1. Trachea
2. Bronchi
3. Alveolar sacs
4. Capillaries
Hope this helps! :)
the macronutrient which supplies glucose, that cells use as the major energy source to fuel your body is
The macronutrient that supplies glucose, the major energy source used by cells to fuel the body, is carbohydrates.
Carbohydrates play a vital role in providing energy to the body. When consumed, carbohydrates are broken down into glucose during digestion. Glucose is a simple sugar that serves as the primary source of fuel for cells, including brain cells, muscles, and other tissues.
Once glucose is absorbed into the bloodstream, it is transported to cells throughout the body. Inside the cells, glucose undergoes a series of metabolic reactions, particularly in the mitochondria, to produce adenosine triphosphate (ATP), which is the energy currency of cells. ATP fuels various cellular processes, such as muscle contractions, nerve impulses, and the synthesis of molecules needed for cellular functions.
Carbohydrates can be obtained from various food sources, including grains, fruits, vegetables, and dairy products. It is important to consume an adequate amount of carbohydrates in the diet to provide the necessary glucose for energy production and overall bodily functions.
Learn more about macronutrient here
https://brainly.com/question/31914450
#SPJ11
2. What portion of the DNA is also known as a gene?
A. The coding sections
B. The noncoding sections
C. The mRNA strand
D. The polypeptide sequence
Answer:
the coding sections
Explanation:
non coding sections aren't considered as genes.mainly genes are translated into proteins which show our traits and general features
Looking at the chart provided, the students need to develop a classification scheme to distinguish plant and animal cells. The presence of which of the following structures/organelles would be most useful for this purpose?
Answer:
The Cell Wall of plants are more geometrical, than animal cells. Plant cell wall are also stronger.
Plant cell is larger than animal cells
Plant cell have chloroplast while animal cells doesn't
Explanation:
Answer:
cell wall
Explanation:
Plant cells contain a cell wall while animal cells do not have a cell wall. By looking for the presence of a cell wall, students would be able to positively identify a cell as either plant or animal.
in comparison to activating effects, organizing effects of hormones take place:
In comparison to activating effects, the organizing effects of hormones take place in early development.
Hormones have organising impacts early in development, during crucial times, and these effects endure a lifetime on the organs' shape and function, including the brain. Usually irreversible, these consequences influence a person's physical and behavioural characteristics for the rest of their life.
Contrarily, hormones activating effects are brief, transient alterations in behavior or physiological processes that happen later in development. These effects are reliant on the hormone's presence and often vanish when the hormone is absent. Overall, organising effects, which are more long-lasting and deep, have a greater influence on the person than activating effects, which are more transient and reversible.
Read more about hormones on:
https://brainly.com/question/8162998
#SPJ4
mass extinction definition
Answer:
The extinction of a large number of species within a relatively short period of geological time, thought to be due to factors such as a catastrophic global event or widespread environmental change that occurs too rapidly for most species to adapt.
Explanation:
Hope this is helpful.
One reason male peacocks spread their tail feathers is to attract a mate. How does choosing a male with a bright, full tail increase a peahen’s chance of producing healthy peachicks?
Answer:
It means that the peacock is more than likely healthy meaning healthy offspring?
Explanation:
Answer:
Typically, if a peacock has a bright tail with many feathers and eyespots, a female will choose him. These tail features indicate that the peacock may be healthier than other males and, therefore, produce healthier peachicks.
Explanation:
sample response on edge 2020
Is apoptosis a useful mechanism for prokaryotes?
Answer:
yes it is a useful mechanism
Coral reef ecosystems and rain forests are both important in terms of productivity for their areas and across the globe. Without human influence, they can be extremely stable ecosystems. Which statement best describes why these two ecosystems have the ability to be stable and highly productive?
Responses
A They both resist the impacts of habitat loss by humans
B They both have more top predators in their food chains compared to lower predators
C They both have large varieties of plants, animals, and other organisms, which increases biodiversity
D They both have high levels of invasive species, which add to the biodiversity.
Statement C They both have large varieties of plants, animals, and other organisms, which increases biodiversity best describes why these two ecosystems have the ability to be stable and highly productive.
