find the value of x and identify the type of polygon

Find The Value Of X And Identify The Type Of Polygon

Answers

Answer 1

the figure is a quatrilateral becase have 4 sides

the sum of the internal angles of a quadrilateral is 360

then

\(\begin{gathered} 60+x+x+x=360 \\ 3x=360-60 \\ x=\frac{300}{3} \\ \\ x=100 \end{gathered}\)

so, the right option is D


Related Questions

Monica uses 3 tablespoons of milk in her custard recipe. The ratio of tablespoons to fluid ounces is 2 : 1. How many fluid ounces of milk does Monica use?

Answers

Answer:

1 1/2 or 3/2

Step-by-step explanation:

If three tablespoons of milk is 2 times the amount of fluid ounces, then simply divide three by 2 and you will get one and a halve

A spinner has 5 equal-sized sections with different colors. You spin the spinner 50 times. The results are shown in the table. Find the theoretical and experimental probabilities of spinning blue.

Red Green Blue Yellow Orange
8 11 15 9 7
The theoretical probability is
.

The experimental probability is
.

Question 2
What do you think will happen to the experimental probability when you spin the spinner 400 times?


The experimental probability will stay the same.

The experimental probability will get farther from the theoretical probability.

The experimental probability will get closer to the theoretical probability.

Answers

Answer:

a) If the spinner is fair, then each color must have the same probability, this means that the probability for each color is the number of times that the color (in this case blue) is in the spinner divided the total amount of colors in the spinner, then the theoretical probability for each color is:

Pt = 1/5 = 0.20

The experimental probability can be found by dividing the number of times that the spinner landed on a given color (in this case for blue we have 15 times) divided the total number of spins ( 50)

Pe = 15/50 = 0.30

B) As we increment the number of spins, we should see that the experimental probability gets closer to the theoretical probability.

A wall measures 2 meters 30 centimeters in width.

What is the width of the wall in millimeters?
A:0.0023 mm

B:0.23 mm

C:2.3 mm

D:2,300 mm

Answers

Answer:

The answer is D

Step-by-step explanation:

1 meter = 1,000 millimeters

1 centimeter = 10 millimeters

2 meters = 2,000 millimeters

30 centimeters = 300

2,000+30=2,300

Answer: D. 2,300

Step-by-step explanation:

There is 1000 millimeters in a meter which gets you 2000 plus the 30 centimeters. 30 centimeters is equal to 300 millimeters because for every centimeter its 10 millimeters. Add the 2000 to the 300 and get 2300 millimeters.

What is the value of y when x = 5? y=21x−7 Enter your answer in the box.
y= ___

Answers

Answer:

y = 98

Step-by-step explanation:

y=21x−7

Let x=5

y = 21*5 -7

y =105-7

y =98

The area of a rectangle is 3x2 - 12x square yards. If the width is 3x yards, what is the length of the rectangle?

Answers

Answer:

x - 4 yards.

Step-by-step explanation:

Given:

Area of rectangle = 3x^2 - 12x square yards

Width = 3x yards

To find:

Length of rectangle

Solution:

The area of a rectangle is equal to the product of its length and width.

Area of rectangle = Length * Width

Substituting the given values, we get:

3x^2 - 12x = Length * 3x

Length =( 3x^2 - 12x )3x

Length = x-4

Therefore, the length of the rectangle is x - 4 yards.

Answer: The length of the rectangle is x - 4 yards.

Step-by-step explanation:

We can create an equation to solve this word problem, where the variable L = length.

3x  ×  L  = \(3x^2 - 12x\)

We need to solve for the variable L, to find the length of the rectangle.

First lets factor the right side of the equation to make it easier to divide with.

3x  ×  L  = \(3x^2 - 12x\)

We can factor out 3x from the right side of the equation.

3x  ×  L  = 3x(x - 4)

Now we need to get the variable L by itself (isolating the variable). In order to do that, we can divide both sides by 3x.

3x ×  L  = 3x(x - 4)

/3x           /3x

L = x - 4

The length of the rectangle is x - 4 yards.

The area of a rectangle is 3x2 - 12x square yards. If the width is 3x yards, what is the length of the

For what values of b are the given vectors orthogonal?

(−30, b, 5), (b, b2, b)

Answers

Given :

Two vectors :

\(v_1=-30i+bj+5k\\\\v_2=bi+2bj+bk\\\\\)

To Find :

The value of b for which the vectors are orthogonal .

