Cell having two copies of each type of chromosome is called

Answers

Answer 1

Answer: Diploid means you have two of each type of chromosome.

Explanation:

Diploid is the term that refers to the number of each type of chromosome that an organism has. And diploid specifically means every cell in that organism has two copies of each type of chromosome.


Related Questions

what do you understand by the term reproductionwhat do you understand by the term reproduction

Answers

Answer:

Reproduction is the manufacturing of offspring. There are  primary forms: sexual and asexual reproduction. In sexual reproduction, an organism combines the genetic statistics from each of its mother and father and is genetically unique. In asexual reproduction, one parent copies itself to shape a genetically same offspring.

Explanation:

Make sure to rewrite it in your own words, don't get caught cheating (for those who are.)

Using the following formula ∆N = [B – D] + [I – E], what is the change in the population (∆N) of rabbits if during that year there are 10 rabbits to begin with, 5 births, 2 deaths, 4 individuals migrated into the population and 2 left the area?

A. 8
B. 5
C. 0.5
D. 10

Answers

The change in the population of rabbits for the period would be 5 individuals.

Change in population

The change in the population of an organism over a period of years is the increase or decrease in the population of the organism over the period.

The change in the population of organisms is determined by the general formula:

∆N = [B – D] + [I – E]

Where:

∆N is the change in populationB is the birth rateD is the death rateI is immigrationE is emigration

When the birth rate is greater than the death rate and immigration exceeds emigration, a population will experience growth. When the reverse occurs, a population will suffer population decline.

In this case:

B = 5D = 2I = 4E = 2

Thus:

∆N  = (5-2) + (4-2)

       = 3+2

       = 5

In other words, the population change over the quoted year is 5. Meaning that the population has increased by 5 individuals.

More on population change can be found here: https://brainly.com/question/27991860

#SPJ1

Which of the flowers are found in unexpected places on the DNA cladogram? Figwort, Plantain, and Speedwell If you look at the cladograms side by side it is clear that Figwort is not as closely related to Foxglove or Speedwell.

Answers

The flowers are found in unexpected places on the DNA cladogram is Figwort. If you look at the cladograms side by side it is clear that Figwort is not as closely related to Foxglove or Speedwell.

In the DNA cladogram, it is evident that the Figwort flower is found in an unexpected position. This observation is particularly interesting when comparing Figwort's relationship to Foxglove and Speedwell. Contrary to what one might expect, Figwort is not as closely related to these two flowers as one might initially think. Meanwhile, Plantain and Speedwell flowers are more closely related to each other, revealing an interesting aspect of their genetic relationships.

The cladogram, which is a diagram that showcases evolutionary relationships among different species, provides insights into the genetic makeup and history of various plants. This information helps scientists better understand the diversity and connections between species. So therefore in this case, the unexpected position of Figwort in the cladogram highlights the complexities and surprises found within the genetic relationships of these three flowers, ultimately allowing for a deeper understanding of their evolution and development.

Learn about evolution here:

https://brainly.com/question/31544302

#SPJ11

Index fossils help scientists estimate the age of a rock because index fossil species only existed for a relatively short time. What happened to the species that are now used as index fossils?

Answers

Index fossils are useful for determining the age of a rock because index fossil species only existed for a relatively short time.

Index fossils are specific fossils that are used to identify a particular period's age. Index fossils usually represent organisms that existed for a relatively short period of time but were geographically widespread.

The species that are now used as index fossils became extinct over time. They existed for a short period, maybe a few thousand years to a few million years, and then became extinct due to a variety of factors such as environmental changes, predator-prey relationships, and the emergence of new species that outcompeted them for food and habitat.

Index fossils help scientists estimate the age of rocks. By correlating the fossils from one area to another, geologists can use index fossils to tell the relative ages of the rocks in each area. This is called relative dating. The index fossils tell geologists what period of time the rock was formed by identifying the rock's age in relation to other rock layers with similar index fossils.