What is a stable and highly productive ecosystem?A stable and highly productive ecosystem is a geographical region that exhibits features capable of increasing the amount of biomass by units of time such as a high amount of solar radiation and water resources in order to perform the process of photosynthesis.
The process of photosynthesis increases the net primary productivity of the ecosystem and therefore it is key to increasing the productivity of an ecosystem.
Therefore, with this data, we can see that a stable and highly productive ecosystem is able to generate much biomass per unit of area and time, thereby this term is associated with the mass of organisms.
Learn more about highly productive ecosystems here:
https://brainly.com/question/18155766
#SPJ1
Answer:
C.) They both have large varieties of plants, animals, and other organisms, which increases biodiversity
Explanation
It's on my test? I got the answer of my review power point.
Complete the following sentence.
A qualified landscape architect will usually hold a college degree, may hold an advanced degree, and will often hold a ________ bestowed by a state board.
Answer:
bachelor's degree : ) it says my answer needs to be longer for some reason so here you go I guess lol
PLEASE HELP ME!!!!!!!!!!!!!!!!!!!!!!!!!
Insert a T after the 4th G in the sequence below and show how the protein is affected
CTG GTC TAC GCG CTA TTT GCC ATA CTC TGG ACT GAC
The insertion of a T after the 4th G in the given DNA sequence results in a frameshift mutation that alters the reading frame and subsequently changes the sequence of amino acids in the resulting protein.
To insert a T after the 4th G in the given DNA sequence, the sequence would become:
CTG GTTC TAC GCG CTA TTT GCC ATA CTC TGG ACT GAC
This change in the DNA sequence would result in a mutation called an insertion. The addition of the T nucleotide alters the reading frame of the sequence, which can have significant consequences for the protein that is encoded by this DNA sequence during translation.
During translation, the DNA sequence is transcribed into mRNA, which is then translated into a protein. Each group of three nucleotides, called a codon, codes for a specific amino acid. However, the insertion of an additional nucleotide shifts the reading frame, causing a frameshift mutation.
As a result of the frameshift mutation, all subsequent codons downstream of the insertion are altered. This means that the entire sequence of amino acids in the resulting protein is changed from the point of the mutation onward. This can lead to a non-functional or completely different protein being produced, affecting its structure and function.This can have significant effects on the structure and function of the protein.
for more such questions on insertion
https://brainly.com/question/14848129
#SPJ11
How many atoms are present in 3H^2O
Answer:
3486784401
Explanation:
3^20 is 3486784401
I'm not 100 percent sure though, I'm sorry
Answer:
there are 6 hydrogen atom and 3 oxygen atoms
present
Which of the following is an appropriate hypothesis to answer the question, why are leaves green?
A: To study the coloring of leaves, scientists grew 250 maple trees within a greenhouse over the course of six months and analyzed the structure of over 1,000 leaves.
B: Leaves are green due to the presence of chlorophyll, a pigmented compound found within the leaves.
C: Based upon the given data, which spans 25 years of research, scientists determined that leaves are green due to the presence of chlorophyll, a pigmented compound found within leaves.
D: Using the work of previous scientists and adding new data to their information, scientists have found that leaves are green due to the presence of chlorophyll, a pigmented compound found within leaves.
PLEASE HELP FAST !!!!!!!!!!!!!!!!!
Answer:D
Explanation:
Answer:
D. Using the work of previous scientists and adding new data to their information, scientists have found that leaves are green due to the presence of chlorophyll, a pigmented compound found within leaves.
Explanation:
A glacier is decreasing its length. This means that its glacial budget is ...
a. positive
b. negative
c. neutral
Answer: b. neutral
Explanation:
Why don’t we have eclipses every month?
Answer:
Because the moon rotates around the Earth and is not in the same position every night
Explanation:
Logistic growth curves are density-dependent.
true or false?
Answer:
true
Explanation:
A curve in which the rate of population growth stays the same, as a result, the population size increases steadily. ... Resources that limit population growth to their quantity, such as food and water. Logistic Model. A population model in which exponential growth is limited by a density-dependent factor.
Answer:
A, true
Explanation:
have a great day and stay happy
!!!!