Solution :

We know , two vectors are orthogonal when the are perpendicular to each other .

So , their dot product will be zero .

So ,

\(-30b+2b^2+5b=0\\\\2b^2-25b=0\\\\b(2b-25)=0\)

Therefore , for b =0 and \(b=\dfrac{25}{2}\) the vectors are orthogonal .

Hence , this is the required solution .

100 inches into yards

Answers

i think that’s about 2.8

2.77778 yards

divide the length value by 36

Match the concepts.

Please help:)

Match the concepts.Please help:)

Answers

The tangent identity is: tan x = sin x / cos x. It relates the tangent, sine, and cosine of an angle in a right triangle.

How to explain the matching

The Pythagorean identity is: sin² x + cos² x = 1. .

The length of the hypotenuse of a right triangle with legs of equal length is √2 times the length of either leg.

The 30-60-90 triangle theorem states that the length of the hypotenuse is 2 times the length of the shorter leg, and the length of the longer leg is √3 times the length of the shorter leg.

The Pythagorean theorem states that in a right triangle, the square of the length of the hypotenuse (c) is equal to the sum of the squares of the lengths of the legs (a and b): c² = a² + b².

Leans more about tangent on

https://brainly.com/question/4470346

#SPJ1

A laptop computer consumes about 20 watts of electricity per hour when operating. At 10 cents per kilowatt-hour, how much does a laptop cost to operate for 5 hours?

Answers

Answer:

$0.01

Step-by-step explanation:

1 kilowatt = 1000 watts

5hrs it uses 100 watts

100 watts = 0.1 kilowatts

0.1 × $0.10 = $0.01

Liam mows 2 acres of a field in 20 minutes he needs to finish mowing 30 more acres if he continues mowing at the same rate,how long will it take liam yo finish 30 acres

Answers

Liam will take 300 minutes to mow 30 acres

Liam mows 2 acres in 20 minutes. The first step is to calculate the number of minutes it will take to mow 1 acre

2= 20

1= x

cross multiply

2x= 20

x= 10

He will mow 1 acre in 10 minutes

Therefore in 30 acres the time it will take can be calculated as follows

1 acre= 10 minutes

30 acre= y

cross multiply both sides

y= 30 × 10

y= 300

Hence it will take 300 minutes to mow 30 acres

Read more here

https://brainly.com/question/7255867?referrer=searchResults

#SPJ1

If Jan adds 5 times her number to 75, she gets 120. What is Jan’s number?

Answers

5x + 75 = 120
5x = 45
x = 9

A contractor agrees to lay a road 3000 m long in 30 days. 50 men are employed and they work for 8 hours per day. After 20 working days, he finds that only 1200 m of the road is completed. How many more men does he need to employ in order to finish the project on time if each man now works 10 hours a day?​

Answers

Answer:

Since the contractor already has 50 men, he needs to employ an additional 71 men to complete the project on time.

Step-by-step explanation:

Let's first find the total amount of work needed to be done, using the given information that the road is 3000 m long:

Total amount of work = 3000 m

We know that 50 men are employed and they work 8 hours per day. So the total man-hours worked in 20 days can be calculated as:

Total man-hours worked in 20 days = 50 men x 8 hours/day x 20 days = 8000 man-hours

We also know that only 1200 m of the road is completed in 20 days. So the amount of work remaining can be calculated as:

Remaining amount of work = Total amount of work - Completed work

Remaining amount of work = 3000 m - 1200 m = 1800 m

Now, we can calculate the total number of man-hours required to complete the remaining work:

Total man-hours required = Remaining amount of work / Productivity rate

Productivity rate = (8000 man-hours) / (1200 m) = 6.67 man-hours/m

Total man-hours required = (1800 m) x (6.67 man-hours/m) = 12,006 man-hours

To complete the remaining work in 10 days, each man needs to work 10 hours per day. Therefore, the total number of men required can be calculated as:

Total men required = Total man-hours required / (Hours per day x Days available)

Total men required = 12,006 man-hours / (10 hours/day x 10 days)

Total men required = 120.06

Rounding up to the nearest whole number, the contractor needs to employ 121 men.

Which number(s) have a 5 that is 10 times the value of the 13,725 in ?

Answers

Answer:

I will give you three, but the answer is the number that has a 50

Step-by-step explanation:

52

654

7657

50 is the numbers that have a 5 in 10 times the value of the 13,725.

