Sure! I can help you compare striated, smooth, and cardiac muscle by organizing the given characteristics into the correct categories. Here's how we can do it:
Striated Muscle:
Also called skeletal muscleMade of tissues that contractVoluntary (you control it with your mind)Example: Thigh musclesSmooth Muscle:
Muscles that allow movement in organsInvoluntary (you cannot control it with your mind)Cardiac Muscle:
Example: DiaphragmMade of tissues that contractInvoluntary (you cannot control it with your mind)Also called heart muscle
Please note that the term "GLE C" and the phrase "CHARLEIKERAD GUMEMIKIL THE" do not appear to be related to the characteristics of striated, smooth, or cardiac muscle. If you have any further questions or need additional information, feel free to ask!
for similar questions on cardiac muscle
https://brainly.com/question/27081052
#SPJ11
Problem I. Assume we encode A, T, C, and G as two bit codes A.00, T:01, C:10, and G:11, respectively. Given the sequence AATCGATAAGCAAAACCGGA, build a hash table with all possible 3-mers from this sequence.
All potential 3-mers from the given sequence are included in the resulting hash table along with their matching hash codes. This hash table can be utilized for a number of tasks, including the effective storing and retrieval of sequences as well as the analysis of trends in DNA sequence data.
To build a hash table with all possible 3-mers from the given DNA sequence AATCGATAAGCAAAACCGGA, we can follow these steps:
1. Identify all possible 3-mers (sequences of three consecutive nucleotides) in the given sequence: AAT, ATC, TCG, CGA, GAT, ATA, TAA, AAG, AGC, GCA, CAA, AAA, AAA, AAC, ACC, CCG, CGG, GGA.
2. Assign a unique numerical hash code to each 3-mer based on the provided encoding scheme:
- AAT: 000000
- ATC: 000001
- TCG: 000010
- CGA: 000011
- GAT: 000100
- ATA: 000101
- TAA: 000110
- AAG: 000111
- AGC: 001000
- GCA: 001001
- CAA: 001010
- AAA: 001011
- AAA: 001011 (Note: Repeat sequence with the same hash code)
- AAC: 001100
- ACC: 001101
- CCG: 001110
- CGG: 001111
- GGA: 010000
3. Create a hash table with the 3-mer sequences as keys and their respective hash codes as values:
- AAT: 000000
- ATC: 000001
- TCG: 000010
- CGA: 000011
- GAT: 000100
- ATA: 000101
- TAA: 000110
- AAG: 000111
- AGC: 001000
- GCA: 001001
- CAA: 001010
- AAA: 001011 (Note: Repeat sequence with the same hash code)
- AAC: 001100
- ACC: 001101
- CCG: 001110
- CGG: 001111
- GGA: 010000
The resulting hash table contains all possible 3-mers from the given sequence along with their corresponding hash codes. This hash table can be used for various purposes, such as efficient storage and retrieval of sequences or for analyzing patterns in the DNA sequence data.
To know more about the hash table refer here :
https://brainly.com/question/31596628#
#SPJ11
May 8th The next day, Margo went to another urgent care facility where she hoped she would find some relief. John, an Advanced Registered Nurse Practitioner (ARNP), took her history and performed his clinical assessment, noting a normal body temperature and normal-size lymph nodes. While examining the injured finger, he observed significant swelling, mild erythemia, and a small wound with minimal clear exudate. Other than the index finger, the rest of Margo’s hand appeared normal. Upon completing his examination, John cleaned the wound, numbed the area, and injected a medication called Depo-Medrol into Margo’s finger. Afterwards, he talked to Margo about wound infections, including the redness and swelling she had been dealing with. John told Margo to clean her wound three times a day with soap and water and then to dry it thoroughly. He gave her a prescription for the antibiotic Keflex to be taken two times a day for 10 days. He also gave her a visit summary/discharge instruction paper that identified the clinical impression/diagnosis as "cellulitis/foreign body/fungi." John further instructed Margo to return in 72 hours if her symptoms did not improve. Once home, Margo closely read the written information she had been given and noted that the document mentioned she had been taking the drug Septra since May 3rdwithout improvement. Also, her medical services/charge sheet noted "foreign body removal" as a procedure carried out, yet she had no memory of such a procedure. Although at the end of her clinical visit Margo had signed the paper acknowledging her treatment, she was now more confused than ever regarding the cause of her wound and the course of her treatment.
