Why
do we use a log phase culture of Tetrahymena instead of a
stationary phase culture? What effect do you think growth phase may
have on feeding rate?

Answers

Answer 1

A log phase culture of Tetrahymena is preferred over a stationary phase culture because it represents a period of active growth and replication. During the log phase, the cells are dividing rapidly and reaching their maximum growth rate.

They are metabolically active, synthesizing proteins, and actively feeding on available nutrients. Using a log phase culture ensures that the cells are in their most physiologically active state, providing reliable and consistent results in experiments. The growth phase of Tetrahymena can indeed affect the feeding rate. In the log phase, the cells have high energy demands due to their active growth and replication, resulting in a higher feeding rate. Conversely, in the stationary phase, the cells have reached a stable population density, and their metabolic activity slows down, leading to a decreased feeding rate as they conserve energy.

Learn more about Tetrahymena

https://brainly.com/question/30625637

#SPJ11


Related Questions

Question 3 of 26
Which sentence describes both computer models and mathematical models?
O A. They are able to produce exact copies of real-life objects and
systems.
B. They use mental images to compare a process to a conceptual
idea so that it is easier to visualize.
C. They are useful for representing the physical shape or function of
an object.
D. They can involve looking for patterns and relationships in
numerical data.

Answers

Computer and mathematical models are both described in option D. they can entail searching for patterns and connections in numerical data.

To represent and simulate real-world systems and objects, mathematical and computer models both use numerical data. To produce predictions and offer insights into the behavior of the systems they represent, they rely on the analysis of data patterns and linkages.

Mathematical models employ equations and formulas to describe the relationships between variables, in contrast to computer models, which use software to generate virtual representations of objects and systems. To mimic and forecast real-world phenomena, both kinds of models, however, rely on data and mathematical analysis.

To know more about mathematical model, refer:

https://brainly.com/question/24731503

#SPJ1

Select the likely effects of a mutation in the sequence (5')AAUAAA in a eukaryotic mRNA transcript. a. inhibition of 5' capping by 7-methylguanosine b. inhibition of posttranscriptional cleavage c. blockage of posttranscriptional polyadenylation d. blockage of RNA self-splicing in group I introns

Answers

A mutation in the sequence (5')AAUAAA in a eukaryotic mRNA transcript is likely to cause blockage of posttranscriptional polyadenylation.

This sequence is the recognition site for the poly(A) signal, which is necessary for the addition of a poly(A) tail to the 3' end of the mRNA. If this recognition site is mutated, the poly(A) signal will not be recognized, and the mRNA will not be polyadenylated.

A mutation in the sequence (5')AAUAAA in a eukaryotic mRNA transcript is likely to cause blockage of posttranscriptional polyadenylation, as this sequence is the recognition site for the poly(A) signal.

A mutation in this sequence can have significant effects on mRNA processing and stability, as the poly(A) tail plays important roles in mRNA transport, translation, and degradation.

To know more about polyadenylation visit

https://brainly.com/question/31603978

#SPJ11

A housefly is
is an
arthopoda why​

Answers

Answer:

Arthropods as Carriers of Pathogens

Many arthropods can contaminate or spoil food. Insects such as houseflies or cockroaches may regurgitate pathogen-contaminated fluids prior to or during feeding. They may also defecate, contaminating the food with potential pathogens.

Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as:

Answers

Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as homeostatic mechanisms.

Homeostasis is the body's ability to maintain a stable internal environment despite external changes.

In the context of the brain, homeostatic mechanisms involve various processes that regulate physiological functions and maintain optimal levels of essential substances.

These mechanisms can include feedback loops that detect imbalances and initiate corrective actions.

For example, if there is a deficiency in a particular nutrient or hormone, the brain may activate mechanisms to increase its production, decrease its consumption, or enhance its absorption from the environment.

Homeostatic mechanisms play a crucial role in ensuring the body's overall stability and functioning, helping to maintain proper levels of various substances and promoting overall well-being.

To know more about Homeostasis, refer here:

https://brainly.com/question/15647743#

#SPJ11

What must be the genotype of a couple that has a 100% chance of producing offspring that areheterozygous for the PTC taster gene?

