Find the length of the missing side (nearest tenth).
25 yd
37 yd

Find The Length Of The Missing Side (nearest Tenth).25 Yd37 Yd

Answers

Answer 1

Answer:

27.3 yards

Step-by-step explanation:

Since this triangle is a right triangle, this can be solved using the equation:

a^2 + b^2 = c^2

c^2 is the side opposite to the right angle (37)

So, you need to change the equation to where it is set equal to b^2.

Subtract a^2 on both sides.

b^2 = c^2 - a^2

Now, plug in the numbers you have.

b^2 = 37^2 - 25^2

Simplify.

b^2 = 1369 - 625

b^2 = 744

Now, to find b, take the square root of 744.

√744 = 27.3

Answer 2
picture included (detailed) on how to solve
Find The Length Of The Missing Side (nearest Tenth).25 Yd37 Yd

Related Questions

Of the 30 girls who tried out for the lacrosse team at Euclid Middle School, 12 were selected. Of the 40 boys who tried out, 16 were selected. Are the ratios of the number of students on the team to the number of students trying out the same for both boys and girls? How do you know?

Answers

Answer: 28 because 16+12=28

Answer:yes the ratios are the same

Step-by-step explanation: when found to common denominator they are equal 16x3 equals 48 and 12x4 equals 48

find the area of the parallelogram with vertices a(−4, 2), b(−2, 5), c(2, 3), and d(0, 0).

Answers

8 square unit to find the area of the parallelogram with vertices A(-4, 2), B(-2, 5), C(2, 3), and D(0, 0), follow these steps:


Step 1: Find the base and height vectors of the parallelogram. Let's use AB and AD as the base and height vectors, respectively.
AB = B - A = (-2 - (-4), 5 - 2) = (2, 3)
AD = D - A = (0 - (-4), 0 - 2) = (4, -2)



Step 2: Calculate the cross-product of the base and height vectors.
Cross product = AB_x * AD_y - AB_y * AD_x = (2 * -2) - (3 * 4) = -4 - 12 = -16

Step 3: Find the area by taking the absolute value of the cross product divided by 2.
Area = |Cross product| / 2 = |-16| / 2 = 8

The area of the parallelogram with vertices A(-4, 2), B(-2, 5), C(2, 3), and D(0, 0) is 8 square units.

To know more about area click here

brainly.com/question/13194650

#SPJ11

Assume you are flipping an unbiased coin and that the flipping process is entirely random. A psychic claims that he can sense the outcome of each flip. You put him to the test. You flip the coin 6 times and guess what

Answers

Given statement solution is :- If I were to assume the flipping process is entirely random and the coin is unbiased, the chances of correctly guessing the outcome of each flip would be 1 out of 2, or a 50% probability.

If I were to assume the flipping process is entirely random and the coin is unbiased, the chances of correctly guessing the outcome of each flip would be 1 out of 2, or a 50% probability. However, the psychic claims to have the ability to sense the outcome of each flip, which would suggest that he believes he can accurately predict the results.

To put the psychic to the test, you can proceed with flipping the coin six times and ask the psychic to guess the outcome of each flip. After the coin has been flipped, compare the psychic's guesses with the actual outcomes to evaluate the accuracy of their predictions.

Keep in mind that even if the psychic does make correct predictions, it does not necessarily prove their psychic abilities. Random chance can occasionally lead to a streak of correct guesses, even if there is no true psychic ability involved. To draw any meaningful conclusions, a larger sample size or repeated testing would be required.

For such more questions on Coin Flip Psychic Test

https://brainly.com/question/15755434

#SPJ11

Someone please help me with this it’s due today I have to write a statement of how I determined the answer for number 1 too please y’all

Someone please help me with this its due today I have to write a statement of how I determined the answer

Answers

Answer:

The Answer Is A.

How I Found The Answer:

4 - 1 = 3

X Comes Before Y In Pairs.

Answer:

wouldn't it be A?