What is place value?

Place value is the value of each digit in a number.

For example, the 5 in 350 represents 5 tens, or 50; however the 5 in 5006 represents 5 thousands, or 5000.

Now the given number is,

13,725

10 times of the number is givens as,

13,725*10

or, 137,250

here place value of 5 in 137,250 is 5 tens or 50.

Therefore, 50 is the numbers that have a 5 in 10 times the value of the 13,725.

More about place value :

https://brainly.com/question/27733929

#SPJ1

3. The fuel economy of a car, measured in miles per gallon, is modeled by the function f(s) = -0.009s² +0.699s +12 where s represents the speed of the car, measured in miles per hour. What's the fuel economy of the car when it
travels at an average of 20 miles an hour?
O A. 20 miles per gallon
O B. 26.63 miles per gallon
4
O C.-10.02 miles per gallon"
O D. 22.38 miles per gallon
O Mark for review (Will be highlighted on the review page)

Answers

Answer:

The Answer Will Be D

Step-by-step explanation:
The fuel economy of a car is modeled by the function f(s) = -0.009s² +0.699s +12 where s represents the speed of the car, measured in miles per hour.We need to find the fuel economy of the car when it travels at an average of 20 miles an hour.f(20) = -0.009(20)² +0.699(20) +12f(20) = -0.009(400) +13.98f(20) = 9.6The fuel economy of the car when it travels at an average of 20 miles an hour is 9.6 miles per gallon.Therefore, the answer is option D. 22.38 miles per gallon.

22. The diameter of circle F is 8; AB = 10; and AB, BC, and AC are tangent to circle F.
What is the perimeter of triangle ABC?

22. The diameter of circle F is 8; AB = 10; and AB, BC, and AC are tangent to circle F.What is the perimeter

Answers

The perimeter of the triangle ABC is 60units

What is perimeter of a triangle?

A triangle is a polygon with three sides having three vertices.

Perimeter is a math concept that measures the total length around the outside of a shape.

Since the radius of the circle is 4,

The hypotenuse = 6+x

base = 4+x

Using Pythagorean theorem

(6+x)² = 10² + (4+x)²

36+12x +x² = 100+ 16 + 8x + x²

collecting like terms

116-36 = 12x -8x

80x = 4x

x = 80/4

x = 20

Therefore ;

hypotenuse = 20+6 = 26

base = 20+4 = 24

Perimeter of the triangle = 26+24+10

= 60 units

learn more about perimeter of triangle from

https://brainly.com/question/19819849

#SPJ1

2 3/4 of 500grams in step by step calculator

Answers

Answer:

To calculate 2 3/4 of 500 grams, follow these steps:

1. Convert the mixed number to an improper fraction:

2 3/4 = (2 x 4 + 3)/4 = 11/4

2. Multiply the improper fraction by 500:

11/4 x 500 = (11 x 500)/4 = 2,750/4

3. Simplify the fraction by dividing the numerator and denominator by their greatest common factor, which is 2:

2,750/4 = (2 x 1,375)/(2 x 2) = 1,375/2

Therefore, 2 3/4 of 500 grams is equal to 1,375/2 grams or 687.5 grams.

Step-by-step explanation:

Find the first five terms of the sequence described. a1=3, an+1=an+5

Answers

Answer:

  3, 8, 13, 18, 23

Step-by-step explanation:

The recursive definition tells you the first term is 3, and that each successive term is 5 more than the one before. 5 terms are ...

  3, 8, 13, 18, 23

From Monday to Thursday, the depth of a snowdrift changed by 2 3/8 inches. From Thursday to Friday, the depth changed by half as much. What is the change in the depth of the snowdrift from Thursday to Friday?

Answers

Answer:

From Thursday to Friday, the change in the depth was 19/16 inches

or as a mixed number, 1 3/16 inches

Step-by-step explanation:

From Monday to Thursday, the depth of a snowdrift changed by 2 3/8 inches

now, 2 3/8 = 2(8/8)+(3/8) = 16/8 + 3/8 = (16+3)/8

so, 2 3/8 = 19/8 inches = depth change from monday to thursday

From Thursday to Friday, the depth changed by half as much,

so,

depth change from Thursday to Friday = 1/2(depth change from Monday to Thursday)

depth change from thursday to friday = 1/2(19/8) = 19/16 inches

what is the area of the shaded region ? ​

what is the area of the shaded region ?