What must be the genotype of a couple that has a 100% chance of producing offspring that areheterozygous

Answers

A taster gene is a dominant trait. The probable gene of the parents that is more likely to produce 100% heterozygous offspring are:

Parent 1- TT (homozygous taster)

Parent 2- Tt (heterozygous taster)

When these genotypes TT X Tt are crossed the results are:

TT, TT, Tt, Tt

TT- 50% homozygous taster of PTC

Tt- 50% heterozygous taster of PTC

Michelle and George are studying the forces and motion of a 0.8-kg low friction cart on a horizontal table. They use a spring scale to exert different amounts of horizontal pulling force on the cart, and they measure the acceleration of the cart for each pulling force. The measurements of each set of pulling force and acceleration are displayed in the table to the right. If friction is much weaker than the pulling force, which of the following is the best fit for the missing pulling force in the table?

Answers

Based on the given information, the best fit for the missing pulling force in the table is 1.0 N (Option B).

To determine the best fit for the missing pulling force, we need to analyze the relationship between the pulling force and the acceleration.

From the given table, we can observe that as the pulling force increases, the acceleration of the cart also increases. This suggests a direct proportionality between the pulling force and the acceleration.

When we look at the values in the table, we can see that for each increase of 0.2 N in the pulling force, the acceleration increases by 0.5 m/s^2. This indicates a constant ratio of 0.5 m/s^2 per 0.2 N.

To find the missing pulling force, we can use this constant ratio. Starting from the last known pulling force and acceleration values (0.6 N, 1.5 m/s^2), we can add the constant ratio of 0.5 m/s^2 per 0.2 N to determine the next acceleration:

1.5 m/s^2 + 0.5 m/s^2 = 2.0 m/s^2

Therefore, the missing pulling force that corresponds to an acceleration of 2.0 m/s^2 is 0.8 N.

Among the given options, the closest fit to 0.8 N is 1.0 N (Option B).

For more such questions on force, click on:

https://brainly.com/question/25239010

#SPJ8

The probable question may be:

Michelle and George are studying the forces and motion of a 0.8-kg low friction cart on a horizontal table. They use a spring scale to exert different amounts of horizontal pulling force on the cart, and they measure the acceleration of the cart for each pulling force. The measurements of each set of pulling force and acceleration are displayed in the table to the right. If friction is much weaker than the pulling force, which of the following is the best fit for the missing pulling force in the table?

Pulling Force (N) | Acceleration (m/s^2)

0.2 | 0.5

0.4 | 1.0

0.6 | 1.5

0.8 | ?

A. 1.5 N

B. 1.0 N

C. 0.2 N

D. 0.4 N

Help meee pretty please

Answers

Answer:

what you need help with

Explanation:

The Cell Theory Summary

-All living things are composed of cells.

-Cells are the basic units of structure and function in living things. -All cells come from pre-existing cells.

Directions: Read and answer what is being asked. Write your answer on a separate sheet of paper.

A. Arrange the events in chronological order as I, II, III, IV and V with I as the oldest and

V as the latest event.

1. Tiny chambers that look like empty compartments were called cells.

2. A scientist concluded that cells come from pre-existing cells.

3. Microorganisms like bacteria and protozoa were seen under a microscope. 4. Schwann studied the animal cells.

5. A German scientist studied plant cells.​

Answers

Answer:

5, 2, 3, 1, 4

Explanation:

HURRY PLEASE I RLLY NEED THIS FOR THE MOST IMPORTANT TEST IM TAKING THIS YEAR. The diagram shows a toy car on a number line.

A line with arrowheads at both ends has ticks marks every 2 units. The tick marks for 0, 6, and 10 are labeled. A car sits above the tick mark for 2 with a dashed red line leading to the tick mark.
What is the position of the car?

–4
1
2
4

HURRY PLEASE I RLLY NEED THIS FOR THE MOST IMPORTANT TEST IM TAKING THIS YEAR. The diagram shows a toy

Answers

Answer:

The position of the car is +2 or simply 2

Explanation:

The position of an object is usually given from a reference position.