MULTIPLE CHOICE QUESTION
Ribosomes
is the site of protein synthesis.
is where the genetic material is housed.
is where plants use sunlight to perform
photosynthesis.
10. Which type of infection is usually fatal? a. Latent infection b. Persistent infection c. Acute infection
During an acute viral infection, symptoms are develop rapidly, which can be resolved quiclky by the immune reponse of the host or may lead to their death.
The answer is: C
HELP ASAP SHOW YOUR WORK AND EXPLAIN HOW YOU GOT YOUR ANSWER-NO LINKS OR JOKING AROUND
Compare the structures of viruses and cells.
Answer:
Cells have a double stranded DNA molecule and many strands of single stranded RNA as the copies. Viruses, however, can have double stranded DNA, single stranded DNA, double stranded RNA, or single stranded RNA. They convert RNA to DNA and then back to RNA to make proteins, which does not happen inside cells.
Easy! Please Help! A man is walking through the woods with his dog. Suddenly, a tree limb falls in his path and he leaps out of the way to avoid it. Then the man's dog gets loose, and he ends up chasing it through the woods for a minute or two before he manages to catch it.
a) Describe the function of the respiratory system in this situation.
b) Describe the function of the endocrine system in this situation.
c) Describe the function of the nervous system in this situation.
d) Describe two ways that any of the man's body systems worked together in this situation.
The answers include the following:
The respiratory system gave the cells more oxygen via breathing to perform various activities.The endocrine system released hormones such as adrenaline to activate chemical changes and stay alert.The nervous system carried electrical impulses necessary for the contraction and relaxation of muscles.The bones and muscles worked together to ensure adequate movement.What is Musculoskeletal system?This is the system which comprises of bones, ligaments etc and ensure that the body system has a rigid structure.
It also ensures organisms are able to move from one place to another in search of food and for their survival.
Read more about Musculoskeletal system here https://brainly.com/question/4300043
#SPJ1
which protein complex co-ordinates communication between enhancers and promoters of genes
The protein complex that coordinates communication between enhancers and promoters of genes is called Mediator.
Mediator is a large multiprotein complex that acts as a bridge between transcriptional activators bound to enhancer regions and the RNA polymerase II transcription machinery bound to the promoter regions of genes.
Mediator helps to facilitate the interaction between enhancer-bound transcription factors and the general transcription factors bound to the promoter, thereby promoting efficient transcriptional initiation.
Mediator also plays a role in controlling the rate and timing of transcriptional elongation, and in regulating the activity of RNA polymerase II throughout the transcription cycle.
Dysfunction of Mediator has been implicated in a variety of diseases, including cancer and developmental disorders.
To learn more about mediator, click here:
https://brainly.com/question/29318361
#SPJ11
The Mediator complex coordinates communication between enhancers and promoters of genes.
How does Mediator complex coordinate communication between enhancers and promoters of genes?The protein complex that coordinates communication between enhancers and promoters of genes is called the Mediator complex.
The Mediator complex is a large, multi-subunit protein complex that acts as a bridge between transcription factors bound to enhancer sequences and RNA polymerase II bound to promoter sequences. It helps to recruit RNA polymerase II to the promoter and also facilitates the interaction between the transcription factors and RNA polymerase II, allowing for the efficient transcription of genes.
The Mediator complex is a key regulator of gene expression and plays a critical role in a variety of biological processes, including development, differentiation, and disease. Dysfunction or dysregulation of the Mediator complex has been implicated in a range of human diseases, including cancer, developmental disorders, and metabolic diseas
The Mediator complex is a highly conserved protein complex, meaning that it is present in many different organisms, from yeast to humans. It consists of approximately 30 subunits, which are organized into three main modules: the head, middle, and tail. The head module interacts with RNA polymerase II and helps to recruit it to the promoter, while the middle and tail modules interact with transcription factors bound to enhancers.
The Mediator complex also has a regulatory role in transcription. It can promote or inhibit gene expression depending on the context and the specific subunits involved. For example, certain subunits of the Mediator complex have been shown to promote the expression of genes involved in cell growth and proliferation, while others have been shown to inhibit the expression of genes involved in inflammation.
