The percent yield will be 90.2% if the reaction is performed using an excess of aluminum and 55.7 grams of bromine.
Thus, the actual yield and theoretical yield are compared, and the difference is expressed as a percentage to get the percent yield. A yield of 60.0 grammes of aluminum bromide is reported as the actual yield. The quantity of aluminum bromide produced depends on the amount of bromine utilized is calculated to determine the theoretical yield.
According to the equation that is balanced, the molar ratio of aluminum bromide to bromine is 2:3. The number of moles of bromine consumed is estimated using the provided quantity of bromine (55.7 grammes).
We determine the theoretical yield to be around 0.232 mol using the mole ratio. By dividing the theoretical yield by the actual yield (60.0 g) and multiplying the result by 100, the percent yield will be 90.2%.
Learn more about the percent yield here:
https://brainly.com/question/17042787
#SPJ1
calculate the molar solubility of barium fluoride (for which ksp=2.45×10−5) in each liquid or solution.
The molar solubility of barium fluoride (BaF2) in a liquid or solution can be calculated using the Ksp value. So, the molar solubility of barium fluoride in the liquid or solution is approximately 1.83×10^-2 M.
The equation for the Ksp of BaF2
Ksp = [Ba2+][F-]^2
where [Ba2+] is the molar concentration of Ba2+ ions and [F-] is the molar concentration of F- ions in the solution.
To calculate the molar solubility of BaF2 in a liquid or solution, we need to determine the maximum concentration of Ba2+ and F- ions that can exist in equilibrium with solid BaF2 at a given temperature. This maximum concentration is the molar solubility of BaF2 in that liquid or solution.
For example, let's calculate the molar solubility of BaF2 in pure water at room temperature (25°C). From the K s p equation, we know that:
K s p = 2.45×10−5 = [Ba2+][F-]^2
Assuming that the initial concentration of Ba2+ and F- ions in pure water is zero, we can let x be the molar solubility BaF2. Then, we have:
Ksp = [Ba2+][F-]^2 = (x)(2x)^2 = 4x^3
Solving for x, we get:
x = (Ksp/4)^(1/3) = (2.45×10−5/4)^(1/3) = 0.0089 M
Therefore, the molar solubility of BaF2 in pure water at room temperature is 0.0089 M.
We can similarly calculate the molar solubility of BaF2 in other liquids or solutions by using the same method and plugging in the appropriate Ksp value.
To calculate the molar solubility of barium fluoride in a liquid or solution, you'll need to use the Ksp (solubility product constant) value provided (2.45×10^-5). Here's a step-by-step explanation:
1. Write the balanced dissociation equation for barium fluoride:
BaF2(s) ↔ Ba^2+(aq) + 2F^-(aq)
2. Set up the solubility equilibrium expression using Ksp:
Ksp = [Ba^2+][F^-]^2
3. Define the molar solubility (x) of barium fluoride in the liquid or solution:
[Ba^2+] = x, [F^-] = 2x
4. Substitute the molar solubility values into the Ksp expression:
2.45×10^-5 = (x)(2x)^2
5. Solve for x (molar solubility):
2.45×10^-5 = 4x^3
x^3 = (2.45×10^-5)/4
x^3 = 6.125×10^-6
x = (6.125×10^-6)^(1/3)
x ≈ 1.83×10^-2 M
So, the molar solubility of barium fluoride in the liquid or solution is approximately 1.83×10^-2 M.
Visit here to learn more about barium fluoride:
brainly.com/question/30540737
#SPJ11
This element has an atomic number lower than aluminum and is in group 14
Answer:
that is impossible. the atomic number can only go up each group
What are the 3 types of zeros?
Answer the following questions about C₂H4O.
(a) C₂H4O (molar mass 44.06g/mol) is a gas at room temperature and can be harmful at concentrations above
8.17 x 10-6M. What is the maximum mass of this compound that can safely be present in a room with a volume of
3.00 x 105L?