A number line is used to specify the position of the car in the given question.

A number line has numbers arranged on a straight line with positive and negative numbers found on both sides of zero serving at the center of the number line. Positive numbers are found to the right of zero on the number line while negative numbers are found to the left of zero onnthe number line.

In the given question, the number line has ticks marks every 2 units.

The car sits above the tick mark for 2 with a dashed red line leading to the tick mark.

Since the car is found to the right of zero on the number and sits above the tick mark for 2, the position of the car is +2 or simply 2

compare the differences in amino acid sequences among the mammals

Answers

The amino acid sequence among mammals varies, which may affect protein functions. The differences in the amino acid sequence are responsible for creating variations in the proteins' shape, which, in turn, affects their functionality.

The amino acid sequence among mammals varies, which may affect protein functions. Amino acid sequence is a very important factor in the study of protein structures, function, and evolution. Proteins' amino acid sequence is responsible for creating variations in their shape, which, in turn, affects their functionality. The differences in the amino acid sequence are responsible for creating variations in the proteins' shape, which, in turn, affects their functionality.Different mammalian species have unique amino acid sequences and can be distinguished by these differences. For example, a human protein's amino acid sequence might be compared to a mouse protein's amino acid sequence to determine the variations between the two. The differences in amino acid sequences among mammals provide insight into the evolutionary relationships between species and the mechanisms by which they adapt to their environment.

Know more about amino acid, here:

https://brainly.com/question/31872499

#SPJ11

which of the following is a correct list of structures found both plant and animal cells​

Answers

Are there suppose to be choices to pick?

Answer:

Answer:

Cell Membrane

Cytoplasm

vacuole

Nucleus

Mitochondria

etc.

There are also other things that they have in common but those are the main ones.

 

 

think of something that would make your life easier, anything from an automatic toothpaste dispenser to an awning that opens up when it senses rain, and imagine how you could actually create it. do you agree with massimo that the arduino makes microcontrollers and coding available to anyone, regardless of experience?

Answers

Yes, I agree with Massimo that Arduino makes microcontrollers and coding available to anyone, regardless of experience. Arduino is an open-source electronics platform that provides a user-friendly environment for creating and programming interactive projects.

It simplifies the process of hardware prototyping and allows individuals with little to no prior experience in electronics or programming to dive into the world of microcontrollers.

To create a helpful device like an automatic toothpaste dispenser, Arduino can be a valuable tool.

With Arduino, you can connect sensors, actuators, and other components to build a system that detects the presence of a toothbrush and dispenses an appropriate amount of toothpaste automatically.

Arduino's extensive library of pre-built functions and the availability of countless tutorials and examples online make it easier for beginners to understand and implement such projects.

Arduino's simplicity and versatility have contributed to its popularity among hobbyists, students, and professionals alike. It has democratized access to microcontroller technology and coding by providing an accessible platform that encourages creativity and innovation.

Whether it's creating automated home systems, robotics, or interactive artworks, Arduino opens up possibilities for individuals from diverse backgrounds to turn their ideas into reality.

To know more about "Microcontrollers" refer here:

https://brainly.com/question/31856333#

#SPJ11

where do we find moss plant​

Answers

You can find it in a swamp, or near a swamp. You find it in shady and damp areas.

solve it according to the question please.
the subject is petroleum, so please solve it regardibg
this.
F- Explain the global carbon-climate cycle during the Cretaceous period. (Write only one paragraph describing what happened during the Cretaceous geological period in order to have good source rocks.)

Answers

During the Cretaceous period, high temperatures and abundant vegetation resulted in increased \(CO_2\) levels, leading to the accumulation of organic matter and the formation of good source rocks for oil and gas.

During the Cretaceous period, spanning from approximately 145 to 66 million years ago, the global carbon-climate cycle played a crucial role in the development of favorable conditions for the formation of good source rocks. The period was characterized by high global temperatures and abundant vegetation, resulting in increased carbon dioxide \((CO_2)\) levels in the atmosphere.