Mutations or dysregulation of Mediator subunits have been implicated in a number of human diseases. For example, mutations in the MED12 subunit of the Mediator complex have been linked to a variety of developmental disorders, including Opitz-Kaveggia syndrome and Lujan-Fryns syndrome. Dysregulation of the Mediator complex has also been implicated in cancer, as it can promote the expression of genes that drive tumor growth and metastasis.
Overall, the Mediator complex plays a critical role in coordinating the communication between enhancers and promoters of genes, and in regulating gene expression in a variety of biological processes. Its importance in human health and disease underscores the need for further research into its function and regulation.
Identity how the addition of acetyl groups to stones leads to a weaker association of DNA in nucleosomes. a Positively charged histones are able to interact with negatively charged phosphate groups of the DNA backbone. Addition of acetyl groups to histone heads weaken this interaction by reducing the positive charge on histones b Negatively charged histones are able to interact with positively charged phosphate groups of the DNA backbone. Addition of acetyl groups to historietails weakens this interaction by reducing the negative charge on histones c Positively charged histones are able to interact with negatively charged phosphate groups of the DNA backbone. Addition of acetyl groups to histone tails weakens this interaction by reducing the positive charge on histones. d Negatively charged histones are able to interact with positively charged phosphate groups of the DNA backbone. Addition of acetyl groups to histone heads weakens this interaction by reducing the negative charge on histones
The correct answer is: (c) . Positively charged histones are able to interact with negatively charged phosphate groups of the DNA backbone. Addition of acetyl groups to histone tails weakens this interaction by reducing the positive charge on histones.
Histones are proteins that play a crucial role in packaging DNA into a compact and organized structure called chromatin. DNA wraps around histone proteins to form nucleosomes, which are the basic repeating units of chromatin.
Histones have positively charged amino acids, such as lysine and arginine, that interact with the negatively charged phosphate groups of the DNA backbone through electrostatic interactions. This interaction helps in stabilizing the association between histones and DNA.
When acetyl groups are added to the histone tails, this process is known as histone acetylation. Acetylation involves the addition of acetyl groups to specific lysine residues on the histone tails. Acetylation neutralizes the positive charge on the histones, reducing their affinity for DNA.
As a result, the weakened interaction between histones and DNA allows for a more relaxed and open chromatin structure. This increased accessibility of DNA is associated with gene expression because it allows transcription factors and other regulatory proteins to bind to the DNA and initiate gene transcription. In other words, histone acetylation is generally associated with the activation of gene expression.
To Know more about acetyl groups Visit:
https://brainly.com/question/28499717
#SPJ11
The multicellular descendant of the united sperm and ovum that implants on the wall of the uterus is known as the?
The multicellular descendant of the united sperm and ovum that implants on the wall of the uterus is known as the Blastocyst
A normally developing embryo will have six to ten cells three days after fertilization. The fertilized egg is known as a blastocyst — a rapidly dividing ball of cells — by the fifth or sixth day. The embryo will be formed by the inner group of cells. The outer group will develop into the cells that feed and protect it.The blastocyst grows and develops within the womb lining during weeks 4 to 5 of early pregnancy. The outer cells extend their reach to connect with your blood supply. They will eventually form the placenta (afterbirth). The embryo develops from the inner group of cells.
To know more about Blastocyst here
https://brainly.com/question/2013947
#SPJ4
The concept of emergent property definition
Answer:
definition
Explanation:
An emergent property is a property which a collection or complex system has, but which the individual members do not have. In biology, for example, heart is made of heart cells, heart cells on their own don't have the property of pumping blood.
How does elevation effect water?
1. Given the double-stranded stretch of DNA below, determine the base sequence of
messenger RNA strand produced using this gene as the template. *Hint: Only one of the
two strands is used as the template.
5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3'
3' TACGGTAACG AATTCGCCCGTAAT ATĄGGTACT 5
AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGA
How many amino acids will this protein contain?
Answer:
AUG-CCA-UUG-CUU-AAG-CGG-GCA-ULA-UAU-CCA-UGA
so 11
Explanation:
because every 3 bases code for 1 amino acid and to make it easier to count split into 3 so u can count easily.
hope this helps :)
A critical rewiew of the literature is necessary in nearly all research projects. True False QUESTION7 OLioctivity and parsimony ase toet rolated to the rigor of an invesigatoo? Truse False QUESTION B Scientific itwestigatoo is characterized by a good theoretical base and a sound methodological design. These charactetistics are both relsted to the of the invesigation Wist must be filled on the line? Rigor Precision and contidance. Otinectivity Farnemeriv.