Answers

Answer: The area is 8 it litterally tells you there

Step-by-step explanation:

a bottle of wine costs $20. if the wine is $5 more than the bottle, how much is the bottle?​

Answers

Answer: the bottles cost is 15$

Step-by-step explanation:

Answer:

Step-by-step explanation:

if the wine bottle is $20 and the bottle is $5 less, then 20-5=15.

The bottle costs $15

The daily recommended allowance of calcium for a sixth grader is 1,200 mg. One cup of
milk has 25% of the recommended daily allowance of calcium. How many milligrams of
calcium are in a cup of milk? If you get stuck, consider using the double number line.



what's the answer pls tell me

Answers

Answer:

300 milligrams are in aa cup of milk.

Step-by-step explanation:

.25 x 1200 = 300

help- which of the following functions will produce the graph

help- which of the following functions will produce the graph

Answers

Answer:

B

Step-by-step explanation:

y= -24/x²+8

y-int ( 0,-3

if i’m not wrong, i believe it’s b

Use calculus to find the area A of the triangle with the given vertices. (0, 6), (2, −3), (3, 4)

Answers

The area of the triangle with the given vertices is 11.5 square units.

Define the area of triangle by vertices?

The area of a triangle can be calculated using the coordinates of its vertices using the following formula.

To find the area of a triangle with vertices (x₁, y₁), (x₂, y₂), and (x₃, y₃), we can use the following formula:

A = (x₁(y₂ − y₃) + x₂(y₃ − y₁) + x₃(y₁ − y₂))/2

Using this formula with the given vertices (0, 6), (2, −3), and (3, 4), we get:

A = (0(-3 − 4) + 2(4 − 6) + 3(6 − (-3)))/2

A = (0 - 4 + 27)/2

A = 23/2

A = 11.5

Therefore, the area of the triangle with the given vertices is 11.5 square units.

To know more about vertices, visit:
https://brainly.com/question/24877689
#SPJ1

Pie chart values
20%. Rice
15%. Others
Pulses. 30%
maize 20%
wheat 15%

Percentage distribution of products in exports of the
given countries.
(a) What is the value (in $ billion) of pulses export
by US? on a billion
(6)
What is the ratio of wheat export of UK to
maize export of IND? 4:10
(e) By what percentage is the maize export of
JAP more than the rice export of AUS?
(d) If the export of AUS is doubled and that of US is
halved but percentage distribution of products of
export remains the same, then find the value of
Export of Rice by US
Export of Pulses by AUS
In USSR, find the ratio of maize export to the
rice export.

Pie chart values20%. Rice15%. OthersPulses. 30%maize 20%wheat 15%Percentage distribution of products

Answers

a.) The value of pulses exported by US in billion would be=30 billion.

b.) The ratio of wheat export of UK to maize export of IND would be= 6:5

How to calculate the value of pulses exported?

For question a.)

To calculate the pulses, the following steps should be taken as follows:

From the bar chart, the value of pulses in billions = 30 billions.

For question b.)

The ratio of wheat export at UK and maize export at IND would be calculated as follows:

The quantity of wheat export at UK = 24

The quantity of maize export at IND = 20

Therefore, the ratio of wheat to maize = 24:20= 6:5

Learn more about ratio here:

https://brainly.com/question/2328454

#SPJ1

Solve the inequality below. Use the drop-down menus to describe the solution and its graph. 7 13 11 Click the arrows to choose an answer from each menu. The solution to the inequality is Choose.... Choose... A graph of the solution should have Choose.... and be shaded to the​

Solve the inequality below. Use the drop-down menus to describe the solution and its graph. 7 13 11 Click

Answers

Answer:

\(x \leq -4\)

There will be a filled-in hole at -4.

Step-by-step explanation:

We can solve an inequality the same way we do for equations. The only thing to keep in mind, is that multiplying by a negative number will result in flipping the inequality sign (< to > and vice versa)

\(-7x + 13 \geq 41 \text{ //}-13\\-7x \geq 28 \text{ //}:-7 \text{ (Notice we multiply by a negative number.)}\\x \leq -4\)

The difference between a filled-in and an empty hole in terms of inequality graphs, is whether or not the number limiting the inequality is included in it.

For example, in x > 3, 3 is limiting the inequality, however, it is not included in it, therefore, x would always be greater than 3.

In another example, \(x \leq -4\), -4 is limiting inequality and is included in it. Therefore, x would always be less than or equal to -4.