Answer:To calculate the maximum mass of C₂H4O that can safely be present in a room with a volume of 3.00 x 10^5 L, we need to convert the concentration limit of 8.17 x 10^-6 M to mass. The molar mass of C₂H4O is 44.06 g/mol. Therefore, the maximum mass of C₂H4O that can safely be present in the room is:
8.17 x 10^-6 M x 44.06 g/mol x 3.00 x 10^5 L = 10.9 g
So, the maximum mass of C₂H4O that can safely be present in the room is 10.9 g.
now let's try one without any help from the simulation. write a balanced chemical equation for the combustion reaction of ethane gas (c2h6 ) and oxygen gas (o2 ), then answer the following questions: (o) how many moles of carbon dioxide are produced from the combustion of 5.35 moles of ethane gas? (you may assume you have an excess of oxygen gas) (p) how many moles of carbon dioxide are produced from the combustion of 4.59 moles of oxygen gas? (you may assume you have an excess of ethane gas) (q) how many moles of carbon dioxide are produced from the combustion of 5.35 moles of ethane gas with 4.59 moles of oxygen gas? (r) how much excess reactant remains after the reaction described in (q)?
The balanced chemical equation for the combustion of ethane gas and oxygen gas is:
C2H6 + 3.5O2 → 2CO2 + 3H2O
where the coefficients represent the stoichiometric coefficients.
(o) To determine the number of moles of carbon dioxide produced from the combustion of 5.35 moles of ethane gas, we first need to determine the limiting reactant. Since oxygen is present in excess, ethane is the limiting reactant. From the balanced equation, we know that 2 moles of CO2 are produced for every 1 mole of ethane combusted. Therefore, 5.35 moles of ethane will produce:
2 moles CO2/mol ethane × 5.35 mol ethane = 10.7 moles CO2
(p) To determine the number of moles of carbon dioxide produced from the combustion of 4.59 moles of oxygen gas, we need to determine the limiting reactant. Since ethane is present in excess, oxygen is the limiting reactant. From the balanced equation, we know that 2 moles of CO2 are produced for every 3.5 moles of oxygen combusted. Therefore, 4.59 moles of oxygen will produce:
2 mol CO2/3.5 mol O2 × 4.59 mol O2 = 2.62 moles CO2
(q) To determine the number of moles of carbon dioxide produced from the combustion of 5.35 moles of ethane gas with 4.59 moles of oxygen gas, we need to determine the limiting reactant. From the balanced equation, we can see that 3.5 moles of oxygen are required to completely combust 1 mole of ethane. Therefore, 5.35 moles of ethane require:
3.5 mol O2/mol ethane × 5.35 mol ethane = 18.725 mol O2
Since we only have 4.59 moles of oxygen, it is the limiting reactant. From the balanced equation, we know that 2 moles of CO2 are produced for every 3.5 moles of oxygen combusted. Therefore, 4.59 moles of oxygen will produce:
2 mol CO2/3.5 mol O2 × 4.59 mol O2 = 2.62 moles CO2
(r) To determine the amount of excess reactant remaining after the reaction described in (q), we need to compare the moles of oxygen required for complete combustion of ethane with the moles of oxygen present. From (q), we know that 5.35 moles of ethane require 18.725 moles of oxygen. Since we only have 4.59 moles of oxygen, we can calculate the amount of excess ethane as follows:
18.725 mol O2 required − 4.59 mol O2 present = 14.135 mol O2 excess
Since ethane and oxygen react in a 2:3.5 ratio, the excess ethane can be calculated as:
2 mol ethane/3.5 mol O2 × 14.135 mol O2 = 8.09 mol ethane excess.
For more questions like chemical equation visit the link below:
https://brainly.com/question/31139039
#SPJ11
Critical thinking : Place an unmagnetized piece of iron in a magnetic field (eg iron filings near a magnet). Why is it attracted to the magnet?
Magnets attract iron due to the influence of their magnetic field upon the iron. Before a piece of iron enters the magnet, the polarization of the irons atoms is random. When exposed to the magnetic field, the atoms begin to align their electrons with the flow of the magnetic field, which makes the iron magnetized as well. This, in turn, creates an attraction between the two magnetized objects. This is why a piece of iron that is exposed to a magnet becomes magnetic for some time afterward.
Foods that are basic can be identified by what taste
Explanation:
sweet,sour,salty, savoury
Answer: bitter
Explanation:
с
E
G
Making Esters
1. Name the following esters and give the name of the alcohol + carboxylic reacted to make each one.
н н
но
I "I
нн
н-с-с-о-С-С-Н
II
H H
Н
н н
Н
H-C-c-c
I+
O-C-H
нн
Н
Н
Kш
H - C-C
H
ННН
НН Н
11
0 — c— с — с-н
| | |
НН Н
0
НННН
H— C - c— C-c
||| 0 — c — c — c — C-H
ННН
| |
НННН
|
|
В
D
F
H-C-c-c
Н Н
Н
O=
О
н н
o - C - C -Н
|
Н Н
|
Н
НННН
H-C-C
Kul
Н
— с - с - с -C-H
||||
НННН
Н Н
жен
H- C-C -
0-
Н Н
H-C
НН
Н
1
— c — c — C-H
|||
НН Н
н н
O-C-C-H
| |
Н Н
Answer:
A. Ethyl acetate (ethyl alcohol + acetic acid)
H
|
H--C--O--C--H
|
CH3
B. Butyl formate (butyl alcohol + formic acid)
H
|
H--C--O--CH3
|
CH3CH2CH2CH2
C. Methyl benzoate (methyl alcohol + benzoic acid)
H
|
H--C--O--C6H5
|
CH3
D. Ethyl butyrate (ethyl alcohol + butyric acid)
H
|
H--C--O--C3H7
|
CH2CH3
E. Propyl propionate (propyl alcohol + propionic acid)
H
|
H--C--O--C--CH3
| |
CH3 CH2CH3
F. Methyl propanoate (methyl alcohol + propanoic acid)
H
|
H--C--O--C2H5
|
CH3
G. Butyl benzoate (butyl alcohol + benzoic acid)
H
|
H--C--O--C6H5
|
CH3CH2CH2CH2
H. Ethyl hexanoate (ethyl alcohol + hexanoic acid)
H
|
H--C--O--C5H11
|
CH2CH3
I. Butyl pentanoate (butyl alcohol + pentanoic acid)
H
|
H--C--O--C4H9
|
CH3(CH2)2
J. Methyl pentanoate (methyl alcohol + pentanoic acid)
H
|
H--C--O--C4H9
|
CH3
(Please could you kindly mark my answer as brainliest you could also follow me so that you could easily reach out to me for any other questions)
When a compound is described as a strong acid it means that:
a. the acid solution is dilute
b. the acid solution is concentrated
c. the acid mostly dissociates when dissolves in water
d. the acid mostly solvates when it dissolves in water
The acid mostly dissociates when dissolves in water.
option C.
What is a strong acid?A strong acid is an acid that is completely dissociated in an aqueous solution such as water when it is dissolved in it. Strong acid is a chemical species with a high capacity to lose a proton, H+.
In other words, a strong acid is one which is virtually 100% ionized in solution.
Thus, when a compound is described as a strong acid it means that: the acid mostly dissociates when dissolves in water.
So option C is the correct answer as it explains the meaning of a strong acid.
Learn more about strong acid here: https://brainly.com/question/24586675
#SPJ1
List all soluble salt
Answer:
Calcium, potassium, aluminum, chlorine, bromine
Explanation:
I do not know all of them, but here are some.
What is bioaccumulation? Describe how mercury in plankton can affect humans. Use the following: (a) human (b) largerfish (c) mercury (d) plankton (e) small fish
Bioaccumulation refers to the process by which substances, such as pollutants or toxins, accumulate and increase in concentration within the tissues of organisms over time. In the case of mercury in plankton, it can have a cascading effect on various organisms, including humans.
Plankton, which are microscopic organisms found in water bodies, can absorb mercury from their environment. Larger fish, such as predatory fish, consume these plankton as a part of their diet. Through the process of bioaccumulation, the mercury that was initially present in the plankton accumulates in the tissues of these larger fish, resulting in higher mercury levels.
When humans consume these larger fish, they are exposed to the accumulated mercury. Mercury is a toxic substance that can have detrimental effects on human health, particularly when ingested in high amounts. It can affect the nervous system, leading to neurological disorders, cognitive impairments, and developmental issues, especially in fetuses and young children.
The transfer of mercury from plankton to larger fish to humans highlights the importance of understanding the bioaccumulation process and its potential impact on different organisms within the food chain. It emphasizes the need for monitoring and managing mercury levels in aquatic ecosystems to safeguard human health and the health of other organisms.
To learn more about bioaccumulation, visit:
https://brainly.com/question/28521708
#SPJ11
how many grams are in 8.00 moles of magnesium
A compound with an empirical formula of CH2O has a molar
mass of 60 g/mol. What is its molecular formula?
Answer:
c2h4o2
Explanation:
I am using my cell. This could take a bit
The Empical formula has a mass of
C 12
2H 2
O 16
total = 30
The molecular mass is given as 60 which is 2 times the empirical mass. Therefore multiply each element by 2 in the empirical formula.
You get C2H4O2
A cell is placed in a salt solution that has the same concentration as the inside of the cell. What will happen to the cell?