Questions
1. What is the function of Depo-Medrol? Speculate on the reasoning/consequences of its use in this particular case.
2. What pathogens are targeted by Keflex (the newest prescription)?
3. What types (genus/species) of fungal pathogens typically cause wound infections?
4. If a fungal pathogen was implicated, would Keflex eliminate that particular infectious agent?
5. Why did Margo’s recent documents mention she was taking Septra rather than Bactrim as her earliest (May 3rd) documents listed?
1. Depo-Medrol is a corticosteroid medication that reduces inflammation and swelling. Its use in this case may have been to reduce the swelling in Margo's injured finger, making it easier to clean and less painful. However, it may also mask the symptoms of an infection, making it difficult to diagnose and treat.
2. Keflex is a cephalosporin antibiotic that targets bacterial pathogens such as Staphylococcus aureus, Streptococcus pyogenes, and Escherichia coli.
3. Fungal wound infections can be caused by a variety of genera and species, including Candida, Aspergillus, and Fusarium.
4. Keflex would not be effective against fungal pathogens, so it would not eliminate a fungal infection.
5. Septra is the brand name for a combination of sulfamethoxazole and trimethoprim, while Bactrim is another brand name for the same combination. It is possible that Margo's healthcare provider used different names for the same medication, or that different pharmacies dispensed different brands.
Margo visited another urgent care facility to seek treatment for her swollen and injured finger. The Advanced Registered Nurse Practitioner (ARNP), John, observed significant swelling, mild erythemia, and a small wound with minimal clear exudate. He injected Depo-Medrol, which is a medication used to reduce inflammation and pain. He prescribed Keflex, an antibiotic used to treat bacterial infections.
The clinical impression/diagnosis given was "cellulitis/foreign body/fungi" and Margo was instructed to return in 72 hours if her symptoms did not improve. The documents provided to Margo mentioned that she was taking Septra, but earlier documents listed Bactrim, and also indicated "foreign body removal" as a procedure carried out, which confused Margo. It is unclear whether a fungal pathogen was involved, but Keflex cannot eliminate fungal infections.
To know more about infections, here
brainly.com/question/13909794
#SPJ4
even though the soft parts of an organism usually decompose when it dies, it's hard parts may become mineralized to form over time.
Even though the soft parts of an organism usually decompose when it dies, its hard parts may become mineralized over time, forming fossils that provide valuable insights into past life forms and ecosystems.
When an organism dies, its soft tissues are often broken down and consumed by decomposers or decayed through natural processes. However, under certain conditions, the hard parts of the organism, such as bones, teeth, shells, or woody tissues, can undergo a process called mineralization. Mineralization occurs when minerals from the surrounding environment, such as silica, calcium carbonate, or iron, gradually infiltrate the pores and spaces within the hard parts of the organism. Over time, these minerals replace the original organic material, preserving the structure and morphology of the organism's hard parts.
The process of mineralization is facilitated by a variety of factors, including the availability of minerals in the environment, the chemical composition of the organism's hard parts, and the burial and preservation conditions. The resulting mineralized remains, known as fossils, can persist for millions of years and provide scientists with valuable clues about the anatomy, behavior, and evolutionary history of ancient organisms. Fossils are important tools for studying the history of life on Earth and reconstructing past ecosystems.
Learn more about morphology here:
https://brainly.com/question/1378929
#SPJ11
How do you identify if a quadratic expression can be factored?
A quadratic expression with integer coefficients may only be factored over the integers if and only if its discriminant is a perfect square.
Two algebraic identities may be used to factor the quadratic problem above. This method can only be applied when the given quadratic equation's LHS takes the form a2 + 2ab + b2 or a2 - 2ab + b2. The fact that a2 + 2ab + b2 = (a + b)(a + b) is known.
Quadratic equations are not always easily resolved by factoring or root extraction. For instance, since the term x 2 + x 1 cannot be factored, the equation x 2 + x 1 = 0 cannot be solved by factoring. Additional equations may be difficult to factor.
