{{c1::aneuploidy}} is the deletion or duplication of an entire chromosome

The protein that attaches HIV-1 to the surface of a sensitive cell is gp120.

What is HIV-1? Human immunodeficiency virus (HIV) is a retrovirus that causes acquired immunodeficiency syndrome (AIDS). HIV-1 is a strain of HIV that is responsible for most infections in humans.

When HIV infects immune system cells, it progressively destroys or incapacitates them, resulting in a weakened immune system that cannot fight off other infections and diseases. HIV is transmitted via bodily fluids, typically through unprotected sexual activity, but also via sharing needles or coming into touch with contaminated blood.

To enter the host cell, the virus must first attach itself to the host cell. HIV does this with the assistance of its surface protein, gp120. HIV attaches to the CD4 receptor on human immune cells (primarily T helper cells) using the gp120 protein. After binding to CD4, HIV attaches to a chemokine coreceptor (usually CCR5 or CXCR4).

These receptors allow HIV to enter the cell after binding.

To know more about HIV-1, refer here:

https://brainly.com/question/29602728#

#SPJ11

Since each gram of fat provides over twice as many calories as a gram of protein or carbs, this indicates that the body needs almost double the energy in order to burn each gram of fat and therefore the body needs to workout extra to achieve that.

Fats are the fatty acids that are present stored inside the body of an organism. The fats take more time to burn off and yields around 9 calories when each gram of fat is burned off.

Calories are the energy content present in the food. The higher the calories the higher energy it provides to the body. This energy gets stored in the body in forms of fats.

To know more about fats, here

brainly.com/question/18934340

#SPJ4

Answer:

5. inner membrane

Explanation:

Answer:

1 - rough endoplasmic reticulum

2 - the purple is chromatin and the red is the nucleolus

3 - mitochondria

5 - cytoplasm

11 - lysosomes

12 - ribosomes

Explanation:

I'm not sure about the rest of them and these are for if it is an animal cell. Hope this helps!

The eukaryotic cells contain the lysosomes, chloroplasts, mitochondria, centrioles, cilia, flagella, and the endoplasmic reticulum, and these structures help the cell in a variety of functions such as digestion, photosynthesis, energy production, etc.

Plant and animal cells have endoplasmic reticulum, which aids protein synthesis; mitochondria, which aid in energy synthesis; chloroplasts, which aid in photosynthesis; and some unicellular cells have cilia and flagella, which aid in movement; the centriole can make microtubules.

Hence, the eukaryotic cells contain the lysosomes, chloroplasts, mitochondria, centrioles, cilia, flagella, and the endoplasmic reticulum, and these structures help the cell in a variety of functions such as digestion, photosynthesis, energy production, etc.

Learn more about the function of the organelles here.

https://brainly.com/question/29776469

#SPJ1

The monosaccharides as well as the disaccharides are designated as nutritive sweeteners since they provide calories.

Nutritive sweeteners, which are also sometimes termed as caloric sweeteners supply energy in the form of carbohydrates. A few nutritive sweeteners are naturally present in foods such as fructose, which is found in fresh fruits.

Monosaccharides are the simplest sugars or carbohydrates having the general formula (CH₂O)ₙ and are generally colorless, water soluble, crystalline solids. Glucose, fructose as well as galactose are all examples of monosaccharides.

Disaccharides are made up of two monosaccharides which are linked together by means of a glycosidic bond. They are also soluble in water. The examples of disaccharides are sucrose, lactose as well as maltose.

To learn more about glycosidic bond here

https://brainly.com/question/13265202

#SPJ4

Answer: the answer would be C

Sodium ion do not leave at the beginning of the nerve impulse.

To know more about nerve impulse here

https://brainly.com/question/13126722

#SPJ2

Answer:

B

Explanation:

A measure of the natural populations of algae, plants, fish, and other wildlife provides evidence of the health of a body of water.