A) The cell will contract.
B) The cell will expand slightly.
C) The cell will burst.
D) The cell will remain the same size.
Answer:
d
Explanation:
Question 4 of 25
What is a pattern in nature?
A. A set of measurements that answers a scientific question
OB. An event that occurs over and over
OC. A collection of scientific theories that helps scientists understand
the world
OD. An arrangement of objects that are in predictable places
The pattern in nature is option B. An event that occurs over and over.
The pattern in nature is seen in regularities of shapes found inside the natural international. these styles recur in exceptional contexts and can now and again be modeled mathematically. natural styles include symmetries, timber, spirals, meanders, waves, foams, tessellations, cracks, and stripes.
Patterns are normal and intelligible bureaucracies or sequences that may be observed at some stage in nature. clinical questions may be generated whilst scientists have a look at a pattern of activities or while something does now not healthy a longtime sample. Scientists can use patterns to classify gadgets or phenomena into corporations.
Learn more about nature here:-https://brainly.com/question/24514288
#SPJ9
howany grams of carbon dioxide CO2 is produced when 3.5 moles of octane C8H18 is burned ?
Answer:
1232 g of carbon dioxide are formed
Explanation:
As octane is being burned it would be combustion reaction.
writing the balanced equation:
C8H18 + 25/2 O2 → 9 H2O + 8 CO2
now stepping up mole ratio from the balanced equation:
moles of octane : moles of carbon dioxide
1 : 8
3.5 : X
X = 3.5 x 8 = 28
therefore when 3.5 moles of octane are burned in air 28 moles of carbon dioxide are evolved.
now in order to calculate the mass of CO2 formed
molar mass of CO2 = 12 + (16 x 2) = 44g
now calculating the mass of 28 moles:
moles : mass
1 : 44 g
28 : X
X = 28 x 44 = 1232 g
1232 g of CO2 are formed
What is the Molecular Formula for Fiber?
Answer:
Description. Dietary fiber is mostly derived from the plant cell wall. It mainly includes cellulose, hemicellulose, pectic polysaccharides, oligosaccharides, resistant starch, and lignin.
Explanation:
I hope help you and thanks for heart and rate my answer
Which of these compounds would you expect to be least soluble in water? CH3OH NaCl CCl4 NH3
The compound that would be least soluble in water is CCl4. Solubility is the property of a substance to dissolve in a solvent. Solubility refers to the maximum amount of a solute that can be dissolved in a given quantity of solvent at a given temperature.
A substance that can dissolve in a solvent is said to be soluble in the solvent.The water molecule is polar and has two ends of opposite charges. The oxygen end of the molecule has a negative charge, while the hydrogen ends have a positive charge. Polar solvents like water dissolve polar solutes, and nonpolar solvents dissolve nonpolar solutes. The water molecule cannot dissolve nonpolar solutes like CCl4.However, NaCl is an ionic compound that can dissolve in water. NH3 is polar, like water, and can dissolve in water. CH3OH is polar and can dissolve in water. Therefore, CCl4 is the compound that would be least soluble in water.
To know more about Solubility visit-
https://brainly.com/question/31493083
#SPJ11
Based on the formula given in the chapter 7 nutrition moodle outline, how much protein should a person consume daily if he/she weighs 100 pounds?
If he/she weighs 100 pounds, 36 gm of protein should be consumed by a person if he/she weighs 100 pounds.
It is very important to maintain a balanced diet.
There are two ways to find the amount of protein consumed per day by a person.
1. Weight in pounds, multiplied by 7, divided by 20
2. And the second way is to simply multiply the weight in pounds by 0.36.
As we all know, it is very important to consume all the nutrients in order to maintain a healthy body. Protein is one of the seven essential nutrients in a well-balanced diet.
It is used to repair cells and also helps with growth in children.
Here is more information about a protein consumption: https://brainly.com/question/18454587?referrer=searchResults:
#SPJ4
A reaction rate is the change in of a reactant or product with
Answer:
the rate of reaction is the speed at which a chemical reaction takes place
In which Group do most of the elements have 8 valence electrons?
A. Transition metals
B. Alkaline earth metals
C. Halogens
D. Noble gases
The point in a neutralization reaction where the number of moles of hydrogen ions is equal to the number of moles of hydroxide ions is called the ___________.
The point in a neutralization reaction where the number of moles of hydrogen ions is equal to the number of moles of hydroxide ions is called the equivalence point.