Step-by-step explanation:

3+1=4

3x+1y=4

please solve number 18
18. Find the average rate of change of f(x) = x² + 3x +/ from 1 to x. Use this result to find the slope of the seca line containing (1, f(1)) and (2, ƒ(2)). 19. In parts (a) to (f) use the following

Answers

Given f(x) = x² + 3x +/.

To find the average rate of change of f(x) = x² + 3x +/ from 1 to x, we have to use the formula of average rate of change of function as given below: Average rate of change of f(x) from x=a to x=b is given by:

Step by step answer:

We have been given\(f(x) = x² + 3x +/\) To find the average rate of change of f(x) from 1 to x, we substitute a = 1 and b = x in the formula of the average rate of change of the function given below: Average rate of change of f(x) from

x=a to

x=b is given by:

Now we substitute the values of a and b in the above formula as below: Therefore, the average rate of change of f(x) from 1 to x is 2x + 3.

To find the slope of the secant line containing (1, f(1)) and (2, ƒ(2)), we substitute x = 2

and x = 1 in the above formula and find the corresponding values.

Now we substitute the value of x = 1

and x = 2 in the formula of the average rate of change of the function, we get Slope of the secant line containing \((1, f(1)) and (2, ƒ(2)) is 7\).

To know more about function visit :

https://brainly.com/question/30721594

#SPJ11

Enter the coordinates of the point
on the unit circle at the given angle. 0°

Answers

The points are ( 1,0) (0,1) .

The coordinates of the point on the unit circle -The coordinates for the points lying on the unit circle and also on the axes are (1,0), (–1,0), (0,1), and (0,–1). These four points (called intercepts) are shown here. When you square each coordinate and add those values together, you get 1. They're the sine and cosine values of the most common acute-angle measures.

a.) We seek the coordinates on the unit circle that represent an angle of 0 degrees.

The points on the unit circle are often provided by,

( cosθ, sinθ )

In order to do so,

θ= 0

to acquire,

(cos(0),sin(0))

(1,0)

b. With regard to the location on the unit circle where the angle is 90 degrees,

We swap out

θ = 90

to acquire,

(cos(90),sin(90))

This is condensed to, (0,1)

Learn more about the coordinates of the point on the unit circle brainly.com/question/10169163

#SPJ2

Answer: 1,0

is the actual answer

Which expression is equal to x−7x2+8−x2−x+6x2+8 ?
Responses

x2+2x−132x2+16


−x2+2x−13x2+8


x2+2x−13x2+8


−x2+2x−132x2+16

Answers

Answer:

x2+2x−132x2+16

Step-by-step explanation:

First, let's simplify the expression by combining like terms:

x - 7x^2 + 8 - x^2 - x + 6x^2 + 8

= -7x^2 + 5x^2 - x^2 + x + 16

= -x^2 + 2x + 16

Now we need to factor the quadratic expression -x^2 + 2x + 16. We can use the quadratic formula or complete the square to find the roots, but it turns out that the expression doesn't factor nicely. However, we can rewrite it as -(x^2 - 2x - 16) and then use the quadratic formula to find the roots of the expression inside the parentheses:

x = (-(-2) ± sqrt((-2)^2 - 4(-16)))/(2(1))

x = (2 ± sqrt(68))/2

x = 1 ± 2sqrt(17)/2

x = 1 ± sqrt(17)

So we have:

-x^2 + 2x + 16 = -(x - (1 + sqrt(17)))(x - (1 - sqrt(17)))

Therefore, the expression is equal to -x^2 + 2x + 16, which corresponds to the option:

x^2 + 2x - 13 / 2x^2 + 16

A drama club is planning a bus trip to New York to see a Broadway show. The cost, c, per person varies indirectly with the number of people, p, on the trip. It will cost $30 per person if 44 people go. how much will it cost per person if 20 people go on the trip

Answers

The problem demonstrates inverse variation, where the cost per person (c) is inversely proportional to the number of people (p). As evidenced by the given information, when 44 people go, the cost is $30 per person, and when 20 people go, the cost increases to $66 per person.