Learn more about equations at
https://brainly.com/question/12425007?referrer=searchResults
#SPJ4
In both plants and animals, RNA contains
deoxyribose sugar, phosphates, adenine, uracil, guanine, and cytosine
ribose sugar, phosphates, adenine, thymine, guanine, and cytosine
ribose sugar, phosphates, adenine, uracil, guanine, and cytosine
deoxyribose sugar, phosphates, adenine, thymine, guanine, and
cytosine
Answer:
option (C)
Explanation:
In both plants and animals, RNA contains:
Ribose sugar, phosphates, adenine, uracil, guanine, and cytosine.
students are measuring the rate of enzyme activity. the graph below shows the rate of enzyme action as they increase the temperature. what is one possible reason the enzyme is less effective at high temperature
Answer:
The heat will cause the enzyme to denature(deform) and the subtrate will no longer fit into the enzyme.
anyone help me please I need help
Answer:
Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive. If one of the alleles is dominant, then the associated characteristic is less likely to manifest.
Explanation:
What are forms the structural and functional
component of cells
Answer:
Cell Structure. The cell structure comprises individual components with specific functions essential to carry out life's processes. These components include- cell wall, cell membrane, cytoplasm, nucleus, and cell organelles.
PSYCHOLOGY
Briefly describe the relationship between hormones, emotion, and external behavior
which type of environmental scientist is likely to study methods of water conservation and decontamination? a. hydrologist b. toxicologist c. oceanographer d. ecologist please select the best answer from the choices provided a b c d
Hydrologist is likely to study methods of water conservation and decontamination.
A person who studies the distribution, quality circulation, and "physical properties" of the water on Earth's surface is known as a hydrologist. They investigate the reactions that occur when water reaches the surface of the earth, such as how snow and rainwater penetrate the soil and become groundwater. They investigate how surface water and groundwater evaporate back into the atmosphere or ultimately reach the oceans, as well as how rain, snow, and other forms of precipitation affect river flows or groundwater levels.
Know more about water conservation here: https://brainly.com/question/10929764
#SPJ4
Canada has the ___ land mass in the world.
A. largest
B. 2nd largest
C. 3rd largest
2nd largest on the worls
Answer:
2nd largest, Russia is the biggo boi
how to tell the difference between a coral snake and a king snake
To tell the difference between a coral snake and a king snake, remember this simple rhyme: "Red touch yellow, kill a fellow. Red touch black, friend of Jack." This means that if the snake has red and yellow bands touching, it is a coral snake and its bite is venomous, but if the bands are red and black touching, it is a harmless king snake.
Coral snakes and king snakes are often confused because they have similar color patterns of red, yellow, and black bands. However, by using the rhyme, you can easily identify which is which. Additionally, coral snakes have round pupils and a small head, while king snakes have larger heads and elliptical pupils. It is important to be able to tell the difference between these two species in order to avoid a potentially dangerous encounter with a venomous coral snake.
know more about coral snake and a king snake, here:
https://brainly.com/app/ask?q=32372901
#SPJ11
Number 4……………………………..
If the new gene "works", then it will synthesize a missing enzyme or structural protein. A gene is a protein-coding nucleotide (DNA) sequence.
A gene is a fragment of DNA that is used by the cell to create a complementary mRNA sequence by a process called transcription.
Subsequently, this mRNA is then used to synthesize a protein by a process called translation.
When a gene is defective, a change in the nucleotide sequence (i.e., a mutation) can restore normal gene function and thus produce a functional protein.
Learn more in:
https://brainly.com/question/4275010
2) The data here indicates the number of species of amphibians that are
affected by several factors in their environments.Calculate
approximately how many times more amphibian species are impacted
by habitat change than the presence of pesticides and chemical toxins.
A) 3.5
B)
5
100
D) 2500
Answer: B. 5
Explanation:
PLEASE HELP ASAP I REALLY NEED HELP PLEASEEE 02.08 What's Your Big Idea?
You have previously written the introduction to your compare and contrast article. Now you will write the two body paragraphs to continue your compare and contrast article.
Note: One body paragraph is to compare similar features of both of your two chosen articles, and the other body paragraph is to contrast different features of both of your chosen articles. The body paragraphs are not summaries of each article.
View the grading rubric as you complete your assignment. This is your guide to a super submission.
You have previously written the introduction to your compare and contrast article. Now you will write the two body paragraphs to continue your compare and contrast article.
Be sure to use the information you previously wrote in your Compare and Contrast Organizer.
In your body paragraphs, remember to include:
Topic sentence for each body paragraph that relates to thesis
Support for your topic sentence with facts from your research
Signal phrases to identify ideas that are not your own
One direct quote, correctly punctuated
Transition phrases at the beginning of each paragraph
Technical language to show your understanding of the topic
Body paragraphs that compare and contrast two helpers
Write three or more complete sentences in each paragraph
Write in formal style using the third person point of view.