For more such answers on Index fossils

https://brainly.com/question/13586565

#SPJ8

A wide, fan shaped deposit sloping down. A geologist took this aerial photo of a location where a river flows out of a mountain range. What feature is pictured here? alluvial fan delta flood plain oxbow lake

Answers

Answer:

alluvial fan

Explanation:

correct on edge 2020

Answer:

Alluvial fan

Explanation:

I just took the assignment on edge!

How are local energy systems in the prairie related to global systems?

Answers

Answer: The energy system is related to the global system by getting an information system by it. The global system is developed and it's the major system that delivers the whole of measurable data worldwide including local energy system which is essentially designed to supply energy services

For molecules in aqueous (i.e. water) solutions, high temperatures typically disrupt hydrogen bonds but not covalent bonds. Based on this information, what happens to DNA when heated? O DNA is degraded to individual nucleotides O Nitrogenous bases are released from each strand of DNA O The DNA strand will become anti-parallel O The two strands of DNA will separate but remain intact O The sugar-phosphate backbone will be degraded Question 46 2.5 pts The uniform width of a DNA molecule is due to O Phosphodiester bonds creating a uniform helical structure O Base pairing between purines O Base pairing between pyrimidines Hydrogen bonding between nitrogenous bases and ribose O Base pairing between pyrimidines and purines Question 47 2.5 pts Which of the following statements best describes DNA replication in prokaryotic (bacteria) and eukaryotic cells? O DNA replication in prokaryotes begins at each end of a linear chromosome O Both prokaryotic and eukaryotic chromosomes have multiple origins of replication O Similar to prokaryotes, eukaryotes replicate their chromosomes one at a time O Prokaryotic chromosomes have a single origin of replication, whereas each eukaryotic chromosome has many O Prokaryotic chromosomes are replicated in two directions until the origin of replication is reached, whereas replication forks on eukaryotic chromosomes proceed until the chromosome ends are reached

Answers

The correct options for each question are:

The two strands of DNA will separate but remain intact.the base pairing between pyrimidines and purines. Prokaryotic chromosomes have a single origin of replication, whereas each eukaryotic chromosome has many.

DNA structure and replication

When DNA is heated, the two strands of DNA will separate but remain intact. This is because high temperatures typically disrupt hydrogen bonds but not covalent bonds. DNA is a double-stranded molecule held together by hydrogen bonds between complementary base pairs. When heated, the energy disrupts the hydrogen bonds between the two strands, causing them to separate. However, the covalent bonds within each strand (i.e. the sugar-phosphate backbone and the bonds between the individual nucleotides) remain intact, allowing the separated strands to come back together when the temperature is lowered.

The uniform width of a DNA molecule is due to the base pairing between pyrimidines and purines. Adenine (A) always pairs with thymine (T), and guanine (G) always pairs with cytosine (C). These base pairs are complementary to each other, and they are held together by hydrogen bonds. The distance between the two nitrogenous bases in a base pair is always the same, which is why DNA molecules have a uniform width.

The statement that best describes DNA replication in prokaryotic and eukaryotic cells is: Prokaryotic chromosomes have a single origin of replication, whereas each eukaryotic chromosome has many.

In prokaryotic cells, DNA replication begins at a single origin of replication. The replication fork then proceeds in both directions, until the entire chromosome has been replicated. In eukaryotic cells, there are multiple origins of replication, and the replication forks proceed in both directions from each origin. This means that eukaryotic chromosomes are replicated much more quickly than prokaryotic chromosomes.

learn more about prokaryotic replication

https://brainly.com/question/28502357

#SPJ11

What is the process by which an organism undergoes a dramatic change in form called?
1. Morphology
2. Metastasis
3. Photosynthesis
4. Metamorphosis

Answers

Metamorphosis through which the insect develops by four distinct stages: egg, larva, pupa, adult. A type of metamorphosis in which an organism's transformation is so dramatic that it is difficult to recognize the relationship between the larva and adult form.

