Correct any errors in capitalization or punctuation. Your answer should be a single sentence. Poet Maya Angelou advised, "Be a rainbow in someone else's cloud".

Answers

Answer 1

Answer:

Poet Maya Angelou advised, "Be a rainbow in someone else's cloud."

Explanation:

When using quotation marks in the form '<Name> said, "<Quote>', you have to put the ending punctuation before the quotation marking. Then, the sentence would be like <Name> said, "<Quote>."

Therefore, the answer is 'Poet Maya Angelou advised, "Be a rainbow in someone else's cloud."'


Related Questions

According to Zimbardo, the abuse at Abu Ghraib occurred because... B C the inmates were aggressive and threatening. the inmates attempted to overthrow the prison guards. soldiers were left in a position of power without guidance or oversight. soldiers could not communicate with or understand the needs of the inmates.​

Answers

Answer:

C - soldiers were left in a position of power without guidance or oversight.

Explanation

Which of the following statements best explains why the events detailed in the text were called Kristallnacht, the night of broken glass?

Answers

Answer: he events detailed in the text were called Kristallnacht, the night of broken glass because of the shattered glass that littered the streets after the Nazis destroyed Jewish homes, businesses, and synagogues.

Explanation:

Which sentence uses the word painting as a gerund?

A. Joe thought about taking an online landscape painting class.

B. When Margo is painting, she uses a mixture of vegetables and office supplies.

C. Painting is one of the most enjoyable pastimes I know.

D. Lauren was painting her room green but decided to change the color to purple instead

Answers

B. When Margo is painting, she uses a mixture of vegetables and office supplies.

The sentence uses the word painting as a gerund is When Margo is painting, she uses a mixture of vegetables and office supplies. Thus, option B is correct.

What is gerund?

A gerund is any of various non-finite verb forms present in several languages, the most frequent of which functions as a noun. In English, it has the characteristics of both a verb and a noun, such as being modified by an adverb and accepting a direct object.

When an -ing form operates as a verb within a clause (such that it might be modified by an adverb or have an object), the resultant phrase (which may consist of only one word, the gerund itself) serves as a noun within the larger sentence.

When Margo paints, she utilizes a combination of veggies and office materials, according to the text. Hence, option B is correct.

Learn more about gerund here:

https://brainly.com/question/11017355

#SPJ5

Here are your goals for this assignment:

Write a rough draft of a short story
Edit your rough draft for punctuation, spelling, and grammar
Write a final draft of a short story

Writing a short story requires a map or outline that is different from the one used for writing an informational essay. As you prepare to write a narrative, try a technique known as storyboarding. With this strategy, you "draw a map" of your story before you begin writing paragraphs.

In the draft form of storyboarding, you begin by using a series of blank squares. In these squares, you sketch out ideas for the action or events in the story. Mapping out the story can help you to create a logical sequence of events. The squares are a place for you to draw pictures, like a cartoon strip. You can even write short phrases of dialogue. Storyboarding can help you think creatively. Imagine how you will solve the problem of getting your hero out of a difficult situation!

Like novels, short stories need to introduce a problem/solution plan in the plot. They may make use of plot twists, flashbacks, or surprise endings. The only condition is that the story is believable.

After you have finished your rough draft, ask someone else to read it before making a final copy. A peer or adult reviewer will ask questions which help to make certain the story is clearly understood. If the questions can't be answered in the text, you may need to clear up some parts of the story.

Finally, correct it for spelling, punctuation, and grammar. Your finished short story should be at least 400 words long.

If you are keeping a composition folder, arrange to have your short story printed out so you can place it in your folder.

Answers

In this assignment, you will write a rough draft of a short story, edit it for punctuation, spelling, and grammar, and then write a final draft. Storyboarding will be used to map out the story, and you should ensure the plot introduces a problem/solution plan.

Here are the steps to complete the assignment of writing a short story:

1. Brainstorm and Outline: Develop a clear idea or concept for your short story. Consider the characters, setting, conflict, and resolution. Use the technique of storyboarding to sketch out the sequence of events in blank squares, creating a visual map of your story.

2. Rough Draft: Using your outline and storyboarding as a guide, start writing your rough draft. Let your creativity flow and allow the story to take shape.