Use correct grammar, punctuation and spelling.
Add your introduction to the body.
Save your work to your computer or drive.
Submit your work in 02.08 What's Your Big Idea?
If needed, review your chosen articles.
Read the articles.
Article 1-Minutes That Matter
Article 2-Defeating Dragons
Article 3-Food That Fuels
Answer:
To start off, let's discuss how these two heroes are similar. First, these heroes we are talking about are teens. Yes, you heard it here folks these people are in between the age of 14 - 18. They also both help others. For example, Brittany Bergquist and her brother Robbie take time out of their day to provide more talk time for soldiers. On the other hand, team made up of girls and boys help people that need medical assistance 24 hours a day. But most importantly they both enjoy, love, and are amazed by what they are doing.
thats paragraph one youre going to do paragraph 2 yourself because im still working on paragraph 2
Explanation:
The distinguishable between Food that fuels and minutes that matter is one's to benefit soldiers to help communicate with his family while they fight for our country.
On the other hand is to help keep their families warm during the winter for the parents working to make ends meet.
First similarity of these two are that they both used recycled items to solve their problem within their families and meet the needs in their community.
But don't forget about the smart kids that came up with the idea to recycle their belongings to solve the problem and let nothing go to waste.
Another difference is that the solution to the obstacle affected the families and households different because the circumstances were totally opposite and now a family warm while a solider can call home to his family but all with smiles on their faces.
What is Food?Food is a substance consisting essentially of protein, carbohydrate, fat, and other nutrients used in the body of an organism to sustain growth and vital processes and to furnish energy.
The absorption and utilization of food by the body is fundamental to nutrition and is facilitated by digestion.
Plants, which convert solar energy to food by photosynthesis, are the primary food source.
Animals that feed on plants often serve as sources of food for other animals.
What is Fuel?Fuel is a substance that is burned to provide nuclear energy, heat or power.
Materials like coal, wood, oil, or gas can provide heat when burned. Methanol, Gasoline, Diesel, Propane, Natural gas, Hydrogen are types of fuel. Nuclear energy is produced by burning plutonium.
From fuel efficiency or fuel economy, we can measure how long any vehicle could travel, which is the opposite of fuel consumption.
Fuel consumption is the amount of fuel vehicle uses to travel a particular distance.
Fuel efficiency can be measured in kilometers per liter. The efficiency with which the fuel does a conversion of energy is known as fuel efficiency.
To learn more about Food are here
https://brainly.com/question/14836263
#SPJ2
.
what does dna have a high concentration of
Answer:
Nucleotides
Explanation:
DNA is made of chemical building blocks called nucleotides. These building blocks are made of three parts: a phosphate group, a sugar group and one of four types of nitrogen bases. To form a strand of DNA, nucleotides are linked into chains, with the phosphate and sugar groups alternating
Which of the following is an element?
A. MgBr
B.HCI
C.O
D.Cu(SO4)3
C. O
An element is a pure substance made up of only one type of atom. It cannot be broken down into simpler substances by chemical means. Of the options listed, only "O" is an element. "MgBr" is a compound made up of magnesium and bromine atoms, "HCI" is a compound made up of hydrogen and chlorine atoms, and "Cu(SO4)3" is a compound made up of copper, sulfur, and oxygen atoms.
Answer:
C.O
Explanation:
"C. O" (Oxygen) is an element.
An element is a pure substance that cannot be broken down into simpler substances by chemical means. It is made up of only one type of atom, with the same number of protons in its nucleus.
A. MgBr (Magnesium bromide) is a compound, which is made up of two or more elements chemically combined in a fixed ratio.
B. HCI (Hydrogen chloride) is a compound, made up of hydrogen and chlorine.
D. Cu(SO4)3 (Copper sulfate) is a compound, made up of copper, sulfur, and oxygen.
define double fertilisation in breif with example ??
Double fertilization refers to the situation in which a sperm is fused with the egg to form the embryo and another sperm combines with the polar nucleus to yield the endosperm.
The term double fertilization applies mostly to the angiosperms. The angiosperms are those flowering plants in which their seed is enclosed within a carpel.Hence, the term double fertilization refers to the situation in which a sperm is fused with the egg to form the embryo and another sperm combines with the polar nucleus to yield the endosperm.