Option 4) Metamorphosis

Answer:

4. Metamorphosis

FILL IN THE BLANKS : Circumferential elastic taping of the lower leg can help alleviate pain of___________.

Answers

Circumferential elastic taping of the lower leg can help alleviate pain of shin splints.

Shin splints most frequently occur after hard activity, sports, or monotonous movement. The muscles, tendons, and the thin layer of tissue that covers the shin bones can become inflamed as a result of this repetitive motion, resulting in pain.

Shin braces frequently disappear once the legs had opportunity and willpower to recuperate, normally in three to about a month. After their legs have healed, most people can resume their exercise routine. Shin splints should be treated early because stress fractures take longer to heal.

Although it is uncommon, it is possible to develop shin splints from walking, especially if you are new to it or have increased your walking speed or distance. You might have to decrease your strolling power or distance for a period until the shin supports improve.

Know more about shin splints, here:

https://brainly.com/question/27960289

#SPJ11

During exercise, sensory receptors detect changes in oxygen and carbon dioxide levels in the blood. This information is then sent to the brain's medulla, which causes the heart to beat faster and increases the rate of breathing. Exercising also causes the nervous system to signal the pancreas and thyroid gland to release hormones which regulate metabolism. Which statement is best demonstrated by this scenario? A. Hormones act as signal molecules between all body systems. B. Exercise is important for the body to function properly. C. Nerves transmit and respond to every major system in the body. D. Increased heart rate and blood flow decrease oxygen supply.

Answers

A. Hormones act as signal molecules between all body systems

Peripheral Chemoreceptors (Carotid + Aortic Bodies) and Central Chemoreceptors in the Medulla Oblongata detect high Carbon Dioxide levels in the blood during exercise. The respiratory centre in the Medulla Oblongata + PONS stimulate the intercostal muscles and the diphragm to contract in order to increase the rate and depth of breathing as to decrease levels of Carbon dioxide in the blood.

The thyroid gland secretes thyroxine which speeds up metabolism (the rate at which cells use glucose)

Answer:

B. Nerves transmit and respond to every major system in the body.

Explanation:

During exercise, sensory receptors detect changes in oxygen and carbon dioxide levels in the blood. This

) a mutation within the gal80 gene that blocks the ability of gal80 protein to interact with gal3p. (d) a deletion of one of the four uasg elements upstream from the gal1 gene. (e) a point mutation in the gal1 core promoter that alters the sequence of the tata box

Answers

The gal80 gene that blocks the ability of gal80 protein to interact with gal3p by the activation of gal80 gene.

In Saccharomyces cerevisiae, galactose turns on the allosteric sign transducer Gal3 protein (Gal3p), which in flip inactivates the repressor Gal80p, thereby activating the Gal4p-established transcriptional activation of GAL genetic switch.

If the GAL80 gene product can not engage with Gal3p, there may be no interplay with the Gal4p/Gal80p complicated and consequently no GAL1 transcription. In the absence of galactose, Gal80 binds to and inhibits the transcriptional activation domain (AD) of the GAL gene activator, Gal4, stopping GAL gene expression. Galactose triggers an affiliation among Gal3 and Gal80, relieving Gal80 inhibition of Gal4.

