know more about actual finish times here:

https://brainly.com/question/31925763

#SPJ11

Which of the following statements is true? Select all that apply.

To find the diameter of a circle, divide its circumference by π or 3.14.
To find the diameter of a circle, divide its circumference by pi or 3.14.

The radius of a circle is twice its diameter.
The radius of a circle is twice its diameter.

The circumference of a circle is greater than its diameter.
The circumference of a circle is greater than its diameter.

The diameter of a circle is twice its radius.
The diameter of a circle is twice its radius.

The circumference of a circle is twice its radius.

Answers

Answer:

the answer is the 1st one

Juan made $1000 in taxable income last year.Suppose the income tax rate is 15% for the first $ 7000 plus 17% for the amount over $7000. How much must Juan pay in income tax for last year?

Answers

step 1

$1,000 < $7,000

so

the tax rate is 15%

15%=15/100=0.15

0.15*1,000=$150

therefore

The answer is $150

A baker made 7 pounds of dough. He used 2/9 of the dough to make sandwich rolls.

How much of the dough is left over?

The amount of dough left over is

pounds.

Answers

The amount of dough left over is 49/9 pounds.

What is fraction?

Anything that is not an integer is a fraction. Typically, a fraction has a denominator and a numerator. The number above serves as the numerator. the number below serves as the denominator

4/5 is an illustration of a fraction. The numerator is 4, and the denominator is 5.

What are three types of fraction?

Proper, improper and mixed are three types of fraction.

Fraction that is left over = 1 - 2/9 = 7/9

Pounds left over = 7/9 x 7 = 49/9 pounds

To learn more about fractions visit the link:

https://brainly.com/question/10354322

#SPJ1

The amount of dough left over is 49/9 pounds.

What is fraction?

A function is a block of code that performs a specific task. It takes an input, performs an action, and produces an output. Functions are an essential part of programming as they help to break down large programs into smaller, more manageable pieces. This allows for code to be reused and modified more easily. Functions are typically declared with a name, a list of parameters, and a block of code. When the function is called, the parameters are passed in and the code is executed. The output is then returned to the calling program. Functions are important for any programmer as they allow for efficient and well-structured code.

4/5 is an illustration of a fraction. The numerator is 4, and the denominator is 5.

What are three types of fraction?

Proper, improper and mixed are three types of fraction.
Fraction that is left over = 1 - 2/9 = 7/9
Pounds left over = 7/9 x 7 = 49/9 pounds

To learn more about fractions visit the link:
https://brainly.com/question/17220365
#SPJ1

What are special angles in geometry?

Answers

Special angles in geometry are specific angle measures that have unique properties and are often encountered in geometric problems:

(1) Right angle      (2) Acute angle        (3)  Obtuse angle         (4)Straight angle              (5)Reflex angle

(6) Complementary angles          (7)Complementary angles

In geometry, special angles refer to specific angles that have special properties or characteristics. These angles include right angles, acute angles, and obtuse angles. A right angle is an angle that measures exactly 90 degrees, while an acute angle is an angle that measures less than 90 degrees. An obtuse angle, on the other hand, measures more than 90 degrees but less than 180 degrees. These angles are important in geometry as they form the foundation for many geometric shapes and concepts. Understanding the properties and characteristics of these special angles is crucial for solving geometry problems and constructing geometric figures accurately.

Special angles in geometry are specific angle measures that have unique properties and are often encountered in geometric problems. These angles include:

1. Right angle: A right angle is an angle that measures exactly 90 degrees. It is formed when two lines intersect perpendicularly.

2. Acute angle: An acute angle is an angle that measures between 0 and 90 degrees. It is smaller than a right angle.

3. Obtuse angle: An obtuse angle is an angle that measures between 90 and 180 degrees. It is larger than a right angle.

4. Straight angle: A straight angle is an angle that measures exactly 180 degrees. It is formed when two lines intersect in a straight line.

5. Reflex angle: A reflex angle is an angle that measures between 180 and 360 degrees. It is larger than a straight angle.

6. Complementary angles: Two angles are complementary if their sum is equal to 90 degrees.

7. Supplementary angles: Two angles are supplementary if their sum is equal to 180 degrees.

Learn more about Angles:

brainly.com/question/28451077

#SPJ11

HELP ME PLS I NEED HELP ITS DUE TOMORROW !!!!! I NEED HELP ON ALL 2,3,4,5

HELP ME PLS I NEED HELP ITS DUE TOMORROW !!!!! I NEED HELP ON ALL 2,3,4,5

Answers

Answer:

1)The slope of the smaller triangle is smaller.