The elevated \(CO_2\) levels fueled vigorous photosynthesis, leading to the accumulation of organic matter in marine and terrestrial ecosystems. As this organic matter was buried and subjected to heat and pressure over millions of years, it transformed into oil and gas, creating potential source rocks. The warm climate and prolific vegetation during the Cretaceous, along with the subsequent geological processes, contributed to the formation of the rich hydrocarbon reserves that are vital to our energy resources today.

To learn more about Cretaceous follow the link:

https://brainly.com/question/2093019

#SPJ4

The correct question is:

Explain the global carbon-climate cycle during the Cretaceous period. (Write only one paragraph describing what happened during the Cretaceous geological period in order to have good source rocks.)

Please help and thank you!
This is more Environmental science than biology.

Please help and thank you!This is more Environmental science than biology.

Answers

Answer:

1. B

2. C

3. E

4. A

5. D

Explanation:

1.  The dependent variable is that part of an experiment that is measured when collecting data.

2. Observation involves taking notice of things with your senses.

3. The control of an experiment is the variable that is normal or remained unchanged.

4. A hypothesis is a testable prediction.

5. The independent variable is the variable that is changed.

Describe the role of membrane technologies in water purification

Answers

Hi :)

The role of membrane processes include desalting, disinfection by-product control, disinfection, clarification and removal of synthetic and inorganic chemicals

Hope this helps!

which of the following statements about dna polymerase iii (pol iii) is/are true? i. dna polymerase iii has greater accuracy than rna polymerase ii. pol iii is the primary replicase of e. coli iii. pol iii does not contain 5' to 3' exonuclease activity

Answers

The correct statements are: Pol III is the primary replicase of E. coli and Pol III does not contain 5' to 3' exonuclease activity. Therefore the correct option is option ii and iii

The main replicase enzyme in E. coli, DNA polymerase III (Pol III), is in charge of creating the leading and lagging strands of DNA during replication.

RNA polymerase II is in charge of converting DNA into RNA; it is not involved in DNA replication.

When it comes to accuracy, DNA polymerase III and RNA polymerase II both contain proofreading functions that support the correction of any mistakes that might happen during transcription and replication, respectively.

The statement that DNA polymerase III is more accurate than RNA polymerase II is therefore untrue. Therefore the correct option is option ii and iii

For such more question on exonuclease:

https://brainly.com/question/27068576

#SPJ11

Give some reasons why global warming is harmful

Answers

Answer:

Global warming stresses ecosystems through temperature rises, water shortages, increased fire threats, drought, weed and pest invasions, intense storm damage and salt invasion, just to name a few.

Explanation:

Because you did it!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Because you did it!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

What are common sedimentary rocks
?

Answers

Answer:

Common sedimentary rocks include sandstone, limestone, and shale

Explanation:

Answer:

Sandstone, Shale, siltstone, chert,

Explanation:

Those are common sedimentary rocks

10. A white flowered plant is crossed with a plant that is heterozygous for the trait.
What percentage of the offspring will have purple flowers?​

Answers

Answer:

0%

Explanation:

The homzyg. flowered gametes are: WW

The heterozygous plant gametes are : Ww

The 'w' allele is for purple and its recessive. The 'W' allele is for white and is dominant. The Punnett square:

      |  W   |  w   |

W  | WW | Ww |

W  | WW | Ww |

Half of them are heterozygous white and half are homzygous white. But there is no 'ww', so its 0%.

If a white-flowered plant is crossed with a plant that is heterozygous for the trait. The percentage of the offspring will have purple flowers is 75%.

What is a heterozygous individual?

A heterozygous individual is one who contains two different alleles for the traits.

The recessive allele is white p

The dominant allele is purple. P

When the crossing is done between them, 75% of the population will be purple, as shown in the diagram, and 25% of the population will be white.

Thus, the percentage of the offspring that will have purple flowers will be 75%.

