Answer:
the correct answer would be C.Liver
Explanation:
because kidneys, ureters, and bladder are all parts of the urinary system
why does plastic deformation occur in the lower crust?
A. Rocks are hot
B. Rocks are strong
C. Tension occurs in the lower crust
D. The mantle is plastic
A
Explanation:
because when temperatures and pressures are higher usually which makes a rock break
Plastic deformation occur in the lower crust because rocks are hot.
What do you mean by plastic deformation?"The meaning of plastic deformation is a permanent deformation or change in shape of a solid body without fracture under the action of a sustained force."
Where does plastic deformation occur?"Plastic deformation in the form of slip occurs along the close-packed lattice planes, where the energy requirement for dislocation motion is minimized."
What are the types of plastic deformation?Plastic deformation in a metal has two prominent mechanisms, and they are:
Slip Twinning Slip Twinning.To know more about plastic deformation here https://brainly.com/question/12975550
#SPJ2
1 Answer:
HACCP is a program designed to create awareness of potential points
of contamination in a food-processing facility.
a. true
b. false
2 Answer:
A bacteriostatic agent uses static electricity to remove bacteria
from a surface.
a. true
b. false
3 Answer:
The three major sources of contamination in a food processing plant
are people, processing equipment, and the plant environment.
a. true
b. false
4 Answer:
Water hardness is a measure of the presence of substances in water
that form insoluble precipitates with soap.
a. true
b. false
5 Answer:
The floor of a food processing facility should have an unfinished
concrete surface for easy cleaning.
a. true
b. false
Hilton confessed to killing 7 people.
Answer: Hilton Confessed To Killing 7 People. He Stated That He Didn't Care About Those People He Told The Police That He Is Indifferent And He Did Not Feel Any Quilt Or Remorse For What He Did. ... His Ex-wife Told The Police That She Believed He Would Do Something So Terrible.
Explanation:
Ravi is driving her car, hits a patch of ice, and momentarily loses control of the vehicle. Despite spinning in a full circle, Ravi manages to
avoid hitting any objects and drives away unharmed. Ravi experiences a surge of adrenaline and a racing heartbeat to due to the activation
of which of the following?
O sympathetic nervous system
O parasympathetic nervous system
O thyroid gland
O somatic nervous system
O pancreas
Ravi is driving her car, hits a patch of ice, and momentarily loses control of the vehicle. Ravi experiences a surge of adrenaline and a racing heartbeat to due to the activation due to Symphthetic nervous system.
What is Symphathetic nervous system?Autonomic nervous system includes the sympathetic nervous system. It might be referred to as your "automatic" nervous system because it controls a variety of processes that don't require conscious thought.
The ability of your sympathetic nervous system to react to risky or stressful conditions is its most well-known function.
When this happens, your sympathetic nervous system kicks in to help you escape danger by increasing your heart rate, pumping more blood to areas of your body that need it, and other responses.
Therefore, Ravi is driving her car, hits a patch of ice, and momentarily loses control of the vehicle. Ravi experiences a surge of adrenaline and a racing heartbeat to due to the activation due to Symphathetic nervous system.
To learn more about sympathetic nervous system, refer to the link:
https://brainly.com/question/28485355
#SPJ1
Explain enzyme inhibition
(In basic terms because this is a biology 101 class)
A chemical that prevents an enzyme from working. Enzymes participate in a variety of cell processes, such as cell signaling, growth, and division, as well as accelerating chemical reactions in the body. Enzyme inhibitors may be used in the treatment of cancer to prevent the growth of particular enzymes required by cancer cells.
✓
What disorder can change morphology?
Answer:
brain disorder
Explanation:
___________________ play(s) an important role in moving Earth's lithospheric plates.
Answer:
Convection currents
Explanation:
Convection currents are in the mantle and move the tectonic plates.
Please Mark Brainliest!
1. After examining the DNA fingerprint of the victim and then the seven suspects, which
suspect committed the crime? How did you determine this?