Read more about protein;

https://brainly.com/question/884935

#SPJ4

Complete the following table comparing and contrasting diploid and haploid cells.
Diploid
Haploid
Description
Homologous chromosome pairs
Designated N
Designated 2N
Has one member of each
homologous chromosome pair
Includes gametes
Includes somatic cells
Heart and liver cells
Sperm and Egg cells

Complete the following table comparing and contrasting diploid and haploid cells.DiploidHaploidDescriptionHomologous

Answers

Answer:

Please find the description and it's pair below:

Homologous chromosome pairs - DIPLOID

Designated N - HAPLOID

Designated 2N - DIPLOID

Has one member of each

homologous chromosome pair - HAPLOID

Includes gametes - HAPLOID

Includes somatic cells - DIPLOID

Heart and liver cells - DIPLOID

Sperm and Egg cells - HAPLOID

Explanation:

1. Diploid organism is an organism with two sets of chromosomes, with each set contributed by each male and female parent. Chromosomes from the male parent is found side by side with chromosomes from the female parent to form HOMOLOGOUS CHROMOSOME PAIR in a diploid organism. Diploidy is denoted by 2N, where N represents number of one set of chromosomes. Diploid cells include somatic or body cells such as heart and liver cells.

2. Haploid organisms are organisms that contain one set of chromosome, formed as a result of meiotic division of diploid cells. Hence, a haploid cell contains one member of each homologous chromosome pair. Haploidy is denoted by N, meaning number of one set of chromosome. Haploid cells include gametes or sex cells such as sperm and egg cells.

What happens to the spores when a sporangium splits open

Answers

Answer:

when the sporangia dry out they break and is released to the air

is coral formed by the abiotic movement of minerals, as in the rock cycle? or is it formed by the biotic cycling of carbon? explain your answer.

Answers

Coral reefs are primarily formed by the biotic cycling of carbon, rather than the abiotic movement of minerals in the rock cycle.

Coral reefs are complex and diverse ecosystems that are formed by the accumulation of calcium carbonate (CaCO3) skeletons secreted by coral polyps, which are tiny marine animals that belong to the phylum Cnidaria. Coral polyps require a source of calcium carbonate to form their skeletons, which they obtain from the surrounding seawater.

In the biotic cycling of carbon, coral polyps use photosynthesis to produce energy and remove carbon dioxide (CO2) from the water, which increases the pH and promotes the formation of calcium carbonate. As more and more polyps secrete their skeletons and die, their accumulated calcium carbonate forms the basis of the coral reef. Over time, as the reef grows and becomes more complex, it provides a habitat for a diverse range of marine organisms..

Learn more about ecosystems here:

https://brainly.com/question/13979184

#SPJ11

A strand of messenger RNA is attached to a ribosome and is directing protein synthesis. The next exposed codon of this messenger RNA has the code GAA. It is most likely to bond with a transfer RNA that has which amino acid?

Answers

Answer:

Glutamic acid or Glutamate

Explanation:

This question is describing the process of TRANSLATION, which is the process by which protein is synthesized from a mRNA template. In the process of translation, a molecule called transfer RNA (tRNA) reads mRNA codons and carries its corresponding amino acid to the growing polypeptide chain.

According to this question, strand of messenger RNA is undergoing translation in the ribosome. However, the next exposed codon of this messenger RNA has the code GAA. A tRNA carrying an amino acid that corresponds to the codon GAA will attach to it. This amino acid is GLUTAMIC ACID.

N.B: codon GAA encodes amino acid GLUTAMIC ACID

A population of grey reef sharks in a coral reef has a maximum per capita growth rate of 1.5 er year. The population size is limited by the carrying capacity of the reef, which is 50 ndividuals.

Which of the following is the growth rate (logistic growth) of the shark population when the population is made of up 30 individuals?

a) 18

b)45

c) 48

d) 75

Answers

The growth rate of the shark population when it consists of 30 individuals is 0.9, which is equivalent to 18 individuals per year. Hence, the correct answer is option a) 18.

Logistic growth is a population growth model that takes into account the carrying capacity of the environment, which is the maximum population size that the environment can sustain. In logistic growth, the growth rate of the population decreases as it approaches the carrying capacity.

To calculate the growth rate of the shark population when it is composed of 30 individuals, we need to determine the proportion of the carrying capacity that the population represents. The proportion is calculated by dividing the current population size (30) by the carrying capacity (50), which gives us 0.6.