Learn more about heterozygous individual

https://brainly.com/question/13050360

#SPJ2

10. A white flowered plant is crossed with a plant that is heterozygous for the trait.What percentage

Solid tumors are clusters of cancer cells and often contain blood vessels. When molecule B binds to the wild-type Brec protein in the plasma membrane of certain solid tumor cancer cells (Figure 1), the cancer cells express the membrane protein A and sometimes stimulate increased growth of blood vessels into the tumors.

Cells with a particular mutation in the Brec gene (Brec-MUT cells) have much increased expression levels of A and stimulate greater growth of blood vessels than do cancer cells with the wild-type Brec (Brec-WT cells); the cells with the mutant Brec can trigger intracellular signaling in the absence of B.

Researchers proposed that the signaling pathway modeled in Figure 1 is triggered by activation of the wild-type Brec and is associated with phosphorylation and activation of kinase D, expression of A, and the ability of the cancer cells to stimulate blood vessel growth.
Part A: Based on the signaling model shown in Figure 1, describe the role of molecule C-P in the activation of D.
Part B: Explain how a molecule such as kinase D can amplify an extracellular signal. Explain how the mutant Brec protein is able to activate kinase D even in the absence of its ligand.
Part C: Based on the proposed signaling pathway, predict the relative activity of kinase D in the Brec-WT cells compared with kinase D in the Brec-MUT cells when both cell types are grown in nutrient broth lacking B. Justify your prediction.
Part D: The researchers claim that treatment with a compound that inhibits dephosphorylation of the intracellular domain of the Brec protein will inhibit expression of A in Brec-WT cells but not in Brec-MUT cells. Based on the information provided, provide reasoning to refute their claim.

Solid tumors are clusters of cancer cells and often contain blood vessels. When molecule B binds to the

Answers

The molecule C-P phosphorylates and thus activates D, whereas Kinase D amplifies cellular signaling by phosphorylating many substrates. In this case, it is expected to observe kinase D overexpression in Brec-MUT cells.

Cancer, phosphorylation and signaling pathways

Cancer can be defined as a multifactorial disease, which is often associated with uncontrolled cell growth.

Cancer signaling may be associated with defective pathways such as, for example, a mutated kinase protein that affects normal downstream molecular cascades.

A kinase is a specific protein that acts to phosphorylate specific cellular substrates, thereby activating/deactivating a particular signaling pathway.

Learn more about cancer pathways here:

https://brainly.com/question/16103657

Your eldest sister instructed you to pack her clothes because she is going to an urgent
out of country seminar and she is running out of time in doing this. What are you going
to do?

Answers

I will follow my eldest sister's instruction and pack her clothes as quickly and efficiently as possible.

I will start by gathering all of the necessary clothing items that she will need for the seminar, including any formal or business attire, as well as any casual clothes for downtime. I will also make sure to pack any necessary toiletries and accessories. I will then fold the clothes neatly and pack them into her suitcase, making sure to maximize the space and avoid any wrinkles or damage to the clothes. Once everything is packed, I will double check to make sure that I have not forgotten anything and that everything is secure before closing the suitcase and giving it to my sister.

Learn more about Clothing:

https://brainly.com/question/24799048

#SPJ11

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome, x = X affected by hemophilia, and Y = Y chromosome. If an Xx female and XY male have children, what fraction of their offspring will have an affected chromosome, and what fraction is likely to be affected by the hemophilia? (1 point) A. 1/4 and 1/2 B. 1/2 and 1/4 C. 1/2 and 1/3 D. 1/4 and 1/4 Ive been stuck on this for a while now, can someone please assist?

Answers

Answer:

B. 1/2 and 1/4

Explanation:

Hemophilia is a disease inherited in humans. It is only carried on the X chromosome, hence, it is said to be X-linked. In this question;

X - unaffected X chromosome

x = X chromosome affected by hemophilia,

Y = Y chromosome

Hence, in a cross between a Xx female (carrier) and a XY male (unaffected), the following chromosomes will be present in the gametes produced by each parent:

Xx- X and x gametes

XY- X and Y gametes

Using these gametes in a punnet square (see attached image), offsprings with genotypes: XX, Xx, XY and xY are produced.