If the cost per person, c, varies inversely with the number of people, p, on the trip, we can set up the following equation:

c = k/p

where k is the constant of variation.

We are given that when 44 people go on the trip, the cost per person is $30. We can use this information to solve for the constant of variation, k:

30 = k/44

To find k, we multiply both sides of the equation by 44:

k = 30 * 44

k = 1320

Now we can use the value of k to determine the cost per person when 20 people go on the trip:

c = k/p

c = 1320/20

c = 66

Therefore, if 20 people go on the trip, it will cost $66 per person.

The correct term for the relationship described in the problem is "indirect variation," also known as "inverse variation." In an inverse variation, as one quantity increases, the other quantity decreases, and vice versa. The equation representing this relationship is of the form y = k/x, where y and x are the two variables, and k is the constant of variation. In this case, the cost per person (c) and the number of people (p) exhibit an inverse variation relationship.

Learn more about inverse variation at:

brainly.com/question/13998680

#SPJ11

$14.40 for 4.5 pounds of beef

Answers

Answer:

One pound of beef is $3.2

Step-by-step explanation:

14.40 / 4.5

= 3.2

CHECK:

3.2 * 4.5

=14.40

Answer:

Step-by-step explanation:

The unit rate for this beef is:

$14.40

---------- = $3.20/lb

4.5 lb

question is in the picture

question is in the picture

Answers

$13 for 9 miles. C(m) = 4 + 1m is the equation for m miles.

The following data show the frequency of rainy days in a year less than 0.01 inch 165 days 0.01 -1 inch 90 days 1.01 - 5 inches 60 days 5.01 -10 inches 40 days more than 10 inches 10 days Find the mode.

Answers

The mode of a dataset is the value that appears most frequently. In this case, we need to find the interval of rainfall that occurs most frequently.

From the given data, we can see that the interval "less than 0.01 inch" has the highest frequency with 165 days. Therefore, the mode of this dataset is "less than 0.01 inch"

Effective communication is crucial in all aspects of life, including personal relationships, business, education, and social interactions. Good communication skills allow individuals to express their thoughts and feelings clearly, listen actively, and respond appropriately. In personal relationships, effective communication fosters mutual understanding, trust, and respect.

In the business world, it is essential for building strong relationships with clients, customers, and colleagues, and for achieving goals and objectives. Good communication also plays a vital role in education, where it facilitates the transfer of knowledge and information from teachers to students.

Moreover, effective communication skills enable individuals to engage in social interactions and build meaningful connections with others. Therefore, it is essential to develop good communication skills to succeed in all aspects of life.

Learn more about dataset here:

https://brainly.com/question/26468794

#SPJ11

Express the ratio below in its simplest form.
4:2:2

Answers

Answer:

2: 1 : 1

Step-by-step explanation:

4:2:2

Divide all sides by 2

4/2:2/2:2/2

2: 1 : 1

aune is going to play a game of chance. there are five cups lined up and under one of the cups is a marble. if aune chooses the cup hiding the marble, she wins the prize. what is the probability that she wins the prize? express your answer as a simplified fraction.

Answers

The probability of winning the cup prize is equal to 1/5 and in percentage it is 20%.

What is probability?

Probability is always defined as the ratio of the number of the favorable outcomes to the total number of the outcomes in other words the probability is a number that shows the happening of any event.

Probability = Number of favorable outcomes / Number of total sample

Since there are five cups overall and only one of the cups has a one marble, she has a 1/5 or 20 percent chance of winning the prize.

The probability will be calculated as,

P = 1 / 5

P = 0.2

P = 20%

Therefore, the probability of winning the cup is equal to 1/5 and in percentage it is 20%.