What is the equivalence point in a neutralization reaction?In a neutralization reaction between an acid and a base, the equivalence point is the point at which the acid and base have reacted in a stoichiometrically equivalent amount. This means that the number of moles of hydrogen ions from the acid is equal to the number of moles of hydroxide ions from the base. At the equivalence point, the solution is neutral and has a pH of 7.
The equivalence point can be determined experimentally by adding a solution of known concentration to the acid or base until the solution reaches a pH of 7. The equivalence point is an important concept in analytical chemistry, as it can be used to determine the concentration of an unknown solution.
Learn more about Equivalence point
brainly.com/question/29999744
#SPJ11
(05.06 LC)
Which of the following statements best defines the percentage yield of a reaction?
(5 points)
The ratio of measured yield over actual yield
The amount of product measured after a reaction
The amount of measured yield over calculated yield
The maximum amount of product that can be obtained
Answer:
C
Explanation:
because percentage yield =actual/theoretical yield
The statements best defines the percentage yield of a reaction will be "The amount of measured yield over calculated yield".
What is percentage yield?The quantity of material that actually forms during the process in a lab setting is known as the actual yield. The actual yield to theoretical yield ratio stated as a percentage has been known as even the percent yield.
Percentage yield can be expressed as:
Percentage yield =actual/theoretical yield
What is calculated yield?The volume of a chemical reaction's calculated yield would be its final product.
The statement best defines the percentage yield of a reaction will be "The amount of measured yield over calculated yield".
Therefore, the correct answer will be an option (C).
To know more about percentage yield and calculated yield
https://brainly.com/question/27492865
#SPJ3
Conduct a survey of 5-7 people in your locality to know the usage of plastic bags and awareness to among people regarding their usage
The usage of plastic bags and the level of awareness among people in your locality. Summarize the findings in a report or presentation, highlighting key findings and any recommendations for promoting sustainable alternatives to plastic bags.
As an AI language model, I don't have direct access to real-time data or the ability to conduct surveys. However, I can provide you with a general framework for conducting a survey on the usage of plastic bags and awareness among people. Here are the steps you can follow:
Define your survey objectives: Determine the specific information you want to gather about the usage of plastic bags and people's awareness. This will help you design appropriate survey questions.
Create survey questions: Develop a set of questions that capture the key aspects you want to investigate. These may include questions about the frequency of plastic bag usage, reasons for using or not using them, knowledge about the environmental impact, and willingness to adopt alternatives.
Determine the sample size: Decide on the number of respondents you want to survey. Aim for a sample size that provides a representative perspective of your locality, but keep in mind the practicalities of reaching out to and collecting responses from the selected participants.
Select participants: Randomly select or identify individuals within your locality to participate in the survey. Consider diversifying the sample to include people of different ages, occupations, and backgrounds for a more comprehensive understanding.
Draw conclusions and report findings: Based on the analyzed data, draw conclusions about the usage of plastic bags and the level of awareness among people in your locality. Summarize the findings in a report or presentation, highlighting key findings and any recommendations for promoting sustainable alternatives to plastic bags.
Learn more about locality here
https://brainly.com/question/32102156
#SPJ1
Here is a single-strand of DNA:
3’ – ACCTAGGACAAAGGTTTCACGCG – 5’
either above or below this strand, write the complementary strand of DNA. Include which end is the 5’ end and which is the 3’ end.
if the original strand is the template for the leading strand, draw an arrow indicating which direction DNA synthesis will proceed
If the original strand is the template strand of a gene being transcribed, draw and arrow indicating which direction RNA synthesis will proceed
Write the sequence of the RNA molecule that would be transcribed from the original strand of DNA. Label the 5’ and 3’ ends
The complementary DNA strand of the given single-stranded DNA is as follows:5' - 3'The 5' end of the DNA strand has the phosphate group attached to it, whereas the 3' end has a hydroxyl group attached to it.
Therefore, in the given DNA strand, the 3' end is on the right-hand side and the 5' end is on the left-hand side.If the original strand is a template for the leading strand, DNA synthesis will proceed in the 3' to 5' direction. The arrow will point from left to right.If the original strand is a template strand of a gene being transcribed, RNA synthesis will proceed in the 5' to 3' direction. The arrow will point from right to left.