XX (1) - unaffected normal female

Xx (1) - unaffected carrier female

XY (1) - unaffected normal male

xY (1) - affected male

Based on the questions;

- 2 out of the possible 4 children have the affected chromosomes i.e. both xY son and Xx daughter have the x chromosome. Hence, the fraction is 1/2

- 1 out of the 4 possible children is affected by hemophilia, which is the xY son. Hence, the fraction is 1/4.

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome,

Answer:

1/2 and 1/4

Explanation:

Took the test

Which part(s) of your eye change light to electrical impulses?

Answers

Answer:

Light passes through the front of the eye (cornea) to the lens. The cornea and the lens help to focus the light rays onto the back of the eye (retina). The cells in the retina absorb and convert the light to electrochemical impulses which are transferred along the optic nerve and then to the brain.

Explanation:

An amazing membrane full of photoreceptors (a.k.a. the "rods and cones"), the retina converts the light rays into electrical impulses. These then travel through the optic nerve at the back of the eye to the brain, where an image is finally perceived. Light passes through the front of the eye (cornea) to the lens. The cornea and the lens help to focus the light rays onto the back of the eye (retina). The cells in the retina absorb and convert the light to electrochemical impulses which are transferred along the optic nerve and then to the brain. (I hope this helps)

addison disease
1. what are the symptoms
2. who can it affect the most
3. what other issuses it can cause
4. what medication or changes in diet or lifstyle can help with symptoms relief
HELP ME PLEASE!

Answers

Answer: Addison disease is an adrenal insufficiency. This occurs because of the fact that adrenal gland produces very low quantity of hormones like cortisol, and aldosterone.

Explanation:

1. The symptoms of addison disease are loss of appetite, increased thirst, low mood, and muscle fatigue.

2. The addison disease is an autoimmune reaction, which can affect people of all age groups.

3. It can cause other diseases like tuberculosis.

4. The hormone replacement therapy is ideal for the treatment for addison disease. The use of oral corticosteroids is ideal. The diet containing balanced proteins, carbohydrates, fats, increased intake of vegetables including vitamins, and minerals are necessary for treatment of addison disease.

Are feathers a structural adaptation?

Answers

Answer:

Yes

Explanation:

Will the sequences 5′GGCC–3′ and 3′–GGCC–5′ in a double-stranded DNA molecule be cut by the same restriction enzyme?

Answers

Adenine and thymine form bonds; guanine and cytosine form bonds. 3'TGACGACTACAACTTAATCT 5' (That is true.)

What do you meant by double-stranded DNA molecule?Two polynucleotide chains, each of which has a nitrogenous base bonded to a hydrogen atom by a hydrogen bond, make up double-stranded DNA. Because of the anti-parallel sugar-phosphate backbone orientation and the complementary nature of the A-T and C-G base pairing, one strand in this arrangement replicates the other. Non-covalent (hydrogen) bonds typically hold the two strands of DNA together in DNA molecules. In a helical pattern, the strands are entangled. Nucleotide sequences are what make up DNA. A deoxyribose sugar, a phosphate group, and one of the four nucleobases (A, T, G, or C) make up each nucleotide. The DNA's double-stranded structure provided evidence of a replicating process. Unnoticed was the fact that it also acted as a template for fixing replication-related damage and errors, helping to maintain genomic stability.

To learn more about double-stranded DNA molecule refer to:

https://brainly.com/question/29808616

#SPJ4

Did Yong Mi make the right decision? Why or why not?
Yong Mi is enjoying her time at the beach. All of a
sudden, she notices that the water along the shore is
receding quickly. She goes back to her room on the first
floor of her hotel to be safe from the natural hazard that
she suspects is coming
O Yes, she made the right decision because she will
be safe on the first floor when the rip current occurs.
O No, she did not make the right decision because she
needs to go to higher ground to be safe when the rip
current occurs
Yes, she made the right decision because she will
be safe on the first floor when the tsunami comes.
O No, she did not make the right decision because she
needs to go to higher ground to be safe when the
tsunami comes

Answers

Answer:

D) No, she did not make the right decision because she needs to go to higher ground to be safe when the tsunami comes

Explanation:

Took the test and it says its right

Answer:

Its d

Explanation:

mention the types of nucleic acid​

Answers

Answer:

the two main types of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA is the genetic material found in all living organisms and is found in the nucleus of eukaryotes and in the chloroplasts and mitochondria.