Next, we multiply the proportion by the maximum per capita growth rate of 1.5 per year. The calculation is as follows: 0.6 * 1.5 = 0.9.

Learn more about Logistic growth here:

https://brainly.com/question/15631218

#SPJ11

Immature bone cells are derived from stem cells called ________________. These cells differentiate into _______________ that secrete matrix. Then these bone cells get stuck in the chamber called lacunae and are now considered mature bone cells or _____________.

Answers

Immature bone cells are derived from stem cells called osteoprogenitor cells. These cells differentiate into osteoblasts that secrete matrix. Then these bone cells get stuck in the chamber called lacunae and are now considered mature bone cells or osteocytes.

Immature bone cells are derived from stem cells called osteoprogenitor cells. These cells differentiate into osteoblasts that secrete matrix. Then these bone cells get stuck in the chamber called lacunae and are now considered mature bone cells or osteocytes. In the process of bone formation, immature bone cells originate from stem cells known as   osteoprogenitor cells.

These osteoprogenitor cells have the ability to differentiate into osteoblasts, which are responsible for secreting the bone matrix. As the bone matrix is formed, the osteoblasts become surrounded by the matrix and become trapped within small spaces called lacunae.

Once trapped in the lacunae, the osteoblasts mature into mature bone cells known as osteocytes. Osteocytes are fully differentiated cells that play a vital role in maintaining the health and integrity of the bone tissue.

To know more about osteoprogenitor cells follow the link:

https://brainly.com/question/17960906

#SPJ4

which part of human heart carry oxygenated blood........​

Answers

Answer:

Left Atrium

Left Atrium Hope this helps :)

typically, where is the single-pole wall switch that controls a continuous feed food waste disposer located?

Answers

Above the countertop the single-pole wall switch that controls a continuous feed food waste disposer located.

Garbage disposals are fantastic devices that turn food scraps into pulp, making it easy to dispose of food waste in residential kitchens. The best garbage disposal switch options are contrasted here. Special switches are used to turn on garbage disposals. The air switch, wireless switch, wall switch, and toe kick switch are the four most common types of garbage disposal switches. If a garbage disposal is a batch feed model, it can also be wired directly to the mains. The easiest and safest way to turn on a garbage disposal is with an air switch. It is a pneumatic switch, which means there are no electrical wires connecting it to the mains. It is often mounted on the counter just over the sink. The switch is safe to use even when wet because there are no direct electrical connections. Additionally, it has a nice appearance and is simple to use.

To know more about disposer visit:
https://brainly.com/question/10989027
#SPJ4

The bigclaw snapping shrimp shown in (Figure 1) is aptly named--it has one big claw that snaps shut with remarkable speed. The part of the claw that m

Answers

The part of the bigclaw snapping shrimp's claw that moves is called the dactyl. The dactyl is the movable finger-like part of the claw that snaps shut.


The bigclaw snapping shrimp, as shown in Figure 1, has a unique characteristic of having one large claw that snaps shut quickly. This snapping action is made possible by the movement of a specific part of the claw called the dactyl. The dactyl is the finger-like structure that is capable of closing the claw with remarkable speed. When the shrimp wants to capture prey or defend itself, it flexes the muscle associated with the dactyl, causing it to rapidly close the claw. This rapid snapping motion generates a powerful force, enabling the shrimp to stun or immobilize its prey.

In summary, the bigclaw snapping shrimp has a specialized part of its claw called the dactyl, which allows it to snap the claw shut quickly. This snapping action is crucial for capturing prey and self-defense purposes.

Learn more about dactyl: https://brainly.com/question/375216

#SPJ11

how the research influenced the study of the mind-body interaction

Answers

Research has significantly influenced the study of the mind-body interaction by providing empirical evidence and advancing our understanding of the complex relationship between psychological and physiological processes.