2. When looking at the DNA fingerprints for the sets of twins, write “identical” or “fraternal”
next to the corresponding sets of letters:
AA
BB
CC
DD
3. How did you determine which twins were fraternal and which were identical?
4. Make up a mystery. Write a crime story using the information in this lab activity (1 page
minimum; write 1.5+ pages for full credit). Give names to the suspects and develop a
mystery plot, solving it including who you discovered as the criminal in this lab. Make
sure your story includes detailed description and dialogue between characters.
1. DNA evidence alone is not always sufficient to determine guilt or innocence, and any determination of criminal responsibility requires a thorough and fair legal process.
2. Identical: AA, CC; Fraternal: BB, DD
3. Identical twins come from a single fertilized egg that splits into two, while fraternal twins come from two separate eggs that are fertilized by two different sperm. Identical twins will have identical DNA fingerprints, while fraternal twins will have similar but not identical fingerprints. The only way to definitively determine whether twins are identical or fraternal is through genetic testing.
4. Detective Jane Smith is on the case to solve a robbery at a local jewelry store. The owner claims a valuable diamond ring was stolen.
There are three suspects: John, Sarah, and Mike, all former employees of the store. Jane investigates and takes DNA samples from the crime scene and from the suspects. After analyzing the DNA fingerprints, she discovers that the DNA from the crime scene matches Sarah's DNA. When confronted, Sarah admits to stealing the ring because she needed money to pay off her gambling debt. Sarah is arrested, and the ring is returned to the store owner.
To know more about DNA evidence, visit:
https://brainly.com/question/28895902
#SPJ1
Professionals in the field of psychology maintain a set of core values and ethics that differs slightly from
those held by social workers, because the needs and challenges of psychology patients are typically greater
than for clients who receive social services. Among the core values of psychologists are the efforts to treat
clients with fairness and honesty, to respect clients, and to
O discuss one client's problems with other clients
O do no harm to clients
O dispense prescriptions to clients
O criticize clients
Among the core values of psychologists are the efforts to treat clients with fairness and honesty, to respect clients, and to do no harm to clients and is denoted as option B.
Who is a Psychologist?This is referred to as a trained mental health professional who helps people handle their mental health challenges through the use of various types of methods and techniques.
They are involved in the treatment of clients with fairness and honesty which is a sign of respect and are not involved in dispensing of prescriptions to clients which is instead done by psychiatrists thereby making option B the correct choice.
Read more about Psychologist here https://brainly.com/question/11708668
#SPJ1
1. The following gene sequence appears on one strand of a segment of DNA that is about to go
through DNA Replication. What code will DNA Polymerase build to make the complementary
strand?
TACGGCATATGCAAATGGCGAGCCTATATT
The DNA polymerase will build the complementary strand with the code: ATGCCGTATACGTTTACCGCTCGGATATA.
What is DNA replication?DNA replication is a process by which a DNA molecule makes a copy of itself. During DNA replication, an enzyme called DNA polymerase reads the existing DNA strand and builds a new complementary strand by matching up the appropriate nucleotides.
To build the complementary strand of DNA, we need to use the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).
So, for each base in the original sequence, we will pair it with its complement:
Original strand: TACGGCATATGCAAATGGCGAGCCTATATTComplementary strand: ATGCCGTATACGTTTACCGCTCGGATATALearn more about DNA Replication here: https://brainly.com/question/21265857
#SPJ1
The complementary strand to the given sequence would be:
ATGCCGTATACGTTTACCGCTCGGATATAA
What is gene sequence?A gene sequence is a specific sequence of nucleotides in DNA (or RNA) that encodes the genetic information for a particular trait, function or protein. Genes are the basic unit of heredity and are responsible for passing on traits from one generation to the next.
The complementary strand of DNA will have a sequence that pairs each nucleotide with its complementary base: adenine (A) with thymine (T), and cytosine (C) with guanine (G). Therefore, the complementary strand to the given sequence would be:
ATGCCGTATACGTTTACCGCTCGGATATAA
During DNA replication, DNA polymerase reads the existing strand from 3' to 5' and builds the complementary strand in the 5' to 3' direction. Therefore, the new strand would be synthesized by adding nucleotides in the following order:
ATA...CGT...TAA...CGC...TGG...ATA
Learn about complementary strand here https://brainly.com/question/1534778
#SPJ1
in which biome are minerals in the soil most rapidly depleted
Answer:
Boreal forest is among the largest terrestrial biomes on earth in which minerals in the soil most rapidly depleted.
why do the body need specialized cells?