Learn more about double fertilization: https://brainly.com/question/14592788
which process plays an important role in the biochemical cycles of carbon nitrogen and phosphorus
Answer:
C. Decomposition
Explanation:
The process that plays important role in the biogeochemical cycles of carbon, nitrogen, and phosphorus is called decomposition.
Answer:
Recycling process plays an important role in the biogeochemical cycles of carbon, nitrogen, and phosphorus.
Answer the following: 1. Describe the common tissues found in the organs of the intestinal tract.
2. Describe the common tissues and structures found in accessory organs
1. Common tissues found in the organs of the intestinal tract There are more than 100 million neurons in the small and large intestines of the gastrointestinal tract, which interact to control digestion, secretion, and absorption.
The walls of the intestinal tract contain four layers of tissue, as well as a mucous membrane that lines the internal surface of the organ. The four layers of tissue are:Epithelium: This layer lines the inner surface of the intestinal tract and is responsible for nutrient absorption and secretion. Connector tissue: The connective tissue layer contains the blood vessels, nerves, and lymphatic vessels that nourish and support the organ's other tissues.Muscularis: The muscularis layer is made up of smooth muscle cells that are responsible for the peristaltic movements that propel food through
the intestinal tract. In the small intestine, these movements help to mix the food with the digestive juices.Serosa: The serosa layer covers the organ's external surface and secretes a lubricating fluid that allows the intestinal tract to move freely within the abdominal cavity.2. Common tissues and structures found in accessory organs Accessory organs are the organs that assist in the digestive process but are not part of the gastrointestinal tract. These organs include the liver, pancreas, and gallbladder.
To know more about million visit:
https://brainly.com/question/28200508
#SPJ11
Hydra is able to perform all the following functions except; A. Photosynthesis B. Feeding C. Movement D. Egestion
Answer:
A is the answer
because the hydra is able to perform the rest!
Answer:
please make me brainalist and keep smiling
Explanation:
A. Photosynthesis
What does a Punnett square show?
a: all the possible offspring outcomes of a genetic cross
b: only the dominant alleles in a genetic cross
c: only the recessive alleles in a genetic cross
Answer:
a
Explanation:
the probability of an offspring with a given genotype resulting from a cross.
citation for Dragoi, V. Visual processing: Cortical pathways in Neuroscience Online: An Electronic Textbook for the Neurosciences
What is visual processing: Cortical Pathways?
The visual system is unique as much of visual processing occurs outside the brain within the retina of the eye.
Within the retina, the receptors synapse with bipolar and horizontal cells, which establish the basis for brightness and color contrasts. In turn, the bipolar cells (the 2° visual afferent) synapse with retinal ganglion cells and amacrine cells, which enhance contrast effects that support form vision and establish the basis for movement detection.
The information from the eye is carried by the axons of the retinal ganglion cells (the 3° visual afferent) to the midbrain and diencephalon.
The axons of the 3° visual afferents (the retinal ganglion cells) form the optic nerve fiber layer of the retina on their course to the optic disc. At the optic disc, the 3° visual afferents exit the eye and form the optic nerve.
The fibers of the optic nerve that originate from ganglion cells in the nasal half of the retina (i.e., the nasal hemiretina) decussate in the optic chiasm to the opposite optic tract.
Consequently, each optic tract contains retinal ganglion cell axons that originate in the nasal half of the contralateral retina and the temporal half of the ipsilateral retina. For example, the temporal (left) hemiretina of left eye and the nasal (left) hemiretina of right eye both have projected on them the right halves of their respective visual fields.
Consequently, each optic tract has within it axons representing the contralateral half of the visual field.
To learn more about Cortical Pathways: https://brainly.com/question/14643268
#SPJ4
An astronaut is planning a trip to a newly-discovered planet according to the law of universal gravitation, the astronaut weight in the new planet will be greater than his weight on earth if:
The new planet has more mass than Earth but the same radius. The mass of the astronaut will be calculated by the use of Newton's gravitational equation. The weight of the astronaut depends completely on its mass and the gravitational acceleration of the planet.
Gravitational acceleration is directly proportional to the mass of the planet and indirectly proportional to the radius of the planet. Hence, when the gravitational acceleration increases the planet's mass will increase therefore the radius will decrease. The astronaut's mass will depend on these factors.