To know more about probability, visit:

https://brainly.com/question/30034780

#SPJ4

Question 5 17 Given $4900 Assets = $3000 Liabilities + $1900 Owner's EquityTransaction - Paid salaries expense of $230 with cash.What is the new total for Owner's Equity? 0 $1470.00 O $1670.00 0 2070.00 0 $1870.00​

Question 5 17 Given $4900 Assets = $3000 Liabilities + $1900 Owner's EquityTransaction - Paid salaries

Answers

Answer:

1900 - 230 = 1670.00 hope that helps you out

over the past few decades, public health officials have examined the link between weight concerns and teen girls' smoking. researchers surveyed a group of 273 randomly selected teen girls living in massachusetts (between 12 and 15 years old). after four years the girls were surveyed again. sixty-three said they smoked to stay thin. is there good evidence that more than thirty percent of the teen girls smoke to stay thin? the alternative hypothesis is:

Answers

We conclude that less than 30% of teen girls smoke to stay thin.

Let p be the percentage of teen girls who smoke to stay thin.

So, the Null Hypothesis,(\(H_{0}\)):

p≥ 30%

This means that at least 30% of teen girls smoke to stay thin

Alternate Hypothesis,(\(H_{A}\)) :

p < 30%

This means that less than 30% of teen girls smoke to stay thin.

The test statistics that would be used here

One sample z proportion statistics:

T.S = p' - p/ \(\sqrt{p'(1-p')/n}\) ≈N( 0,1)

Here p'= sample percent of teen girls who smoke to stay thin = 63/ 273 = 0.231

n = number of sample of teen girls = 273

Now putting these values we have:

Test statistics = 0.231 - 0.30/ \(\sqrt{0.231( 1- 0.231)/ 273}\)

                      = -2.705

So we get the value of z-test statistics as - 2.705.

As there is not provided in the question that the level of significance so we assume it to be 5%. Now at a 5% significance level, the z table gives the critical value of -1.645 for left- the tailed test.

As test statistics is less than the critical value of z that is -2.705< -1.645. So we reject our null hypothesis as will fall in reject our null hypothesis as it will fall in the rejection region due to which we reject our null hypothesis.

Therefore we get that less than 30% of teen girls smoke to stay thin.

To know more about the test statistics refer to the link given below:

https://brainly.com/question/15110538

#SPJ4

A patient is found lying on the floor after falling 13 hours ago. Which of the following laboratory values is expected with a musculoskeletal complication associated with this presentation

Answers

The laboratory values that are expected with a musculoskeletal complication associated with the presentation include elevated creatinine phosphokinase (Option A).

Elevated creatinine phosphokinase level values are generally observed in individuals who suffered damage in the muscle tissues, which is due to the increase in the concentration levels of this enzyme.

Elevated creatinine phosphokinase level values are associated with the functioning of this enzyme which is mainly associated with the functioning of muscle skeletal cells as well as the brain and the heart in the body (heart muscles).

Therefore, with this data, we can see that elevated creatinine phosphokinase level values are associated with complications and or damage of the muscle cells because this protein is mainly observed in these types of cells as well as in the brain of normal individuals.

Learn more about elevated creatinine phosphokinase level values  here

brainly.com/question/15222504

#SPJ4

Complete question is below

A patient is found lying on the floor after falling 13 hours ago. which of the following laboratory values is expected with a musculoskeletal complication associated with this presentation?

A) elevated creatine kinase

B) decreased potassium level

C) decreased WBC

D) elevated GFR

What u have to do: rename ads fractions with common denominators and compare by using < or >
Problem: 5/8 ⬜️ 3/4

Answers

Answer:

<

Step-by-step explanation:

First, let's find common denominators:

Multiply 3/4 by 2.

Product is 6/8.

Next, let's compare both fractions:

5/8 ? 6/8

5/8 is less than 6/8.

Therefore 5/8 < 6/8.

Write as an expression or an equation: Two times a number plus six equals 16.


help please

Answers

Answer:

2x10+6=16

that's the equation

the expression doesn't have an answer so it would look like this:

2x10+6

find the amplitude and period of the function. y = −3 cos(5x)

Answers

So, the period of the function is 2π/5. The general form of the cosine function is y = A cos(Bx + C) + D,

where A is the amplitude, B is the frequency, C is the phase shift, and D is the vertical shift.