1. True 2. True 3. Scientific investigation is characterized by a good theoretical base and a sound methodological design. These characteristics are both related to the Option a. Rigor
True - A critical review of the literature is necessary in nearly all research projects. It helps researchers understand the existing knowledge and gaps in the field, identify relevant theories and methodologies, and build upon previous studies.
True - Objectivity and parsimony are both related to the rigor of an investigation. Objectivity refers to the impartiality and lack of bias in conducting and interpreting the research, while parsimony refers to the principle of simplicity in explaining phenomena or choosing the most straightforward explanation. Both objectivity and parsimony contribute to the rigor of a scientific investigation.
a. Rigor - Scientific investigation is characterized by a good theoretical base and a sound methodological design. These characteristics are both related to the rigor of the investigation. Rigor refers to the thoroughness, precision, and reliability of the research process, including the theoretical underpinnings and the robustness of the methods employed.
To know more about Scientific investigation follow the link:
https://brainly.com/question/12877465
#SPJ4
The correct question is:
1. A critical review of the literature is necessary in nearly all research projects.
True
False
2. Objectivity and parsimony are both related to the rigor of an investigation?
True
False
3. Scientific investigation is characterized by a good theoretical base and a sound methodological design. These characteristics are both related to the of the investigation What must be filled on the line?
a. Rigor
b. Precision and confidence.
c. Objectivity
d. Parsimony..
what is the main role of vitamin k in the body? a. synthesis of reproductive hormones b. calcium utilization c. epithelial tissue renewal d. blood clotting e. antioxidant
The main role of vitamin K in the body is blood clotting.
Vitamin K plays a crucial role in the process of blood clotting or coagulation. When an injury occurs, vitamin K is required to activate certain proteins involved in the coagulation cascade. These proteins, known as clotting factors, help form blood clots to prevent excessive bleeding.
Vitamin K is necessary for the production of several clotting factors, including prothrombin and factors VII, IX, and X. These proteins work together to promote the formation of fibrin, a mesh-like substance that forms a clot and stops bleeding. Without adequate vitamin K, blood clotting is impaired, leading to an increased risk of bleeding disorders and prolonged bleeding.
While vitamin K's primary role is in blood clotting, it also contributes to other important functions in the body. It plays a role in maintaining bone health by regulating calcium utilization and promoting the synthesis of certain proteins involved in bone formation. However, its most well-known and essential function is its involvement in blood clotting mechanisms.
Learn more about vitamin K here:
https://brainly.com/question/31622060
#SPJ11
biodiversity can be an important indicator of what? question 36 options: an unhealthy ecosystem a health well functioning ecosystem too many predators and not enough prey not enough predators
Biodiversity can be an important indicator of a healthy, well-functioning ecosystem.
Biodiversity refers to the variety of life on Earth, including the number and types of species, their genetic diversity, and the ecosystems and ecological processes of which they are a part. Biodiversity is an important measure of the health of an ecosystem.
Biodiversity is important to humans for many reasons, including: Providing food, fuel, and fiber, Maintaining ecosystem services such as soil fertility, pollination, and water purification, Supporting scientific research and education, Cultural and aesthetic values, Enhancing resilience and adaptability to environmental change.
Therefore, biodiversity is an important indicator of a healthy, well-functioning ecosystem.
Know more about biodiversity:
https://brainly.com/question/13073382
#SPJ4
Which of the following are reactants of photosynthesis?
6CO2 + 6H2O + Energy
C6H12O6 + 6O2
CO2 + H2O + Energy
C6H12O6 + O2
Answer:
C6H12O6 + 6O2 are reactants of photosynthesis
Explanation:
think it's the correct answer
pls mark me as the brainlliest
Answer:
6CO2 + 6H2O + EnergyExplanation:
Hope it is helpful!!This type of cell division creates cells with the same number of chromosomes.
O Mitosis
O Meiosis
O Sexual
O Fertilization