2)The slope of the larger triangle is larger than the slope of the smaller triangle.

3)Tre triangles are congruent

4)The slopes of the two triangles are the same.

5)Line A

Answer:

1(d), 2(not correct) 3,4,5 given below

Step-by-step explanation:

1. the slopes are same as we know

m=tan theta=y/x so the slope is same

2. it will be 10 m= tan theta=y/x

or, slope =70-40/7-4=10

3. let x and y are the sides of the triangles

so for 1 triangle it will be x=5 and y=2

"" "" another one its the multiple of 5 and 2 such as x=10 and y=4

4. the two triangle lie on the same line as slopes are equal

1st one , slope=72/12=6

2nd one slope=144/24=6

as slopes equal so they are collinear.

5. i am sorry i am not sure about it

i took all the three lines. as the slope of 5 and 7 no triangleare same(m=0.75) and smaller than others then on line A

then slope of 8 and 9 no triangle are same(m=1.5) so on the line B

then slope of 6 and 10 are same (m=3) so on the line C

i took the three lines for this...

THE ALL ANSWERS ARE BASED ON PRIMARY CONCEPT IF U FIND ANY MISTAKE PLEASE TELL ME LATER..THANK U

.215215215... as a fraction

Answers

Answer:

2/34

Step-by-step explanation:

Kurram was born on June 12, 2002, and his brother was born on February 10, 2004. Who is the elder among them and by how many months? ​

Answers

Answer:

Kurram is elder by 19 months

how do i solve this problem

how do i solve this problem

Answers

The solution to the problem is the simplified expression: 5x³ - x² - 3x + 13.

To solve the given problem, you need to simplify and combine like terms. Start by adding the coefficients of the same degree terms.

(3x³ - x² + 4) + (2x³ - 3x + 9)

Combine the like terms:

(3x³ + 2x³) + (-x²) + (-3x) + (4 + 9)

Simplify further:

5x³ - x² - 3x + 13

In this expression, the highest power of x is ³, and the corresponding coefficient is 5. The term -x² represents the square term, -3x represents the linear term, and 13 is the constant term. The simplified expression does not have any like terms left to combine, so this is the final solution.

Remember to check for any specific instructions or constraints given in the problem, such as factoring or finding the roots, to ensure you address all requirements.

For more such questions on solution

https://brainly.com/question/24644930

#SPJ8

NEED QUICKThe sum of x and 3 is the same as the 5 less than 3x. Find x

Answers

Let's begin by identifying key information given to us:

\(\begin{gathered} x+3=3x-5 \\ \text{Put like terms together, we have:} \\ \text{Subtract ''x'' from both sides, we have:} \\ x-x+3=3x-x-5 \\ 3=2x-5 \\ Add\text{ ''5'' to both sides, we have:} \\ 3+5=2x-5+5 \\ 8=2x\Rightarrow2x=8 \\ 2x=8 \\ \frac{2}{2}x=\frac{8}{2} \\ x=4 \end{gathered}\)

If the r = + 0.8, we would say: As X scores increase, the Y scores increase; and
the magnitude is strong. Explain what each of the following correlation coefficients indicates about the
direction and magnitude in which Y scores change as X scores increase.
a. -1.0
b. +0.32
c. -0.10
d. -0.71

Answers

If the correlation coefficient r is -1.0, it means that there is a perfect negative linear relationship between X and Y.

a) As X scores increase, Y scores decrease in a perfectly consistent manner. The magnitude is strong.

b) If the correlation coefficient r is +0.32, it means that there is a positive linear relationship between X and Y, but it is a weak relationship. As X scores increase, Y scores tend to increase, but not in a perfectly consistent manner. The magnitude is weak.

c) If the correlation coefficient r is -0.10, it means that there is a weak negative linear relationship between X and Y. As X scores increase, Y scores tend to decrease, but not in a consistent manner. The magnitude is weak.

d) If the correlation coefficient r is -0.71, it means that there is a strong negative linear relationship between X and Y. As X scores increase, Y scores tend to decrease in a consistent manner. The magnitude is strong.

To learn more about correlation coefficient here:

https://brainly.com/question/27226153

#SPJ1

8 of 10
What is the decimal multiplier to decrease by 0.4%?