Answer is A:

Explanation:

Glycogen and starch are for ENERGY while cellulose and chitin are for STRUCTURE

The types of polysaccharides that we have are as follows:

Therefore, glycogen and starch are for ENERGY while cellulose and chitin are for STRUCTURE

Learn more: https://brainly.com/question/16580858?referrer=searchResults

Answer:

Offspring acquire a mix of traits from their biological parents. Different organisms vary in how they look and function because they have different inherited information. In each kind of organism there is variation in the traits themselves, and different kinds of organisms may have different versions of the trait.

Transcription is the process by which an RNA molecule is produced from one of the DNA strands whereas translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein.

Transcription is the process by which RNA polymerase enzyme reads the DNA sequence and synthesizes an RNA molecule that is complementary to one of the DNA strands.

During transcription, the DNA double helix is unwound, and the RNA polymerase enzyme adds nucleotides to the growing RNA molecule following the base-pairing rules of A-U and G-C. The resulting RNA molecule is called messenger RNA (mRNA), and it carries the genetic information from DNA to the site of protein synthesis.

Translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein. Translation occurs in the ribosome, where transfer RNA (tRNA) molecules with attached amino acids bind to the mRNA codons in a complementary fashion. This process results in the formation of a polypeptide chain that folds into a functional protein.

To demonstrate these processes, let's take the following DNA segment as an example:

DNA sequence: TACAGCGACGCGTATCGAGG

Transcription:

The first step in transcription is to identify the DNA strand that will serve as the template for the RNA synthesis. In this case, we will use the template strand (the complementary strand to the coding strand).

Template DNA strand: ATGTCGCTGCGCATACTCC

The RNA polymerase enzyme will read this template strand and synthesize a complementary RNA molecule by adding nucleotides to the growing chain. The resulting mRNA molecule will have the same sequence as the coding strand (except for U instead of T).

mRNA sequence: AUGUCGCUGCGCAUACUCCG

Translation:

The mRNA sequence can now be translated into a protein sequence using the genetic code, which is a set of rules that determine how the nucleotide sequence of an mRNA molecule is translated into the amino acid sequence of a protein.

AUG-UCG-CUG-CGC-AUA-CUC-CG

Using the genetic code table, we can determine the amino acid sequence of the protein:

AUG: Methionine

UCG: Serine

CUG: Leucine

CGC: Arginine

AUA: Isoleucine

CUC: Leucine

The resulting protein sequence is: Met-Ser-Leu-Arg-Ile-Leu.

Learn more about transcription and translation at: https://brainly.com/question/11214205

#SPJ1

Answer:

C - The RNA codon was transcribed from a DNA strand with the sequence TAA.

Explanation:

transcription describes the process by which a strand of mRNA is coded for by the protein RNA polymerase taking RNA bases and matching them in complimentry with the DNA bases

Answer:

B. It increases the amount of runoff

When a bacterium moves from a warm to a cold environment, an adjustment is performed to create lipids with shorter hydrocarbon tails and more double bonds. In higher temperatures, the membrane should be more saturated and stiff.

In cooler temperatures, you want the membrane to be more fluid, so you shorten and unsaturate the chains.

Prokaryotes are single-celled creatures that belong to the Bacteria and Archaea domains. Prokaryotic cells are significantly smaller than eukaryotic cells, lack a nucleus, and are devoid of organelles. A cell wall surrounds all prokaryotic cells.

Bacteria are classified as unicellular life-forms because they lack a membrane-bound nucleus and other internal components.

Learn more about single bacterial cell

https://brainly.com/question/8883278

#SPJ4

Answer:

360 m

Explanation:

Answer:

fish

Explanation:

moment

As a nations move through the Demographic transition, demographic trends change.

Demographic trend is defined as the popular term for any measurable change in the characteristics of a population over time such as increase or decrease of a particular ethnic group, sex ratio etc.

In this study of the population, in terms of size and density, fertility, mortality, growth, age distribution, migration, and the integration of all these with vital statistics and social and economic conditions.

Thus, as a nations move through the Demographic transition, demographic trends change.