3. Peer Review: Once you have completed the rough draft, ask a peer or adult reviewer to read your story. Their feedback will help ensure that the story is clear and understandable. Pay attention to any questions or suggestions they have, as they can help you improve the story.

4. Revision and Editing: Take the feedback into consideration and revise your rough draft accordingly. Look for areas that need improvement in terms of plot development, characterization, dialogue, and overall flow. Edit your story for spelling, punctuation, and grammar errors to make it polished and error-free.

5. Final Draft: Based on the revisions and edits, write the final draft of your short story. Make sure it meets the minimum requirement of being at least 400 words long. Check the formatting, font, and any specific requirements mentioned in the assignment prompt.

6. Print and Organize: If you maintain a composition folder, print out your final short story and place it in the folder. This will help you keep track of your completed work and maintain a record of your writing progress.

know more about Storyboarding here:

https://brainly.com/question/29391550

#SPJ8

Read the two excerpts from the two sections about wrestling in The Ancient City.

The boys had to break up the earth to soften it before wrestling. The object of the sport was to throw one’s opponent to the ground.
After exercising, the boys went to the bath house to clean up. Each boy had a strigil, a metal scraper to remove the oil and dust, and also a sponge to wash down. No gymnasium has been fully excavated in Athens.

*****

The contestants for both styles of wrestling rubbed themselves down with oil and sprinkled fine sand over their bodies before a fight. The ground had to be carefully prepared for wrestling. There are innumerable vase paintings showing athletes with the picks they used to break up the ground. . . .
. . . The pankration was by far the most popular event with the crowd. Many of the top contestants became professional wrestlers.

Both excerpts suggest that
is an important detail in Greek wrestling.

Answers

Answer:

Both excerpts suggest that   breaking up the earth to soften it before wrestling

is an important detail in Greek wrestling because The object of the sport was to throw one’s opponent to the ground.

Answer:

Both excerpts suggest that

✔ preparing the ground by breaking it up

is an important detail in Greek wrestling.

hey guys I need help on The bottom of The page please

hey guys I need help on The bottom of The page please

Answers

1. Many 2. Gulf 3. Goal

1.many 2. gulf 3. goal hope that help

What is another way to use the prepositional phrase in this sentence?

((Without hesitation)) the doctor worked feverishly to patch up the wounded soldiers.

A.) The doctor worked feverishly to patch up the wounded soldiers, without hesitation.

B.) The doctor worked feverishly to patch up without hesitation the wounded soldiers.

C.) The doctor worked feverishly, without hesitation, to patch up the wounded soldiers.​

Answers

The doctor worked feverishly, without hesitation, to patch up the wounded soldiers is another way to use the prepositional phrase in this sentence.

A prepositional phrase is a collection of words that includes the preposition, its object, and any object modifiers. It serves as an adjective or adverb in a sentence, changing a noun, pronoun, verb, or adjective. For instance, in the phrase " The doctor worked feverishly, without hesitation, to patch up the wounded soldiers".

Prepositions, modifiers, and their objects are all included in prepositional phrases. Depending on its function in the sentence, a prepositional phrase may be inserted at the start, middle, or end of the sentence.

Hence, the correct option is C.

Learn more about prepositional phrase, here:

https://brainly.com/question/17542837

#SPJ1

Answer:

C.) The doctor worked feverishly, without hesitation, to patch up the wounded soldiers.​

Explanation:

Why was this trip to Washington, D.C., unusual for the author

Answers

The given sentence implies that the trip to Washington, D.C., was unusual for the author. However, without further context or specific information about the author and their usual experiences, it is difficult to determine the exact reasons why the trip was considered unusual. The specific reasons could vary depending on the author's personal circumstances, previous experiences, or any unique aspects of the trip itself.

can I write opposite meaning of city as remote area​

Answers

Yes, you can write the opposite meaning of "city" as "remote area." While "remote area" is not an exact antonym of "city," it is a phrase that conveys a very different meaning and can be used to describe a place that is far away from urban centers or densely populated areas.

What is a city?

A city is a large and permanent human settlement with a high population density and complex infrastructure, including buildings, roads, transportation systems, utilities, and other essential services. Cities are usually characterized by a diverse mix of residential, commercial, and industrial areas, and they serve as centers of culture, commerce, and political power.