Through various scientific disciplines such as psychology, neuroscience, and psychoneuroimmunology, researchers have explored how thoughts, emotions, and behaviors can influence physical health and well-being.

Studies have revealed the impact of stress on the immune system, the role of neurochemicals in mood regulation, and the effects of mindfulness and meditation on brain activity.

This research has helped establish the field of psychosomatic medicine, highlighting the bidirectional influence between the mind and the body and emphasizing the importance of a holistic approach to health and healing.

To know more about psychoneuroimmunology, refer here:

https://brainly.com/question/30009849#

#SPJ11

what kind of cells can develop from pluripotent stem cells?​

Answers

Answer:

Pluripotent cells can give rise to all of the cell types that make up the body; embryonic stem cells are considered pluripotent. Multipotent cells can develop into more than one cell type, but are more limited than pluripotent cells; adult stem cells and cord blood stem cells are considered multipotent.

Jason and Lyric both are trying to enter Harmony House. Jason pushes on the door with a force of 5N right and Lyric pushes on the door with a force of 3N to the right.

Answers

the total number of pushes all together will be 8N


What type of energy is released from one trophic level to the next?

Answers

The type of energy which is released from one trophic level to the next is metabolic heat energy.

How energy is released from one trophic level to another

Energy simply refers to the ability or the capacity of doing work. However, when energy is being transferred from one trophic level to the other, it so happens by means of or the virtue of heat transfer. It is on this premise that we say that energy is released from one trophic level to the next through heat energy.

In conclusion, we can now confirm and deduce from the explanation given above that energy is needed for living organisms to be able to transfer it from level to another.

Read more on energy:

https://brainly.com/question/8101588

#SPJ1

Why was it so incredibly harmful for the Ebola virus to have struck where it did in West Africa

Answers

The virus was able to evade containment attempts due to a variety of circumstances, some of which are specific to West Africa.

What factor favors Ebola virus spread?

The Ebola virus may have spread as a result of factors like population increase, encroachment into forested areas, and direct contact with wildlife (such eating bushmeat).

The bulk of Ebola virus disease cases and outbreaks since its discovery in 1976 have happened in Africa.

Where communities used burial customs that involved touching or washing corpses, the virus spread quickly.

Therefore, Ebola virus to have struck where it did in West Africa.

Learn more about Ebola virus here:

https://brainly.com/question/836713

#SPJ1

What purpose does a fish ladder serve?

What purpose does a fish ladder serve?

Answers

Answer:

D.

Explanation:

A fish ladder, also known as a fishway, provides a detour route for migrating fish past a particular obstruction on the river.  
Hope this helps

A human skin cell contains 46 chromosomes how many chromosomes are present in a human egg cell

Answers

Answer:

23 chromosomes

Explanation:

Egg and sperm cells are produced by meiosis, which means they will be left with a half set of chromosomes.

which one of the following did not constitute the seven contrasting pairs studied by mendel in pea plant?
A.shape of the leaves
B.height of the plants
C.colour of the flower
D.position of the flower ​

Answers

the answer to this question is D

Answer:

A. Shape of the leaves

Explanation:

Mendel chose seven characters of the pea plant to study.

They are:

1. Flower colour

2. Flower position 

3. Stem length 

4. Pod shape 

5. Pod colour 

6. Seed shape

7. Seed colour 

Shape of leaves was not observed by Mendel.


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

Resting membrane potential depends on: i. differential distribution of ions across the axon membrane ii. the opening of voltage-gated calcium channels iii. active transport of ions across the membrane

Answers

Resting membrane potential depends on differential distribution of ions across the axon and active transport of ions across the membrane.

What is resting membrane potential?Resting membrane potential is the static potential difference between the inside of the cell to outside due to the differential distribution of ions on both side of the membrane.It is due to uneven distribution of ions, differential permeability of membrane to the ions and the activity of ion channels like Na+ and K+ channel.During the resting membrane potential, a cell is at rest and does not carry any signal.The value of resting membrane potential varies in different cell types.In a typical nerve cell, value of resting membrane potential is -70mV.When the cells are excited, membrane potential changes drastically for few milliseconds and is called action potential.