Answers

Answer 40%

Step-by-step explanation:

the population (in millions) of a city t years from now is given by the indicated function. (a) find the relative rate of change of the population 7 years from now. (round your answer to one decimal place.) 1.8 % per year (b) will the relative rate of change ever reach 2.3%? yes no solution or explanation (a) (b) p(t)

Answers

The relative rate of population change after seven years from now is a) 1.7 % (rounded off to 1 decimal place) b) Yes, the relative rate of population change will reach 2.3% in 19.21 years

The function for population t years from now is P(t)= 2+ 1.2e^(0.04t)

a) relative rate of change of population

= P'(t) / P(t)

= (0+1.2e^(0.04t) * 0.04 )/ ( 2+ 1.2e^(.04t) )

= 0.048 e ^(0.04t) / (2 + 1.2e^(0.04t) )

Relative rate of change of population 7 years from now

= 0.048 e ^(0.04 * 7) / (2+ 1.2e^(0.04*7))

=0.0177 = 0.177 * 100 = 1.7 % per year (rounded off to one decimal place

b) For the relative rate of change to reach 2.3 %

P'(t) / P(t) = 2.3 % = 0.023

⇒(0+1.2e^(0.04t) * 0.04 )/ ( 2+ 1.2e^(0.04t) ) = 0.023

⇒0.048e ^(0.04t) = 0.046 + 0.0267e^(0.04t)

⇒e ^(0.04t) = 0.958 + 0.556e ^(0.04t)

⇒e ^(0.04t) ( 1 - 0.556) = 0.958

⇒e ^(0.04t) ( 0.444) = 0.958

⇒e ^(0.04t) = 2.157

⇒0.04t = ln(2.157)           (applying ln on both sides)

⇒t = 19.21 years

The relative rate of population change is 2.3% in 19.21 years

Problem on the relative rate of change

brainly.com/question/13814651

#SPJ4

Can you please help me

Can you please help me

Answers

The vertices of ΔFGH are F(-2,4), G(4,4), and H(1,-2), then the coordinates of the orthocenter of ΔFGH are ( 1 , 5/2 ) or ( 1 , \(2\frac{1}{2}\) ).        

Graph ΔFGH . To find the orthocenter, find the point where two of the three altitudes intersect.

Find an equation of the altitude from F to GH.

The slope of GH is,

= 4-(-2)/4-1

= 4+2/4-1

= 6/3

= 2

So the slope of the altitude, which is perpendicular to GH, is -1/2

y - \(y_{1}\) = m (x - \(x_{1}\))

y - 4 = -1/2 ( x - (-2) )

y - 4 = -1/2 (x+2)

y - 4 = -1/2x - 1

y = -1/2x -1 + 4

Find an equation of the altitude from F to GH.

The slope of FH is,

= -2-4/1-(-2)

= -6/1+2

= -6/3

= -2

So the slop of the altitude is, 1/2

y - \(y_{1}\) = m (x - \(x_{1}\))

y - 4 = 1/2 ( x - 4 )

y - 4 = 1/2x - 2

y = 1/2x -2 + 4

y = 1/2x + 2

Solve the resulting system of equations \(\left \{ {{y = -1/2x + 3} \atop {y = 1/2x + 2 }} \right.\)  to find the point of intersection of the altitudes.

Adding the two equations to eliminate \(x\) results in 2y = 5 or y = 5/2

y = 1/2x + 2

5/2 = 1/2x + 2  

1/2 = 1/2x

x = 1

Therefore,

The coordinates of the orthocenter of ΔFGH are ( 1 , 5/2 ) or ( 1 , \(2\frac{1}{2}\) ).

To learn more about information visit Orthocenter problems :        

brainly.com/question/19763099

#SPJ1

Can you please help me

3. according to the statistical abstract of the united states, in 2007, approximately 43% of sixth grade students reported being bullied at school. due to increased education and outreach, educators are convinced that the proportion of students being bullied at school has decreased. in a recent random sample of 75 sixth grade students, 30 responded that they experienced bullying at school. at the 5% level of significance, what can you conclude?

Answers

We do not have enough evidence to conclude that the proportion of students being bullied at school has decreased at a 5% level of significance.

Hypothesis testing:

Hypothesis testing is a statistical method used to determine whether a hypothesis about a population parameter is supported by the data. In this case, the hypothesis is that the proportion of students being bullied at school has decreased.

One-sample proportion test:

The one-sample proportion test is a type of hypothesis test used to determine whether a proportion in a sample is significantly different from a known population proportion.

In this case, we are testing whether the proportion of students who reported being bullied in the sample of 75 sixth grade students is significantly different from the population proportion of 43%.

To test whether the proportion of students being bullied at school has decreased, we can use a hypothesis test with the null hypothesis that the proportion is still 0.43 and the alternative hypothesis that the proportion is less than 0.43.