Learn more about Demographic trends, here:

https://brainly.com/question/28967833

#SPJ1

Answer:

Protron

Explanation:

Every proton has a positive charge, every electron has no charge, and every neutron has no charge. There is no such thing as a positron. I hope i help! :)

The correct option is D. A large central vacuole exerts pressure on the walls of the cell.

The vacuole is a membrane-bound organelle found in plant cells only. Vacuole performs various functions such as storage and digestion.

Chlorophyll is an important pigment for photosynthesis. It is located in the chloroplast. It plays a very important role in photosynthesis. The cell membrane helps water and other molecules to pass into the cell. It is called a semipermeable membrane.

Microfilaments provide support to the cell.  The vacuole is present in plants, bacteria, and algae. The main function of the vacuole is to maintain the turgor pressure in the cell. They also help in the storage of various substances.

Therefore,  The correct option is D. A large central vacuole exerts pressure on the walls of the cell.

To learn more about the cell, refer to the link:

https://brainly.com/question/3142913

#SPJ1

Answer:

D. It exerts pressure on the wall of the cell.

Explanation:

Verified!

Answer: Increasing water consumption that decreases the flow of clean water from the

springs that feed the river

Explanation: Because the salamanders have less clean water, pollution becomes more of a problem, also all of the other options would help the salamanders.

The human activity that would most likely decrease the ability of the salamanders to survive is increasing water consumption, which decreases the flow of clean water from the springs that feed the river, which is the last option.

The salamander is only found in a limited area of the San Marcos River, which relies on clean water from the springs, so decreasing the flow of clean water would negatively impact the salamander's survival, as it depends on specific water conditions for survival. As water is withdrawn from the springs to meet human needs, such as agriculture, industry, or household use, less water is available, which can have a detrimental effect on the habitat that the salamander requires because of human needs.

Hence, increasing water consumption decreases the flow of clean water from the springs that feed the river, so the last option is the correct option.

Learn more about the human activities that lead to habitat loss here.

https://brainly.com/question/8493086

#SPJ6

Answer:

The  high specific heat capacity of water.

Explanation:

When there is a need to raise the temperature of a given amount of a substance by a given amount,the amount of heat required is called heat capacity for that substance.Therefore the amount of heat energy required to  raise the  temperature of I g of water by 1 degree is called the specific heat capacity of  water.

This property of water is due to abundant hydrogen bonds in water molecules.These bonds restricts moment of molecule of water,and thus thier diffusion. Thus in order to free these molecules the hydrogen bonds must be heated up to break so that they could gain kinetic energy to escape. This characteristic makes molecules of water to resist wide fluctuations in body temperature.Hence stabilizing the body fluid in living organism

A change in earth temperature is managed by water specific heat capacity because,it takes significant amount of heat for the water to boil,and when there is a need  release heat during cooling this is done slowly with insignificant rise in the earth temperature.,(since 75% of earth is water,)this keeps the earth temperature in a tolerable limits.

Like any cladogram, we have traits that will mark differences among groups and will allow us to solve phylogenies, in this case, each dot is a trait, so if we look at the point where amphibians diverge from the rest of the groups we have four limbs, therefore the correct answer is option 1.

Answer: The answer is "Ribosomes".

Explanation: Ribosomes are responsible for making protein through amino acids. The proteins created are essential to cell and organismal function. Some ribosomes are attached to the endoplasmic reticulum (rough ER), others float freely within the cytoplasm.

Answer:

ribosomes is right

Explanation:

i just did it and passed sooooo

i hope this helps!!!!!!!!!

Answer:

sunlight

Explanation:

plants absorb sunlight > using their chlorophyll to convert it to food

During the S (synthesis) phase of interphase, the cell replicates its DNA. This is a critical stage in the cell cycle as it ensures that each daughter cell receives a complete and accurate copy of the genetic material.