Therefore, Cities can vary in size and scope, ranging from small towns with populations of a few thousand to megacities with populations of tens of millions. In addition to their physical characteristics, cities are often defined by their economic, social, and cultural significance, which can vary widely depending on their location and history.

Learn more about city  from

https://brainly.com/question/22693818

#SPJ1

write an email about you did something for the first time in your life​

write an email about you did something for the first time in your life

Answers

Answer:

Something that i did for the first time in my life was go out in heavy rain without a coat on or an umbrella just to bring the wet washing inside my house. I would not want to repeat the experience because i got a fever the next day.

Maybe u can write about you going to a different county for the first time and u can act like you talking to friend. I mean that what I did.

When juliet tells the friar that “this shall slay them both” to what does she refer? what is “this” and who is “both”? support your answer with evidence from the text

Answers

Juliet will be saying this quote and it tells that if the potion does not work, she will stab herself.

what is the story before that statement?

"And with this knife, Ill help it presently. God joined my heart and Romeo's through  our hands  And here this hand, by there to Romeo's sealed shall be the label to another dead, or my true heart with treacherous revolt turn to another. This shall slay them both."

Who are romeo and juliet?

The story of Romeo and Juliet centres on a teenage hero and heroine whose families, the Montagues and the Capulets, are fierce rivals. Romeo and Juliet die as a result of their intense star-crossed love, which ultimately serves to improve relations between their families.

To know more about juliet visit:

https://brainly.com/question/10468114

#SPJ1

Answer: When Juliet tells the Friar that "this shall slay them both", she means that if the potion does not work, she will stab herself so that she does not have to marry Paris. In act 4 scene 1, "This" is referring to the potion the Friar gives her, and "both" is referring to Juliet and Romeo.

Which statement best describes how paragraphs 5-9 inform the first half of the passage? A. They provide additional details about the snake and the threat it poses to Brayton. B. They provide an explanation for how the snake likely came to be in Brayton's room. C. They imply that Brayton's ignorance of the Snakery informed his decision to stay at the mansion. D. They help readers understand why Brayton is surprised by the snake's appearance in his room.​

Answers

The statement that best describes how paragraphs 5-9 inform the first half of the passage is that: (A) They provide additional details about the snake and the threat it poses to Brayton.

This passage is taken from "The Man Who Loved Snakes" by O. Henry. The passage describes the story of a young man, Brayton, who decides to stay in a mansion that is believed to be haunted. The mansion houses a collection of snakes, which Brayton has a particular fascination for Paragraphs 5-9 of the passage provide additional details about the snake and the threat it poses to Brayton.

The author describes the snake in detail, mentioning its size, color, and the way it moves. The author also describes Brayton's reaction to the snake and how he tries to kill it. Additionally, the paragraphs mention the risk of the snake's poison and the effect it could have on Brayton. The author also provides information on how the snake might have entered Brayton's room.

All these details help the readers understand the situation better and the potential danger that the snake posed to Brayton. Therefore, option A is correct. The other options are incorrect because: B. They provide an explanation for how the snake likely came to be in Brayton's room: The paragraphs do provide information on how the snake might have entered Brayton's room. The correct answer is A.

Know more about Brayton's here :

https://brainly.com/question/30210033

#SPJ8

Why i love a country that once betrayed me

How does Takei’s discussion of the 442nd contribute to the meaning of the text? Short answer

Answers

The 442nd is one of the things that inspired the speaker to completely embrace his being an American country, hence the discussion of the 442nd helps to clarify the meaning of the text.

Why was George Takei's family sent to a camp for internees?

The Takei family and over 120,000 other Japanese Americans were instead interned in camps due to their Japanese ancestry. During World War II, the internment of Japanese Americans constituted a massive violation of civil and human rights.

What message does internment convey?

Internment can make you angry or make you cry, but it eventually inspires you to speak up for one other and believe that when we do, genuine change is possible. It deals with overcoming oppression, erasure.

To know more about country visit:-

https://brainly.com/question/1274166

#SPJ1

I need help analyzing this poem!