Learn more about Gravitational acceleration, here
https://brainly.com/question/3009841
#SPJ1
All living things need to transport molecules from one place to another within the body in order to carry out necessary life functions. Water makes up approximately 60% of the human body. Which property of water best describes how it is able to transport these molecules from place to place and play such a vital role in life's functions?
Answer: Water as a universal solvent
Explanation:
Water is a universal solvent because of its property of dissolving a large number of molecules of different kind. The water at the biological level forms the major body weight of the organisms. It helps in supporting the cell metabolism and function. It is the main component of the liquid component of blood that is plasma. The water dissolved in it various vitamins, minerals, fibers, and other components of the food and helps in digestion of food in the body. Thus in human and animal body water plays an important role in circulation and digestion process.
PLEASE ANSWER IT'S DUE IN 30 MINUTES
Many athletes and runners describe themselves as "solar powered". Describe how this can be a true statement
Photovoltaic (PV) panels or solar radiation-concentrating mirrors are two ways that solar technologies turn sunlight into electrical energy. It is possible to utilise this energy to create electricity, store it in thermal or battery form, or both.
What is solar energy used for?
Anything produced by the sun is considered to be solar energy. Nuclear fusion that occurs in the sun is the source of solar energy. Hydrogen atom protons clash ferociously in the sun's core, where they fuse to form helium atoms, which is the process of fusion.
Among the applications for solar energy are solar water heating, solar water heating, solar ventilation, solar lighting, portable solar (for personal electronic devices), and solar mobility (for electric vehicles)
To learn more about solar powered refer to:
https://brainly.com/question/17711999
#SPJ2
Neurons contain several axons to carry impulses to a cell body. true or false
To transmit impulses to a cell body, neurons have several axons. This is not true.
What are Neurons?Informative messengers are neurons. The brain's various regions, the spinal cord, and the entire body can all communicate with one another using electrical and chemical signals. The neuron, a specialised cell created to carry information to other nerve cells, muscles, or gland cells, is the fundamental functional unit of the brain. Neurons are nervous system cells that communicate with other nerve, muscle, and gland cells by sending signals. The majority of neurons have an axon, dendrites, and a cell body. This is not an easy question to answer, at least for neurons in the brain. However, we can claim that the sensory, motor, and interneuronal neuron types are present in the spinal cord.To learn more about Neuron, refer to:
https://brainly.com/question/13061744
fat is the most efficient molecule for long-term energy storage even compared to carbohydrates because _____.
An O-glycosidic bond is shaped when the anomeric carbon of the sugar lays out a connection with the oxygen particle in the hydroxyl gathering of the liquor.
On the off chance that the anomeric carbon of the sugar makes the connection with the nitrogen particle of an amine, the bond is alluded to as an N-glycosidic bond.
Two monosaccharide units can be consolidated by glycosidic security — this is the essential linkage among the monosaccharide building blocks tracked down in all oligosaccharides. The glycosidic bond is framed between the anomeric carbon of one monosaccharide and a hydroxyl gathering of another.
The β-1,4-glycosidic bond has the hydroxyl bunch facing up. 1,4-glycosidic bonds can be tracked down in both amylase and amylopectin in starch. These linkages make stretching in the polysaccharide. There are numerous glycosidic linkages in polysaccharides because of the enormous number of hydroxyl bunches present.
To learn more about O-glycosidic bonds here
https://brainly.com/question/29717563
#SPJ4
Sarah learned that the steps of transcription and translation are similar to baking a cake from a recipe. The cell's genome is like a cookbook, with step-by-step directions. The mRNA copy is like writing down a copy of the instructions to give to someone else. What would the amino acids be most similar to?
The amino acids would be most similar to the ingredients used in the recipe.
When the mRNA moves out of the nucleus, it then gives the instructions (the genetic sequence) to someone else, which is tRNA. During translation, the tRNA and mRNA complex reads the genetic sequence and then binds required amino acids, sequentially. Thus, the combined amino acid chain forms the desired protein.
Therefore, the amino acids are the ingredients and the protein is the final dish.
To learn more about translation, go to:
https://brainly.com/question/29668811
IMPORTANT!1! DUE TOMORROW
Explain how 38 ATP are produced through the process of aerobic cellular respiration. Be sure to include the major energetic events in glycolysis, the conversion of pyruvate to Acetyl-CoA, the Krebs cycle, and the electron transport chain.
.................................................................