Learn more about resting membrane potential here:

https://brainly.com/question/15459255

#SPJ4

Other Questions
L'avion vient juste d'arriverSngal.A. B. desC. au D. du What is the answer ? b/2 - 4 = 26 Question 1: How is the establishment of the Works Progress Administration (WPA) connectedto the social conditions depicted in the photograph?Question 2: How is the Wall Street Crash of 1929 connected to the social conditions depicted in the photograph? Eric, a novice salesman, works for a pharmaceutical company. He is heading out on a sales trip. Which of the following should he follow to succeed in his sales effort?A. He should offer one-sided messages.B. He should use logic regardless of the audience and the message.C. He should ask a small favor before making a big request.D. He should go in the middle for best results. the distribution of iq (intelligence quotient) is approximately normal in shape with a mean of 100 and a standard deviation of 15.according to the standard deviation rule, % of people have an iq between 55 and 145. do not round. An internal conflict features caracter VS.V Sheridan Chiropractic Clinic produces $320,000 of cash flow each year. The firm has no debt outstanding, and its cost of equity capital is 20 percent. The firms management would like to repurchase $800,000 of its equity by borrowing $800,000 at a rate of 9 percent per year. If we assume that the debt will be perpetual, find the cost of equity capital for Sheridan after it changes its capital structure. Assume that Modigliani and Miller Proposition 1 assumptions hold. (Round answer to 2 decimal places, e.g. 17.54%.)Cost of equity capitalenter the cost of equity capital in percentages rounded to 2 decimal places % solve the system of equations by the addition method 4x + 2y = 463x - 5y = - 11 At t=0s a small "upward" (positive y) pulse centered at x = 4.0 m is moving to the right on a string with fixed ends at x=0.0m and x = 13.0 m . The wave speed on the string is 3.5 m/s . At what time will the string next have the same appearance that it did at t=0s? Which results from an increase in the greenhouse effect? Carla is 5 years old and Jim is 13 years younger than Peter. One year ago, Peter's age was twice the sum of Carla's & Jim's age. Find the present age of each one of them.Carla: ________ Jim: ________ Peter: _______ Q|C A container in the shape of a cube 10.0cm on each edge contains air (with equivalent molar mass 28.9g /mol ) at atmospheric pressure and temperature 300K . Find(c) the force it exerts on each face of the cube. Read Romans 12-14 and 15:1-13. In no less than two paragraphs, describe what these chapters say about how Christians ought to live and explain how you are living a life of obedience to God in accordance with these passages. HURRY PLEASEWhat forces act upon a maglev train? Select the THREE (3) that apply.air resistanceair resistancefriction with the ground/trackfriction with the ground/trackmagnetic fields that attract and repelmagnetic fields that attract and repelgravitygravityapplied forces from other vehicles classify the following items as operating investing financing or significant noncash investing and financing activities using the direct method cash payments to employees Mr. and Mrs. Lopez recently divorced. Their 5-year-old son is likely to ________.a. take on extra household choresb. blame himself for the marital breakupc. escape into undesirable peer activitiesd. provide emotional support to his mother What is the solution set of 6x-24 =0? x^2 Find the first four non-zero terms of the Taylor polynomial of the function f(x) = 2+ about a = 2. Use the procedure outlined in class which involves taking derivatives to get your answer and credit for your work. Give exact answers, decimals are not acceptable. If the expected market return is 4% and the risk-free rate is 1%, what is the required rate of return on BPs stock? appliances-a-rama, an indian company that manufactures kitchen appliances, alters the design of its ranges to suit the needs of its japanese consumers. the japanese prefer compact and efficient appliances to fit their small kitchens. according to the product component model, which product component is being addressed?