In this case, the given function is y = -3 cos(5x). Comparing with the general form, we have:

A = -3 (amplitude)

B = 5 (frequency)

The amplitude is the absolute value of the coefficient in front of the cosine function, which is |-3| = 3. So, the amplitude is 3.

The period of the function is given by the formula: period = 2π / B

Substituting B = 5, we get:

period = 2π / 5

So, the period of the function is 2π/5.

To know more about function click here

brainly.com/question/28193995

#SPJ11

- Melody has 12m of material. She cut 6 pieces. each 1 1/4 long how much material does she have left.

Answers

Answer:

12 - 6(1.25) = 12 - 7.5 = 4.5 meters of material left

Into how many equal parts can the same cake be cut if the cuts can only be made along the gridlines?

Into how many equal parts can the same cake be cut if the cuts can only be made along the gridlines?

Answers

Answer:

I think its 20, hope this helps.

Please help I’ll give brainiest!!

Please help Ill give brainiest!!

Answers

Answer:

The 3rd One

Step-by-step explanation:

All real numbers greater than or equal to -6 and less than 8

Hope this helps ;)

Multiply. (5x+7)^2 :)

Multiply. (5x+7)^2 :)

Answers

Answer:

The answer is B.

Step-by-step explanation:

You can expand it in a simplier way using :

\( {(a + b)}^{2} = {a}^{2} + 2ab + {b}^{2} \)

So for this question :

\( {(5x + 7)}^{2} \\ = {(5x)}^{2} + 2(5x)(7) + {(7)}^{2} \\ = 25 {x}^{2} + 70x + 49\)

Answer:

B. 25x^2+70x+49

Step-by-step explanation:

To multiply we can use a method called FOIL. In this method, we multiply the first terms of each binomial, then the outer terms (first and last), then the inner terms (2nd and 3rd), and finally the last terms (2nd and last). The two binomials in this case are (5x+7)(5x+7).

So this means we first multiply 5x*5x, then 5x*7, then 7*5x, and finally 7*7. Multiplying these out we get 25x^2 + 35x + 35x +49. Finally, combining like terms we get 25x^2+70x+49, which is our answer.

pls help asap if you can!!!!

pls help asap if you can!!!!

Answers

The statement that proves that angle XWY is equal to angle ZYW is

A. If two parallels are cut by a transverse, then alternate interior angles are congruent

What are alternate interior angles

Alternate interior angles are a pair of angles that are formed on opposite sides of a transversal line when two parallel lines are intersected by the transversal.

When a transversal intersects two parallel lines, it creates eight angles. Among these angles, the alternate interior angles are located on the inside of the parallel lines and on opposite sides of the transversal.

In a parallelogram, the two opposite sides are parallel to each other hence the line crossing them will lead to formation of alternate interior angles

Learn more about alternate interior angles at

https://brainly.com/question/20344743

#SPJ1

a bit is a 0 or a 1. a bit string of length 7 is a sequence of 7 digits, all of which are either 0 and 1. (a) how many bit strings of length 7 are there?

Answers

There are 128 number of bit string of length 7.

Define the term string length?The entire amount of characters in a string is referred to as its length or size.With the exception of the null letter "0," the length of a string in C is equivalent to the total number of characters in it. For instance, the string "gfddf" is five characters long, but the string "4343" is four.

For the data given in question-

7-character string with two possible values for each (0 or 1).

a) For strings with an average length of 7 bits:

The 7-digit string contains two possibilities for each digit.

As, a bit is a 0 or a 1.

The 7-digit number is;

N = 2×2×2.... = 2^7 = 128

Thus, there are 128 number of bit string of length 7.

Define the term string , here

https://brainly.com/question/20813205

#SPJ4

A Chinese restaurant in Mandeville, Louisiana, has a large goldfish pond around the restaurant. Assume that an inlet pipe and a hose together can fill the pond in 8 hours. The inlet pipe alone can complete the job in one hour less time than the hose alone. Discover the time that the hose can complete the job alone and the time that the inlet pipe can complete the job alone. Round each to the nearest tenth of an hour.