The sequence of the RNA molecule that would be transcribed from the original strand of DNA is:5' - 3'The 5' end of the RNA strand has the phosphate group attached to it, whereas the 3' end has a hydroxyl group attached to it. Therefore, in the given RNA strand, the 3' end is on the right-hand side and the 5' end is on the left-hand side.\
To know more about phosphate group visit :
https://brainly.com/question/911397
#SPJ11
A chemist reacted 12.0 liters of F2 gas with NaCl in the laboratory to form Cl2 gas and NaF. Use the ideal gas law equation to determine the mass of NaCl that reacted with F2 at 280. K and 1.50 atm.
Answer:
The mass of NaCl needed for the reaction is 91.61 g
We'll begin by calculating the number of mole of F₂ that reacted.
Volume (V) = 12 L
Temperature (T) = 280 K
Pressure (P) = 1.5 atm
Gas constant (R) = 0.0821 atm.L/Kmol
Number of mole (n) =?
PV = nRT
1.5 × 12 = n × 0.0821 × 280
18 = n × 22.988
Divide both side by 22.988
n = 18 / 22.988
n = 0.783 mole
Next, we shall determine the mole of NaCl needed for the reaction.
F₂ + 2NaCl —> Cl₂ + 2NaF
From the balanced equation above,
1 mole of F₂ reacted with 2 moles of NaCl.
Therefore,
0.783 mole F₂ will react with = 0.783 × 2 = 1.566 moles of NaCl.
Finally, we shall determine the mass of 1.566 moles of NaCl.
Mole = 1.566 moles
Molar mass of NaCl = 23 + 35.5 = 58.5 g/mol
Mass of NaCl =?
Mass = mole × molar mass
Mass of NaCl = 1.566 × 58.5
Mass of NaCl = 91.61 g
Therefore, the mass of NaCl needed for the reaction is 91.61 g
Explanation:
does a mixture of water (1) and 1-butanol (2) form a miscibility gap at 928c? if it does, what is the range of compositions over which this miscibility gap exists? note: you know that the van laar parameters for this system are as follows: l12
Yes, a miscibility gap exists for a mixture of water and 1-butanol at 928C. The range of compositions over which this gap exists is between the eutectic point and the upper cloud point.
The eutectic point is the composition where the two components form two liquid phases, and the upper cloud point is the composition where the two components form a single liquid phase.
The van Laar parameters for this system (L12) indicate the degree to which changes in temperature, pressure, and composition affect the relative solubility of the two components.
For a mixture of 1-butanol and water at 928C, the relative solubility of the two components decreases as the composition deviates from the eutectic point, resulting in a miscibility gap. The range of compositions over which this gap exists is determined by the van Laar parameters.
Know more about eutectic point here
https://brainly.com/question/31382998#
#SPJ11
What do you call an animal with multiple organs ?
Answer: Hermaphrodite
hope this is helpful
What is the difference between bulk and particle scale?
Someone please help!!
Answer:
Particle density is the volumetric mass of the solid soil. It differs from bulk density because the volume used does not include pore spaces. Particle density represents the average density of all the minerals composing the soil.
Hope that helps
In an ionic compound, the size of the ions affects the internuclear distance (the distance between the centers of adjacent ions), which affects lattice energy (a measure of the attractive force holding those ions together).
Based on ion sizes, rank these compounds of their expected lattice energy.
Note: Many sources define lattice energies as negative values. Rank by magnitude and ignore the sign.
Lattice energy = absolute value of the lattice energy.
Greatest |lattice energy| (strongest bond)
least |lattice energy| (strongest bond)
MgBr_2, MgF_2, MgCl_2, MgI_2
The compounds ranked by their expected lattice energy from greatest to least are: MgF_2, MgCl_2, MgBr_2, MgI_2.
Lattice energy is a measure of the energy released when gaseous ions come together to form an ionic solid. It is influenced by factors such as ion charge and ion size. In general, as the charges of the ions increase, the lattice energy also increases. However, when comparing ions with the same charge, the size of the ions becomes the determining factor.
In the given compounds, the common ion is Mg_2+ (with a +2 charge), while the anions are F-, Cl-, Br-, and I-. Among these anions, fluoride (F-) has the smallest ionic radius, followed by chloride (Cl-), bromide (Br-), and iodide (I-). Smaller ions have a higher charge density, meaning the positive charge is concentrated in a smaller space, leading to stronger attractive forces between the ions.
Therefore, based on ion size, the compound with the greatest expected lattice energy is MgF_2, followed by MgCl_2, MgBr_2, and MgI_2, with MgF_2 having the strongest bond and MgI_2 having the weakest bond.
Learn more about lattice energy from the given link:
https://brainly.com/question/29735933
#SPJ11