Answer: Hello, There! your Answer is Below!!
specialized cells allow for different types of tissues to exist in our organs, so that the organs can perform different functions in our organ systems.
Explanation:
Cell specialization allows new cells to develop into a range of different tissues, all of which work together to make living organisms function as a whole.
Hope this helps!!!
Have a great day!!!
does the efficiency of a cell depends on its complexcity
Answer:
No, the efficiency of a cell does not always depend on its complexity
Explanation:
hope it helps
Topic Test
Topic Review Activity
Active
8
Which of the following is not a component of soil?
a. organic material
b. minerals
C. gases
d. none of the above
at the bort answer from the choices provided
2
3
Answer:
D. None of the above
Explanation:
Soil contains rocks (minerals), leaves, decomposed material (organic material, as well as water and air (gas).
Explain a benefit of heat energy to work. Heat energy will always produce more work. Heat energy is the only source of work. Heat energy can transfer energy to help with movement of objects. Work cannot be done without heat energy.
Answer:
heat energy
Explanation:
Heat energy will always produce more work. Heat energy is the only source of work. Heat energy can transfer energy to help with movement
What is the image
of the point (3, 1)
translated 8 units
left and 3 units
up?
Answer:
(-5,4)
Explanation:
cuz u take 3-8 witch gives u -5 and u do 3+1 witch gives u 4
also u can take the long way and count backwards from 3
12. Which of the following in NOT a reason for the government to provide renewable energy subsidies?
A.to boost the economy
B.to improve the environment
C.to reduce dependence on foreign supplies
D.to decrease energy security
Answer:
decrease energy security
Renewable energy is energy that is collected from renewable resources that are naturally replenished on a human timescale. The option (D) is correct.
What is renewable energy?Renewable energy is energy derived from natural sources that are replenished at a higher rate than they are consumed. Sunlight and wind, for example, are such sources that are constantly being replenished.
Moreover, renewable energy provides reliable power supplies and fuel diversification, which enhance energy security and lower risk of fuel spills while reducing the need for imported fuels. Renewable energy also helps conserve the nation's natural resources.
Hence, generating energy that produces no greenhouse gas emissions from fossil fuels and reduces some types of air pollution. Diversifying energy supply and reducing dependence on imported fuels.
Learn more about renewable energy:
https://brainly.com/question/17373437
#SPJ2
Earth's temperature has increased slightly in the last 100 years. Many scientists believe that
the increase is related to human activities, particularly the burning of fossil fuels. What gas
produced in this process has been most closely linked to rising atmospheric temperatures?
A) soot
B) chlorofluorocarbons
C) nuclear waste
D) carbon dioxide
The gas produced in the burning of fossil fuels that has been most closely linked to rising atmospheric temperatures is carbon dioxide. Option D
What is the burning of fossil fuel?
As a byproduct of combustion when fossil fuels like coal, oil, and natural gas are used to produce energy, carbon dioxide is discharged into the atmosphere.
As a greenhouse gas, carbon dioxide absorbs heat from the sun inside the Earth's atmosphere, creating the greenhouse effect, which causes global warming. The Earth's natural greenhouse effect, which keeps the globe warm enough to support life, is caused by this phenomena.
Learn more about fossil fuel:https://brainly.com/question/31522482
#SPJ1
In a certain breed of dog spotted fur color is dominant over solid fur color. Smooth fur is dominant over rough fur. If a heterozygous spotted colored dog with rough fur is mated to a solid-colored, homozygous smooth-furred dog provide the ratio of possible phenotypic outcomes.
a
1 spotted smooth : 1 solid smooth
b
3 spotted smooth: 1 solid rough
c
1 spotted smooth: 1 solid smooth: 1 solid smooth: 1 solid rough
d
1 spotted smooth: 1 spotted rough
The possible phenotypic outcomes and their ratios are:
Spotted smooth: 1 SsPp
Solid smooth: 1 ssPP
The genotype of the heterozygous spotted-colored, rough-furred dog is SsRr, where S is the dominant allele for spotted fur color, s is the recessive allele for solid fur color, R is the dominant allele for rough fur, and r is the recessive allele for smooth fur.