The replication process begins with the unwinding of the DNA double helix, which allows the replication machinery to access the individual strands. The replication machinery, composed of enzymes such as helicases and polymerases, then adds new nucleotides to the exposed strands, creating two identical copies of the DNA molecule. This process is called semi-conservative replication, as each new DNA molecule is composed of one original strand and one newly synthesized strand. The S phase ensures the proper distribution of genetic information to the daughter cells, ensuring the continuation of the cell cycle and the preservation of the genetic material.

Learn more about DNA:

brainly.com/question/264225

#SPJ4

The description of chores in paragraph 3

contributes to the author's explanation of division of labor through option C. It explains how work can get done more quickly when it is divided between many workers.

Division of labor is the practice of breaking down a complex task or job into smaller, more specialized tasks or sub-tasks.

This allows each person or group to focus on a specific part of the job, using their skills and expertise to perform that task more efficiently and effectively than if they were responsible for the entire job themselves.

It is often seen as a key driver of economic growth and productivity.

learn more about Division of labor: https://brainly.com/question/2671091

#SPJ1

Answer:

Your answer is C) Cephalization

Explanation:

Cephalization is the mouth, sense organs, and nerve ganglia that become concentrated at the front end of an animal, producing a head region. And it is also a evolutionary trend spanning over many generations. Hope this helped :)

Answer:

I hope this helps.

Answer:

The option which does not represent a function of the skeletal system is production of body heat.

What are the basic functions of the skeletal system?

Locomotion: The skeletal system helps in the movement of bodies.

Support: The skeletal system provides support to the organism.

Production of erythrocytes: The bone marrow is a part of the skeletal system that produces red blood cells.

The question is not complete. The complete question is

Which of the following is not a function of the skeletal system?

A) Locomotion

B) Production of erythrocytes

C) Storage of minerals

D) production of body heat

Answer:The closer a location is to the equator, the more energy it receives from the sun. Therefore, a location's air temperature is affected by its distance from the equator. The amount of energy from the Sun does not change during El Niño years so there must be some other cause for cooling in New Zealand

Explanation:

Energy from the sun is transferred to Earth’s surface. Some of that energy is then transferred to the air above the surface. The closer a location is to the equator, the more energy it receives from the sun. Therefore, a location’s air temperature is affected by its distance from the equator. The amount of energy from the Sun does not change during El Niño years.

The energy transmits from warmer substances to colder substances. Warmer air transmits energy to cooler currents whereas warmer currents transmit energy to cooler air. In normal years, a warm current passes by New Zealand and warms its air. Something may disturb this current during El Niño years.

Thus, In normal years, a warm current passes by New Zealand and warms its air.

To learn more about the temperature of Christchurch click here:

https://brainly.com/question/16847701

Governments have been involved in the protection of vulnerable species through the Endangered Species Act or ESA which is managed through the program for endangered species.

The initiative aims to facilitate the recovery of species on the Endangered Species List and, via proactive conservation activities, to stop further species from being added to the list.

According to the provisions of the Wild Life (Protection) Act, 1972, Protected Areas, including National Parks, Sanctuaries, Conservation Reserves, and Community Reserves, covering important habitats across the nation, were established to better protect wildlife, including threatened species and their habitat. These species and the ecosystems they depend on are protected by the ESA.

To learn more about  Endangered Species Act visit:

https://brainly.com/question/10415903

#SPJ1

Proteins are able to perform different tasks in the body due to their unique three-dimensional structure, which is determined by the sequence of amino acids in the protein.

The specific arrangement of amino acids allows proteins to interact with each other and with other cellular components in specific ways, allowing them to perform a wide variety of functions. For example, some proteins act as enzymes and catalyze chemical reactions, while others transport molecules across cell membranes or act as structural components of tissues. Additionally, the activity of many proteins can be regulated by the addition or removal of chemical modifications, such as phosphorylation or acetylation, which can alter their structure and activity. The ability of proteins to perform different tasks is crucial for the proper functioning of the body, as they carry out a wide range of essential processes, including metabolism, cell signaling, and gene expression.

Learn more about amino acids here:

https://brainly.com/question/28409615

#SPJ4