Answers

The inlet pipe and the hose combined can fill the pond in 8 hours. The inlet pipe alone takes one hour less than the hose alone to complete the job.

Let's assume that the time taken by the hose to fill the pond alone is 'x' hours. This means that the inlet pipe can complete the job in (x - 1) hours.

To find the individual rates of the hose and the inlet pipe, we can use the concept of work done. The work done is equal to the rate multiplied by the time taken.

When the inlet pipe and the hose work together, they can fill the pond in 8 hours, so their combined rate is 1/8 of the pond per hour.

Using the concept of work done, we can set up the following equation:

1/8 + 1/x = 1/h,

where 'h' represents the time taken by the inlet pipe to fill the pond alone.

Now, we can solve this equation to find the values of 'x' and 'h'. By rounding each to the nearest tenth of an hour, we can determine the time it takes for the hose and the inlet pipe to individually fill the pond.

Learn more about rates here: https://brainly.com/question/199664

#SPJ11

Please help me out- I cannot do math correctly-​

Please help me out- I cannot do math correctly-

Answers

Answer:

mark a dot on (0,3) and another dot on (-4, 0) then put a line through them

3 is the y-intercept so you put a mark on 3 then you go down 3 and left 4 which is (-3/-4) a negative and a negative gives you a positive

Katy invests £200000 in a savingsaccount for 4 years. The account pays compund interest at a rate of 1.5% per annum calculate the total amount of interest katy will get at the end of 4 years

Answers

Answer:

£12000

Step-by-step explanation:

1 year = 1.5%

4 years = 6%

6% = 0.06

200000 times 0.06 = £12000

So, Katy will get £12000 interest rate at the end of 4 years.

If you can, please give me a Brainliest; thank you, and have a good day!

Answer:

£3,137

Step-by-step explanation:

First year: £200000 x 1.5% = £3,000

Second year: £203,000 x 1.5% = £3,045

Third year: £206,045 (because of 203,000+3,045) x 1.5% = £3,090.675

Last year: £209,135.675 x 1.5% = approximately £3,137

How many even numbers less than 500 can be formed using 1,2 3 4 5?

Answers

28 different even numbers can be formed using 1,2,3,4 and 5 that are less than 500.

To form the even number from a combination of five different numbers 1 to 5 and the even number less that will be formed from such a combination are less than 500. Therefore, in this scenario, 28 different event numbers will be formed. The cases to formed the even number from 1,2,3,4 and 5 are given below:

Case 1: There is only one digit in the number.

The only even integers in this situation are 2 and 4, adding up to a total of 2.

Case 2: There are exactly two digits in the number.

In this instance, the first digit must be one of the other four permitted digits and the last digit must be either 2 or 4, for a sum of 2*4=8.

Case 3: There are exactly three digits in the number.

In this instance, the middle digit must be one of the other four permitted digits, and the last digit must either be 2 or 4.

The total will be 2*3*2=12 if the middle digit is not 5, which means the first digit must be one of two digits other than the final two digits and 5.

As a result, there exist 28 even numbers with the digits 1, 2, 3, and 5 that are less than 500.

You can learn more about even number at

https://brainly.com/question/1331030

#SPJ4

Miss Hoy can bake two dozen cookies every four hours. Mrs. Jardine can bake one dozen cookies every one hour. Assuming Mrs. gets a 3 dozen Head start, when does Mrs. Jardine bake more cookies compared to Mrs. Hoy? Assume X represents hours and why represents dozens of cookies baked in an hour.

Miss Hoy can bake two dozen cookies every four hours. Mrs. Jardine can bake one dozen cookies every one
Miss Hoy can bake two dozen cookies every four hours. Mrs. Jardine can bake one dozen cookies every one
Miss Hoy can bake two dozen cookies every four hours. Mrs. Jardine can bake one dozen cookies every one

Answers

The time it takes for Mrs. Jardine to bake more cookies compared to Mrs. How is of 6 hours.

How to define the linear functions?

The linear functions in this problem are defined in the slope-intercept format, as follows:

y = mx + b.