I do not care to talk to you although
Your speech evokes a thousand sympathies,
And all my being's silent harmonies
Wake trembling into music. When you go
It is as if some sudden, dreadful blow
Had severed all the strings with savage ease.
No, do not talk; but let us rather seize
This intimate gift of silence which we know.
Others may guess your thoughts from what you say,
As storms are guessed from clouds where darkness broods.
To me the very essence of the day
Reveals its inner purpose and its moods;
As poplars feel the rain and then straightway
Reverse their leaves and shimmer through the woods.

Answers

Answer:

you got this!

Explanation:

hope this helped. hehe

Answer:

This may help!

https://poets.org/poem/dreams-2

Explanation:

Copy and paste!

Have a great day!

Bye!

-Your helper!

(i have more if needed)

Which revision of the last sentence best makes it more analytical? O Clinton highlights the phrase "it is time" to command her listeners to speak out. O Clinton repeats "it is time" to ensure that listeners know when to speak out. O Clinton's compelling use of anaphora emphasizes the imperative nature of her assertion. O Clinton's use of ethos illustrates her insistence that others see her vision of the world.​

Answers

The revision that best makes the last sentence more analytical is option c. Clinton's compelling use of anaphora emphasizes the imperative nature of her assertion.

This answer is more analytical because it identifies the rhetorical device Clinton uses, anaphora, and explains its effect on the message. Anaphora is the repetition of a word or phrase at the beginning of successive clauses, which creates emphasis and reinforces the importance of the message.

In this case, Clinton's repetition of "it is time" is an example of anaphora, and it serves to stress the urgency of the situation. By pointing out the rhetorical device and its impact, the analysis goes beyond simply describing what Clinton does, as in options a and b, and delves into the deeper significance of her language choice.

Option d is not as analytical because it focuses on ethos, which refers to the credibility of the speaker, rather than the specific language techniques Clinton employs to make her argument more persuasive. While ethos is an important aspect of rhetoric, it is not as directly relevant to the question of how the repetition of "it is time" contributes to the overall message. Therefore, option c is the most analytical and appropriate revision. Therefore the correct option is C

Know more about  rhetorical device here:

https://brainly.com/question/28938751

#SPJ11

OPINION BASED
"Johnny Outlaw" is a convicted felon who has served time for burglarizing the a very wealthy upper-class family in his hometown. The items he stole were worth $500,000. He is a 1st-time offender who is 20 years old. Which of the above approaches (out of the previous 4 options above) should the judge consider when she gives her sentencing to Johnny Outlaw?there is no correct or wrong answer just tell me your opinion.

Answers

The judge must consider that this is the first time Johnny has been involved in a criminal act before giving the sentence.

Why should the judge consider this?Because Johnny didn't repeat a crime.Because Johnny was never tried.Because this is the first time Johnny has broken the law.

A person who committed a crime for the first time should be judged more leniently than someone who committed a crime, was convicted, and then committed the same or another crime.

This is because the recurrence of crimes shows that the criminal's conviction did not fulfill its social role of reintegrating him into society in a beneficial way.

However, a person who committed the crime for the first time can receive lesser punishment because he made a single mistake, and can be "fixed" by the prison system, except for crimes that were extremely violent and hateful.

Therefore, we can say that the judge must consider Johnny to be a 1st-time offender before pronouncing his sentence.

Learn more about 1st-time offenders:

https://brainly.com/question/11722224

#SPJ1

Scenario: Lisa and Maria work well together even though they have a 40 year age difference between them. Lisa has been in the same position for over ten years while Maria started close to two years ago. One day, Lisa brings in an article about Millennials and starts complaining about “these youngsters” and how they want to “have it all without paying their dues”. Maria feels annoyed, so she responds jokingly, “It’s better to dream big than be stuck in the same position, don’t you think?” This remark causes Lisa to jump up and leave the office, red faced with anger. Maria is embarrassed.


o As a manager what recommendations do you have for resolving this conflict?



o Explain a time when a co-worker stereotyped based on a generational attribute?




o How did you feel? What recommendations do you have to prevent this in the future?