Explanation:

Is evaporation of water a physical or chemical change? explain your answer *EXTRA POINTS*

Answers

Answer:

physical

Explanation:

the water isn't changing substance but it's changing its form

Other Questions
Under the Articles of Confederation, the federal government was given the power to? A) impose taxes. B) enforce laws. C) declare war. D) regulate trade. ASAP Courtney Company uses a periodic inventory system. The following data were available: beginning inventory, 1,600 units at $30; purchases, 3,400 units at $35; operating expenses (excluding income taxes), $94,500; ending inventory per physical count at December 31, 1,050 units; sales price per unit, $80; and average income tax rate, 30%. 1700/49 + 1700/49 + 1700/49 + 1700/49 + 1700/49 + 33/5 Disease: Crimean Congo haemorrhagic feverMutation 1: Cathepsin SMutation2: proteosomeIdentify the type of organism and its site of replicationDescribe disease and symptomsDescribe complete steps of antigen processing for extracellular or intracellular organism (depends on pathogen)Describe the normal function of non-mutated gene on antigen processingPredict the effect the mutated gene would have on antigen processing A 913 kg car travels around a curve with a radius of 268 meters at a constant speed of 11 m/s. Calculate the cars acceleration analysts should not worry about the users' perceptions of the new system during acceptance testing. true or false? Suppose 1-year T-bills currently yield 7.00% and the future inflation rate is expected to be constant at 2.00% per year. What is the real risk-free rate of return, r* digital media such as blogs allow marketers to interact with prospective customers in what? Jordan opened a savings account with $320 and deposits $25 into his saving account weekly.How much would Jordan have after 36 weeks? can someone help please? Identify the overall theme of the film Requiem for a Dream (2000) and explain how do technical film techniques and shots like extreme closeups of characters, scenes done in fast-motion, and even split-screens employed by Aronofsky in his film contribute to the audience realizing this overall theme of the film. Provide sequences from the movie that will help you clarify your ideas. Explain your answer in a paragraph form/essay form Read the excerpt of the following poem."A Dialogue between Old England and New" By Anne BradstreetNew England.Alas, dear Mother, fairest Queen and best,With honour, wealth, and peace happy and blest,What ails thee hang thy head, and cross thine arms,And sit i' the dust to sigh these sad alarms?What deluge of new woes thus over-whelmThe glories of thy ever famous Realm?What means this wailing tone, this mournful guise?Ah, tell thy Daughter; she may sympathize.Old England.Art ignorant indeed of these my woes,Or must my forced tongue these griefs disclose,And must my self dissect my tatter'd state,Which Amazed Christendom stands wondering at?And thou a child, a Limb, and dost not feelMy weak'ned fainting body now to reel?This physic-purging-potion I have takenWill bring Consumption or an Ague quaking,Unless some Cordial thou fetch from high,Which present help may ease my malady.If I decease, dost think thou shalt survive?Or by my wasting state dost think to thrive?Then weigh our case, if 't be not justly sad.Let me lament alone, while thou art glad.Why would Bradstreet refer to England as "ever famous" in the following lines?The glories of thy ever famous Realm? England is older than America, so it was more famous. England had a monarchy, which made it unique at that time. England was known throughout the world because of its many celebrities. England was known throughout the world because it had so many territories. hii , how many perfect squares are there under 1000 , PLS HELP WILL MARK BRAINLIEST! what is the definition of virtue? What is an adverb? ANSWER QUICK You spend $40 on 5 pounds of concrete. How much is 1 pound? Are all integers whole numbers? A scientist has 15 barrels of gasoline with 8% ethanol content. how much pure ethanol (100% ethanol) needs to be added to the 15 barrels to create a gasoline mixture with 10% ethanol content? the correct amount of pure ethanol to be added is barrel(s). square root of 90 to the nearest integer