Let p be the true proportion of students being bullied at school, then we have:

H₀ : p = 0.43

Hₐ : p < 0.43 (one-tailed test)

Using the sample data, we can calculate the sample proportion of students who reported being bullied at school:

=> \(\hat{p}\) = 30/75 = 0.4

We can use this to calculate the test statistic:

=> z = ( \(\hat{p}\)  - p) / √(p×(1 - p)/n) = (0.4 - 0.43) /√(0.43×0.57/75) = -0.81

At the 5% level of significance with a one-tailed test, the critical z-value is -1.645. Since our calculated test statistic (-0.81) is greater than the critical value, we fail to reject the null hypothesis.

Therefore,

We do not have enough evidence to conclude that the proportion of students being bullied at school has decreased at a 5% level of significance.

Learn more about Hypothesis testing at

https://brainly.com/question/30588452

#SPJ4

Other Questions
how did victory at yorktown and the support of france and pain affect the terms of the treaty of paris What is the molarity of 750 mL of NaCl solution that contains 21.04 g ofNaCl?The Periodic TableA. 0.028 mol/LB. 0.48 mol/LC. 28 mol/LD. 4.8 x 10-4 mol/L Charlie wants to build a restaurant. The cost of the building is 516000, the fittings cost 55000. The bank will allow Charlie to borrow 370000, he will have to save the remaining amount required, He set up a bank account as a sinking fund and plans to make payments of 2100 a month which will offer 6.9% per annum compounded monthly.i) Calculate the size of deposit Charlie would need to save. By how much will he fall short of his goal?ii) Use the sinking fund formula on excel to find out the size of monthly payments Charlie should make in order to save the deposit amount in 6 years.(iii) Charlie would like to use the original payment of 2100, he decides to find another financial institution for an interest rate that would enable the desired amount to be achieved. Determine the appropriate interest rate for an account offering monthly compounding and monthly payment of 2100 used in (i) 3. In Act III, Scene i, what does Hamlet mean whenhe says, "To be, or not to be, that is the question"?Cite evidence from the text to support youranswer. a client is diagnosed with pulmonary tuberculosism and the health care provider prescribes a combination of rifampin and isoniazid Hunter works to fix wires and paneling. Hunter is a(n) Carpenter. Plumber. Glazier. Electrician. Discuss two safety suggestions when using a chainsaw Cambridge Market is having a sale on Takis, selling 4 bags for $3. What is the cost of one bag at the sale price? Someone plz help me PLEASE HELP MEE!!Shawntae has 21 coins, a combination of nickels and dimes. The total value of her coins is $1.70.How many of each coin does Shawntae have?a. Define the variables and then write a system of equations that represent the situation.(2 points)b. Solve the system using either the substitution or elimination method. Show your work.2 points)C. In a complete sentence, how many nickels and how many dimes does Shawntae have?(2 points) The temperance movement in the first half of the 19th century was an influential social undertaking that called for. WILL GIVE BRANLIEST !Case #28104Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.Part TwoCopy the DNA sequences for each suspect into a Word document.Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.Repeat step 1 with the DNA samples for Suspects B and C.Suspect ATCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGASuspect BTCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGASuspect CTTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGAProbeAGGTQuestionsAnswer these following questions in the essay box below.1. Which suspect most likely committed the robbery?2. How do you know? 1. Construct a spreadsheet to calculate the payback period, internal rate of return, modified internal rate of return (assume the investment rate is the same as the borrowing rate), profitability index and net present value of the proposed mine. 2. Based on your analysis, should the company open the mine? 3. What would your opinion be if bullock mining evaluated the risk of spending $850 million and decided in the current environment, they required a 30% required return on all of its new gold mines? why? 4. What is the meaning of the "required return?? A 5.00 gram sample of an unknown metal was placed in a beaker of boiling water (99.58 C). After five minutes it was immediately transferred from the boiling water to a calorimeter containing 50.0 mL of water at 11.25 C. The final temperature of the metal- water mixture was 44.10 C. What is the specific heat of the metal? [qwater + qmetal = 0] Does anyone know the answer to my Newsela? please help. True or false please answer ASAP ( Brainliest ) what is the prime number of 30 to 59 One of the 13 states in the Union, __________ chose not to send delegates to the Constitutional Convention of 1787. 2. You have to make cakes for a party. The recipe says you need exactly four cups of sugar. You have only two containers. One holds five cups and the other holds three cups of sugar. Using these containers, can you measure exactly four cups of sugar? Explain how. two distinct integers, and , are randomly chosen from the set . what is the probability that is even?