Answers

As a manager, my recommendations for resolving this conflict would be to first have a private conversation with Lisa to understand her perspective and feelings about the situation. It is important to acknowledge and validate her feelings while also explaining the impact of her comments on Maria. Then, I would facilitate a meeting between Lisa and Maria to have an open and respectful conversation about their differing viewpoints and how they can work together effectively despite their age difference. It may also be helpful to provide training or resources on cultural competency and respectful communication to prevent similar conflicts from arising in the future.

I have experienced a similar situation where a co-worker stereotyped based on a generational attribute. One of my colleagues, who was in his fifties, made a comment about how younger employees always want things handed to them on a silver platter and lack work ethic. As a younger employee myself, I felt frustrated and disrespected by this comment.

To prevent this in the future, I recommend promoting open and respectful communication among all employees and emphasizing the importance of avoiding stereotypes and assumptions based on age or other demographics. Encouraging diversity and inclusivity in the workplace can also help prevent stereotyping and promote a more positive work environment for all employees.

3. What does it mean for a word to have a negative connotation?

Answers

It means to have a bad feeling if I’m not mistaking

Target Lesson: Finding the Best Evidence with "The US Has Become a Nation
of Suburbs"
Which detail from the text reveals the author’s prediction about the future of suburbanization ?

Target Lesson: Finding the Best Evidence with "The US Has Become a Nationof Suburbs"Which detail from

Answers

The text reveals the author’s prediction about the future of suburbanization  major effects of suburbanization

The increase of people living outside of cities and the growth of suburbanization can have detrimental effects on the environment. Increased land use, increased land mileage, and increased domestic energy use have all been connected to suburbanization.

The term "suburbanization" refers to the expansion and spatial restructuring of modern cities. The spread of the compact city's population, housing stock, and commercial and industrial activity to new low-density communities is the cause of this growth.

Learn more about suburbanization  https://brainly.com/question/14546542

#SPJ9

https://newsela.com/read/principal-henry-darby/id/2001018992/

https://newsela.com/read/ela-famous-food-origins/id/2001018461/

https://newsela.com/read/texas-storm-power-outage/id/2001019087/

What is the main point of the following articles? Was the article interesting to you? Is the author trying to push a viewpoint?

Answers

Answer:   they want to always be together.

Explanation:

A response to a counter-argument in a debate is known as a-



claim


argument


rebuttal


persuasion

Answers

Answer: rebuttal

Explanation:

Example of dramatic irony in the open boat

Answers

One example of dramatic irony is when the people on the shore see the boat out at sea. They believe that it is a novelty, not that someone might need their help. The people in the boat, see the people on the shore as their rescuers. Both are wrong.

The Counterpoint author believes that the Flynn effect disproves the notion that intelligence is fived at birth mainly because
O A video games are such a popular form of entertainment
O Bil the worldwide average 10 increases over time, then I can't be determined genetically
Cas our ability to process visual information increases, so do our 10s
Dit shows that as time goes by, the world's intelligence stays the same

Answers

The Counterpoint author believes that the Flynn effect disproves the notion that intelligence is fixed at birth mainly because if the worldwide average 10 increases over time, then it can't be determined genetically. The correct option is B.

What are the reasons for the Flynn effect?

According to the Flynn effect theory, the rise in IQ scores can be attributed in part to improvements in education and nutrition. People are also reading more, and new technology - computers, the Internet - forces them to think more abstractly. All of this contributes to an increase in IQ.

The Flynn effect is a long-term increase in population intelligence quotient (IQ) that was observed throughout the twentieth century. The changes were rapid, with measured intelligence increasing at a rate of three IQ points per decade on average.

Thus, the ideal selection is option B.

Learn more about the Flynn effect here:

https://brainly.com/question/11772792

#SPJ1

i need help ASAP!!! how would you describe anne's relationship with her mother versus the one she had with her father

Answers

Answer:

In one of her very first entries, Anne describes talking to her father about staying safe in hiding, and her tone indicates that she feels safe and at ease knowing that they are in hiding together. Her mother, on the other hand, is described as “unbearable” in the very same entry.

Explanation:

BEST ANSWER GETS BRAINLIST. IN BREAKING POINT CHAPTER 2
What is the relationship like between Vicky’s mom and dad?

Answers

Answer:

Vicky's mom and dad don't have a good relationship they are constantly arguing and don't get along. The family if very stressful.