In which:

m is the slope, representing the hourly rate for each person.b is the intercept, representing the initial amount of cookies baked for each person.

Miss Hoy can bake two dozen cookies every four hours. Mrs. Jardine can bake one dozen cookies every one hour, then the slopes are given as follows:

Hoy: 24/4 = 6.Jardine: 12.

Assuming Mrs. Hoy gets a 36 cookie head start, the functions are given as follows:

How: y = 6x + 36.Jardine: y = 12x.

Mrs. Jardine will have baked more cookies when:

12x > 6x + 36

6x > 36

x > 36/6

x > 6 hours.

Hence after 6 hours.

More can be learned about linear functions at https://brainly.com/question/24808124

#SPJ1

Other Questions
Consider the claim.Streetlights should be added to the neighborhood to improve evening safety for pedestrians.Identify reasons that support this claim. Check all that apply.Shadows from trees obscure people and objects at the edge of the street.The nearby park and pool promote heavy pedestrian traffic in the evenings.Homeowners are responsible for landscaping their yards and gardens.The neighborhood association has funds available for safety and maintenance.The neighborhood association plans social gatherings and annual picnics. Mary ordered dinner for 10 people.Three people ordered the 4.75 chicken dinner, two people ordered the 4.95 fish dinner and five had beef dinner at cost of 6.75 each. What was the average cost of each dinner at Mary's party What policy goal would a government set if it were trying to achieve price stability?A maintaining a low unemployment rateB maintaining a high economic growth rateC maintaining a high income tax rateD maintaining a low inflation rate what does pen mean?. A pair of jeans is sold for $28. If the sales tax is 6%, what is the total cost of the jeans including tax? what is the value of real gross domestic product (gdp) in 2010? round to the nearest second decimal. a change in relates to a change in method of accounting for an item, whereas a change in arises from a new calculation due to new information or new experience. Power Industries has acquired a patent for $16,000. Its useful life is expected to be four years. When the company records the annual amortization it willIncrease amortization expense and decrease the specific intangible asset. what legal defense to a conspiracy charge claims that the person charged with conspiracy never actually intended to commit a crime and faked their intent to do so? which term applies to the small swellings at the distal end of the axon of a neuron that contain synaptic vesicles? Which excerpt from the passage best states the authors' claim? JUST REPOSTING THIS QUESTION UNTIL I GET A CORRECT ANSWER lol! If the same number is subtracted from both the numerator and the denominator of 13/17 , the result is 3/5 . Find the number. ONE HUNDRED POINTS!Which excerpt from Act 2 of The Monsters Are Due on Maple Street best reflects the idea that fear can lead people to make false accusations?A-"And you're with him tooall of you! You're standing here all set to crucifyall set to find a scapegoatall desperate to point some kind of a finger at a neighbor!"B-A figure has suddenly materialized in the gloom and in the silence we can hear the clickety-clack of slow, measured footsteps on concrete as the figure walks slowly toward them.C-"Maybe he'd found out something and came back to tell us who there was amongst us we should watch out for"D-As suddenly Charlie's lights go off and the lights in another house go on. They stay on for a moment then from across the street other lights go on and then off again. A runner having mass of 55 kg moving at a speed of 9 m/s rounds a bend with a radius of 18 m. What is the centripetal the type of growth that is from head to toe is called In which Colorado Rockies scenario was there more erosion? Why was there more erosion in the scenario? PLEASE PLEASE HELP. Ill give branliest....Im begging. 6. Write the sequence of the mRNA transcript that corresponds to the following gene segment of duplex DNA; indicate which of the two sequences represents the coding strand. Initiation site 5'TATAATGCGCCCATCATGCCGCTAGATTAGA3' 3'ATATTACGCGGGTAGTACGGCGATSTAATCT5' Two students are observing a 10 gram object moving around a circle with a radius of 5 centimeters. The constant velocity of the object is measured as 0.75 m/s with a motion detector. Which is the approximate centripetal acceleration of the object? A. 5 m/s2 B. 11 m/s2 C. 20 m/s2 D. 98 m/s2