The solid-colored, homozygous smooth-furred dog's genotype can be expressed as ssrr.
The offspring's phenotypic ratio can be computed by counting the number of individuals with each phenotype and expressing the result as a ratio. The various phenotypic outcomes and their ratios in this scenario are:
1 smooth-furred spotted: 1 smooth-furred solid
1 solid, rough-furred: 3 spotted, smooth-furred
learn more about phenotype here
https://brainly.com/question/22117
#SPJ1
Can someone help me with this question WILL MARK BRAINLIEST 100 POINTS!!
what are the characteristics steps of the scientific method?
The Rh factor is also known as the
antigen.
A. monoclonal
B. polyclonal
C. D
D. X
E. AB
Answer:
Explanation:
Option E is the correct answer
Answer:
C. D
Explanation:
RBCs that are Rh positive express the one designated D (RhD antigen).
-TheUnknownScientist
•Based on cellular respiration, why does cardiac arrest (heart stops beating) decrease brain activity? Hint: think about what happens in the absence of blood flow and oxygen levels.
Answer:
the heart stops pumping as much blood to the brain which will lower the amount of funtion.
in a scientific experiment , an experimental group is
What plane is
the segittal sutures located
Describe the mechanism of glycolysis in detail
The process of Glycolysis is a catabolic process in which two molecules glucose goes through a ten- step pathway and yield two molecules of pyruvate . It is a major part of carbohydrate metabolism .
Mechanism Of Glycolysis
The glycolysis is also known as EMP pathway and it is involved in both aerobic and anaerobic conditions .There are two phases in the mechanism of glycolysis in which 5 reactions takes place in each phase and the process of glycolysis takes place in cytosol
Preparatory phase refers to the generation of two molecules of glyceraldehyde 3-phosphate from one molecule of glucose which further goes into the payoff phase . In this phase two molecules of ATP are used and two regulatory enzymes were involved in this reaction .
Payoff phase refers to the further break down of two molecules of glyceraldehyde3-phosphate to two molecules of pyruvate . In this phase four molecules of ATP and two molecules of NADH are generated . In this phase only one regulatory enzyme is involved which is the breakdown of PEP to pyruvate .
Both the phases of glycolysis takes place in the cytoplasm and there are three enzymes that involved in regulating the glycolytic pathway .This process is also known as the catabolic process .
To learn more about glycolysis
https://brainly.com/question/26990754
(ix) Rh blood group system is encoded by three genes C, D and E which occupy----
tightly linked loci
(A) four
(B) three
(C) five
(D) two
Rh blood group system is encoded by three genes C, D and E which occupy 3 tightly linked loci. Option B
What should you know about Rh blood group system?The Rh blood group system is typically considered to be encoded by three loci namely; one for RHD, and two for the RhCE (C and E) antigen variations.
The RHD locus is known to encode the D antigen, which is the most important Rh antigen.
The RhCE locus encodes the C and E antigens, which are less common than the D antigen.
The Rh blood group system is important for blood transfusions, as it determines whether or not a person's blood is compatible with another person's blood.
Find more exercises on Rh blood group system;
https://brainly.com/question/30668976
#SPJ1
What is the answer to that question
Answer:
D. Steps to use for doing the Heimlich maneuver
Explanation:
That's what the section is talking about.
don't mind the blue dot
Answer:
an organelle found in plant leaves
Good luck!
Answer:
An organelle found in plant leaves
Explanation:
Chloroplasts are organelles that are found in plant leaves. They are one of the reasons why plant leaves are green because they have a pigment called chlorophyll which is a green pigment that gives plants the green color. Chloroplasts are present in the cells of all green tissues of plants and algae.
how does grass affect the movement of water?
Answer:
Even turf grass lawns restrict water flow into the ground and actually become nearly as impervious as paved surfaces because of turf grass’s densely-matted root structure. During and after a rainstorm, water rushing off impervious surfaces can be significant. This water is called runof