Explanation:

Vicky Fallon, a Bluford High School sophomore, is nearing her breaking point. Her father has lost his job, her parents are arguing over money problems, and her elderly grandfather is moving in with her family, forcing Vicky to give up her bedroom. To make matters worse, Vicky’s little brother, Danny, is becoming increasingly troubled, and Vicky’s best friend, Teresa Ortiz, resents Vicky’s new relationship with Martin Luna. Vicky’s situation becomes even more stressful with the discovery that Dad has been gambling and selling family possessions to pay off debts. After keeping her troubles to herself, Vicky finally confides in Teresa who, in turn, alerts Martin. As the book ends, the Fallons are evicted from their home due to unpaid bills resulting from Dad’s gambling debts, but Martin and others join in to help them move to their new apartment.

Comment:

Do I get brainly now? (:

Analyze your responses to conflict in terms of the exit–voice–loyalty–neglect model discussed in the text. How often do you use each response style in your friendship and romantic relationships? Which style do you use least? What are the results of the way(s) you respond to conflict? Are there any adaptations or changes you would like to make in the future?

If you choose exit, to what extent and under what conditions do you consider it ethical to exit conflict by refusing to reply to texts, emails or phone calls? Does refusing to engage deny the other person an opportunity to resolve the conflict?

Answers

Based on the conflict resolution styles such as the exit–voice–loyalty–neglect model, the most used conflict resolution style for me would be the voice model.

The style that I use the least is the exit style because I prefer to talk things over.

The result of the way I respond to conflict is there has been a good number of conflicts resolved due to the use of the voice model.

No, there are no adaptations I would like to make.

What is Conflict Resolution?

This refers to the methods that are used in order to put an end to conflicts in a peaceful and often compromising manner, finding a "middle ground" that would suit all opposing parties.

Hence, it can be seen that when it comes to the various styles of conflict resolution, each person can decide to make use of a certain style that would best suit the situation or conflict and would give the best results to resolve a conflict.

Read more about conflict resolution here:

https://brainly.com/question/1917566

#SPJ1

Sentences with the word
Encroach
Obliterate
August (not the month)
Coquettish
Bemuse
Anonymous
Edict
Dispensation
Perpetuity
Archaic
Vanquish
Temerity
Torso
Pauper
Acrid

Answers

Answer:

hello! i think these terms associate with adjectives that describes a meanigufl event

Explanation:

Hopefully these work for you! They took a while, so be sure to mark Brainliest!

The marshes encroach most upon the parishes of St Charles, Orleans and Plaquemines.

Once the cannon was fired, the brick wall was obliterated.

The family claims an august lineage.

Before going out on her date, Emily selected a coquettish outfit.

He glanced at his uncle, bemused. "You're threatening to kill me now?" he asked, bemused.

The winners of the $1,000 wished to remain anonymous to protect themselves.

The principal’s edict prohibits female students from wearing skirts and dresses that do not cover their knees.

Families were shocked to learn the state had been given dispensation from a city law in order to build a prison near their subdivision.

John prayed the man who killed his daughter would suffer in perpetuity in prison.

The original Ford Model T car is considered archaic when compared to modern vehicles.

In movies, superheroes usually vanquish the villains.

Misbehaved children have the temerity to challenge rules.

As they slow danced, John’s wrapped his arm around Zoey’s torso.

Hebert was basically a pauper after his wife took all his money in the divorce.

Sulfur has an acrid smell that is quite similar to the odor of rotten eggs.

Which of these questions would be effective interview questions? (Select all correct answers.)
What is your favorite color?
Can you tell me more about that experience?
What else do you remember about that time in your life?

Answers

Answer:

B

Explanation:

Can you tell me more about that experience?

I have to write two small paragraphs on Should government provide health care? can someone help and just give me their opinion on the topic

Answers

Answer:

I would say that yes government should provide health care.