A filled-in hole means the number is included in the inequality, while an empty one means it isn't.

In our cases, -4 is included in the inequality (notice the line under the inequality sign that resembles "less than or equal to"), therefore there will be a filled-in hole at -4.

Anybody can help me out?

Anybody can help me out?

Answers

Answer:

answer D

Step-by-step explanation:

Hello

(fog)(x)=f(g(x))=|4x+9|

so g(x)=4x+9

and f(x)=|x|

hope this helps

Solve this question—————-

Solve this question-

Answers

Answer: (2, -5) (light blue answer choice)

Solving by substitution

−7x+y=−19;−2x+3y=−19

−7x+y+7x=−19+7x (Add 7x to both sides)

y=7x−19

Step: Substitute7x−19 for y in −2x+3y=−19:

−2x+3y=−19

−2x+3(7x−19)=−19

19x−57=−19 (Simplify both sides of the equation)

19x−57+57=−19+57 (Add 57 to both sides)

19x=38

19x/19 = 38/19 (Divide both sides by 19)

x=2

Step: Substitute 2 for x in y=7x−19:

y=7x−19

y=(7)(2)−19

y= −5 (Simplify both sides of the equation)

Therefore: x = 2 and y = −5

Which equation represents the total number of black and white squares on the chess board?

Which equation represents the total number of black and white squares on the chess board?

Answers

The equation that represents the total number of black and white squares on the chess board is 8 * 2² = 32

How to determine the equation of the black and white squares

From the question, we have the following parameters that can be used in our computation:

The chess board

From the chess board, we have

Black squares = 32

White squares = 32

When factorized, we have

Black squares = 32 = 8 * 2²

White squared = 32 = 8 * 2²

Hence, the equation that represents the squares on the chess board is 8 * 2² = 32

Read more about equation at

https://brainly.com/question/148035

#SPJ1

I just need 1,2, and 3 to be solved.

I just need 1,2, and 3 to be solved.

Answers

The values of x and y are

1. x= 35 and y= 25

2. x = 4  and y = 1

3. x = 2 and y= 5

1. We know that opposite angle of parallelogram are equivalent

So, 2x = 70

x= 35

and, 3x +5 = x + 3y

105 + 5= 35 + 3y

110 - 35 = 3y

3y = 75

y = 25

2. Now, the diagonals bisect each other

3x = 12

x= 4

and, x + y = 5y

4 + y = 5y

4y = 4

y= 1

3. Now, opposite sides are congruent then

3x = 6

x= 2

and, x + 2= y-1

4 = y  -1

y = 5

Learn more about Parallelogram here:

https://brainly.com/question/28854514

#SPJ1

1) The values of x and y are,

x = 35, y = 25

2) The values of x and y are,

x = 4, y = 1

3)  The values of x and y are,

x = 2, y = 5

We know that;

Sum of opposite angles in a rectangle is 180 degree and diagonal are bisects each other.

And, Opposite sides of a parallelogram has equal length.

Hence, WE can formulate;

1) WE get;

2x = 70

x = 35

And, 3x + 5 = x + 3y

3 x 35 + 5 = 35 + 3y

105 + 5 = 35 + 3y

110 - 35 = 3y

3y = 75

y = 25

2) Since, diagonal are bisects each other.

Hence, we get;

3x = 12

x = 4

And, x + y = 5y

4 + y = 5y

4y = 4

y = 1

3) Opposite sides of a parallelogram has equal length.

Hence, WE get;

3x = 6

x = 2

And, x+ 2 = y - 1

2 + 2 = y - 1

y = 5

Learn more about the rectangle visit:

https://brainly.com/question/2607596

#SPJ1

Tobias won a $100 gift card at a local Fortnite tournament. He decided that he wanted to
purchase some new dance moves for his in-game character, which cost $5.25 each.
a) Write an algebraic expression to represent the situation.
b) How much money will Tobias have left if he bought 15 dance moves

Answers

Answer:

100-5.25x            100-5.25(15)= 22.25

Step-by-step explanation:

Other Questions
cities in developing countries containing a complex mix of ethnic groups show evidence of which urban structure model Make you the Brainliest!?Fill in the blanks In Spanish, adjectives usually come after the noun that they describe, AND they should "agree" with the noun they are describing. If a noun is masculine (el), the adjective will be masculine (-o). If the noun is feminine (la), the adjective will also be feminine (-a). If the noun is plural (los/las), the adjective should also be plural (-s). Note: Adjectives ending in letters other than -o/-a (such as those ending in -e) are neutral and do not change based on gender.Fill in the table with the correct forms of the adjectives in parentheses that complete the sentences. 5'-CATTTATTTAACTGGGTTCTTGCCCAGCCCATATTTTCACCCTTTAATGG TAATGAAGCTAAAATTTCTTTCCAGTCACTTTGCATATCATTTCCTTTCT CTTTAATTCTCTTTCGAAGTGAGATGATTGATAGATTCTTCTTCAGCAGT CACTTACTTTGGTAGATGATTTTCTTTTTCCTTTGAAGTCGATTTTGAAA GGAGCTCTGTGTGATGAGCTAATTAGCACAAACACACAGAGTATATAACC TTAATTAGGCATGATTATAGGCTCAACGTAATGGGATGTCCTGAAACTGC ACACTATGCAAATATTAGACTTTTCATTCTTCCCATTACATCGGAAACCA TCAAGCAAAGGATGTTTTGCAGTAGGTACCACAGTCAATGCCAGGTGCAA CTCTTTCAATAAAAGGTTGATT-3'1) you want to use PCR to amplify a specific portion. Use the underlined bases as the location of the two primers, what are the two primer sequences that need to be designed and synthesized for PCR? Be sure to indicate the 5 and 3 ends of the primers.2) What is the size of the expected amplified product? everyone is excited about the new subdivision going in on the south end of the valley. it will have more than 400 new homes, a shopping center, a water park, and an extensive park system. people are so excited, in fact, that there is a long waiting list of people who want to buy into the community. according to arizona law, what must the association do when one of those waiting-list members states his intention to buy? Implement the firstOnly method so that it returns the first character of the 5 parameters a, b, c, d and e concatenated together. Getting the other party to reveal why he or she is sticking so strongly to a given point is an example of which of the following practices?A) Remember the intangiblesB) Actively manage coalitionsC) Savor and protect your reputationD) Remember that rationality and fairness is relativeE) Master the key paradoxes One similarity between a small, solid sample of aluminum and a large, liquid sample of aluminum is that both samples have. Solve the given system graphically. Choose the scales on the axes such that the graph of each line clearly shows its intercepts. x + y = 42x y = 5 What are two efforts going on in Florida to further advance theadoption of EHR?What is the impact of HIE and NHIN health care delivery andthe practice of health care providers?Discuss 2 ways tha what are 10 favorite songs that you really like? what does solubility mean? On Monday, a museum had 460 visitors. On Tuesday, it had 600 visitors. Estimate the percentchange in the number of visitors to the museum. Use pencil and paper. Estimate how many peoplewould have to visit the museum on Wednesday to have the same estimated percent changebetween Tuesday and Wednesday as between Monday and Tuesday. Explain your answer.Which of these is the best estimate for the percent change in the number of visitors to themuseum? abilify, one of the new-generation antipsychotic drugs, achieves its effect by being a serotonin and dopamine: a. stabilizing dopamine and serotonin levels in certain areas of the brainb. blocking receptor sites when levels of serotonin and dopamine are too highc. stimulating receptor sites when levels of serotonin and dopamine are too lowd. All of these A ball is launched with a velocity of magnitude 10.0 m/s, at an angle of 50.0 to the horizontal.The launch point is at the base of a ramp of horizontal length d1 6.00 m and height d2 3.60 m. A plateau is located at the top of the ramp. Required:a. Does the ball land on the ramp or the plateau? When it lands. b. What are the magnitude and angle of its displacement from the launch point? What is the total surface area? Echinoderms lack a head and brain, but still have a simple ___________ system.circulatorynervousrespiratorydigestivereproductive FILL IN THE BLANK. rona was asked by her psychotherapist to describe what she saw in 10 ambiguous inkblots. rona was most likely responding to a(n)___test. differences on the dependent measure between the levels of one variable within one level of another variable are known as #38 Choose the correct code assignment for the following scenario: 18-year-old with marijuana abuse and current intoxication is brought into today for a crisis intervention.A. F12.120B. F12.120, GZZZZZZC. F12.220D. F12.220, GZZZZZZ 238U decays spontaneously by emission to 234Th. The atomic masses are 238.050788 u for 238U and 234.043601 u for 234Th.A. Calculate the total energy released by this process.B. Calculate the recoil velocity of the 234Th nucleus.