Explanation:

Start off your first paragraph with your opinion and add one reason. An example would be, Government should provide health care because reason 1. Discuss reason 1 in the first paragraph. For the second paragraph start the same way, I think government should provide health care because reason 2. If you have text then include quotes. In one of your paragraphs include a counter claim. Basically say, Some people may say government should not provide health care because (insert reason). Then say, this is not a realistic reason because..... At the end of your first paragraph write a transitional sentence such as, government has many other reasons to provide health care or something along that line. At the end of your second paragraph write a concluding sentence. For example, government should provide health care because reason 1 and reason 2 prove that it would be beneficial.  One reason you could use I thought of right away was so that people are able to care more about helping their child, significant other, mom, dad, etc get better than worry about how much money the life saving procedure is going to cost.  A reason you could say to not provide health care, is that insurance would most likely fight procedures more and it would be difficult to get treatments because if everyone can now get procedures they need for free, some people may not be accepted because they are not in as dire of circumstances. Overall, a general rule of thumb I use is pick the side that is easiest to support not what you necessarily agree with.

a day in the life of a 7 grader on quarantine

Answers

Answer: depressing

Explanation: just depressing

Other Questions
it is estimated that most disabling accidents on the job involve the _____. Which detail from the text reveals the Igbo's dedication to the rules of the gods?O "As the elders said, if one finger brought oil it soiled the others" (125). "Violent deaths were frequent, but nothing like this had ever happened" (124). "It was a warrior's funeral, and from morning till night warriors came and went in their age groups" (121). O "The Earth had decreed that they were an offense on the land and must be destroyed" (125). Express these temperatures in degrees Fahrenheit and in kelvins. A.-252.97 C B. -40 C C. 1,064 C How to Make Lemonade is a topic that would be considered1: too narrow2: too broadHelp ASAP! What are the 3 female parts of a flower? Mr walker needs to purchase another pair of crocs Fill in the complementary DNA strand (template strand). Then transcribe \& translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are the non-template strands. 5'TCAATGGAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATTGACACT 3 ' 5GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTtAACCCCGGA 3 uppose the commissions of the employees of a clothing store are normally distributed. for a random sample of employees, the confidence interval (140.50, 145.50) is generated. find the sample mean x. give just a number for your answer. for example, if you found that the sample mean was 12, you would enter 12. Common symptoms of Multiple Sclerosis include all of the following EXCEPTa) numbness or weakness in one or more limbsb) double vision or blurring visionc) facial weakness or numbnessd) cold sensitivity PLEASE HELP!!!I need help writing an essay for the story "Stray" and "Lone Dog" it is a compare and contrast. Here is the requirements! Assignment: Compare and Contrast EssayLike many of the authors whose stories you read, you know that good writing begins with an idea. You also know that good writing doesnt end there. It takes critical thinking, imagination, research, revision, and peer feedback to transform an idea into a written work. Review the assignment to make sure you understand the requirements. Compare "Stray" and "Lone Dog. "Gather your Checklist from yesterday's lesson's student guide. Your essay should be complete and free from structural, organizational, and mechanical errors. Review the rubric to be sure you are submitting your best work Direct and indirect ways in which the climate system can control the function of terrestrial ecosystems. helppppp please will give brainlist You are flying 2586 miles from San Francisco to New York.The pilot looks at the speedometer on the plane and it reads 615 mph. This is a measure of thea Average Speedb Instantaneous Velocityc Average Velocityd Instantaneous Velocity 2. Which evidence supports the authors reasoning that foods rich in folate can help prevent cancer?A. Dry beans and peas, for example, provide a good source of folate.B. Folate can help repair damaged cells to help lower the risk of pancreatic cancer.C. Folate is also found in broccoli, cauliflower, cabbage, and Brussels sprouts.D. Even the ancient Romans knew about the health benefits of beans and peas. Quote--> Life is not a spectator sport. If youre going to spend your whole life in the grandstand just watching what goes on, in my opinion youre wasting your life - Jackie RobinsonQuestion--> what is the meaning of the following quote? Do you agree? How does it relate to the world? Or your life? e^(3x)+e^x-6=0stuck on step u = e^x, u^3 + u - 6 = 0 Which sentence identifies the author's main claim about Maggie L. Walker in the text? This composite figure is made of three identical cylinders that are connected togetherRadius:3 Height:8 For a fixed confidence level, when the sample size decreases, the length of the confidence interval for a population mean decreases. (T/F).(F)alse FILL IN THE BLANK. Economists estimate that ________ of U.S. currency is outside the United States and held primarily by ________.