Help!!!!! Its a Chemistry Question I think its letter choice C but i think it might be D aswell I am not sure Review the following chemical reaction and data table provided.



What mass of water is expected to be produced in the reaction above?

Question options:

76.5 g because the mass of the final product must equal the reactants.


76.5 g because mass cannot be created or destroyed.


18.0 g because the mass of products must equal the reactants.


18.0 g because mass is created for the final product.

Help!!!!! Its A Chemistry Question I Think Its Letter Choice C But I Think It Might Be D Aswell I Am

Answers

Answer 1

Answer:

C

Explanation:

76.5 subtract 58.5, you get 18. Water has to be 18 to make up for the rest of the mass of the reactants

Answer 2

The mass of water is expected to be produced in the reaction above 18.0 g because mass is created for the final product. Therefore, option C is correct.

What do you mean by mass ?

Mass is quantitative measure of inertia. The term mass is defined as it is a fundamental property of matter, and it is the resistance that a body of matter offers to change in its speed or position upon the application of force.

The greater the mass of the body, the smaller the change produced by an applied force.

Mass is a measurement of how much matter an object contains. Weight is a measurement of the gravitational force on an object. It not only depends on the object's mass, but also on its position. Therefore, weight is actually a measure of force.

Here, subtract 58.5 from 76.5, you get 18. Water has to be 18 to make up for the rest of the mass of the reactants.

Thus, option C is correct.

To learn more about the mass, follow the link;

https://brainly.com/question/19694949

#SPJ2


Related Questions

How do you find the Ar of an element?

Answers

By summing up the number of protons and neutrons in an element's atoms, one may get the Ar (atomic mass) of that particular element.

The number of protons and neutrons in an atom's nucleus is added to determine the atomic mass of an element. The mass number is a frequent name for this figure. The weighted average of the masses of all the naturally occurring isotopes of an element is used to determine its atomic mass. Each isotope's proportional abundance in nature is taken into consideration while calculating its weight. The periodic table, which provides the atomic number, symbol, name, and atomic mass for each element, may be used to determine an element's atomic mass, which is often represented in atomic mass units (amu).

learn more about element here:

https://brainly.com/question/14347616

#SPJ4

Why is the condensation of water vapor considered to be a process which hads up the air? a. Water yapar must nbsorb energy in order to condense. b. Air cain hold thore water in the liquld phase that the vapor phase. c. Energy is released by water vapor as it condenses. d. Liquid water has a lower specific heat than water vapor. QUESTION 60 a. 42% b. 2+5% c 90% d. 3376

Answers

The correct answer to the first part of your question is option (c): Energy is released by water vapor as it condenses.

When water vapor condenses into liquid water, it undergoes a phase change from a gaseous state to a liquid state. During this phase change, energy is released in the form of latent heat. This release of energy occurs because the water molecules in the vapor phase are more energetic and have higher kinetic energy compared to the water molecules in the liquid phase.

To know more about latent heat

brainly.com/question/23976436

#SPJ11

What is the frequency of a photon with an energy of 4.56 × 10^-19 J?OA. 6.88 x 10^14 HzOB. 6.42 x 10^14 HzOC. 4.36 x 10^14 HzOD. 5.10 x 10^14 Hz

Answers

So,

There's an equation that we could use in order to find frequency, and it is the next one:

This equation tells us that the energy of the photon is equal to the product of the Plank constant (h), which is 6.626*10^-34 J.s, and the frequency.

In this problem, we know the value of E and the value of h, so we need to solve for v:

Therefore, the correct answer option is A.

What is the frequency of a photon with an energy of 4.56 10^-19 J?OA. 6.88 x 10^14 HzOB. 6.42 x 10^14
What is the frequency of a photon with an energy of 4.56 10^-19 J?OA. 6.88 x 10^14 HzOB. 6.42 x 10^14

The sun sends energy to Earth. This energy, solar energy, helps drive the water cycle. Can you match each term with the correct explanation?



This is another term for vaporization, the
part of the water cycle in which water changes =
from a liquid to a gas. Water moves from
bodies of water on Earth to water vapor
in the atmosphere.


This is the evaporation of water from above
ground parts of plants, especially from leaves =
but also from stems and flowers.


This is the movement of landwater to
the oceans, mainly from rivers, lakes, =
and streams.


Rain, snow, sleet, hail. Condensed =
water falls back to Earth


This is the process of water
changing from a gas to a liquid. =
You will see clouds forming when this
happens.

_______________________________________________________

/1. Transpirtation/ /2. Condensation/ /3. Precipitation/ /4. Run-off/ /5. Evaporation/

Answers

The terms that match the processes are;

1) Evaporation

2) Transpiration

3) Run off

4) Precipitation

5) Condensation

What is vaporization?

We know that the term vaporization has to do with the loss of water from the earth surface. This occurs when energy is supplied to the water molecules that are on the earth surface and they are able to break the barrier of the intermolecular forces in the liquid phase and then transition into the gas phase.

The matching of the terms is done below;

1) This is another term for vaporization, the part of the water cycle in which water changes = Evaporation

2) This is the evaporation of water from above ground parts of plants, especially from leaves = Transpiration

3) This is the movement of landwater to the oceans, mainly from rivers, lakes, = Run off

4) Rain, snow, sleet, hail. Condensed water falls back to Earth =  Precipitation

5) This is the process of water changing from a gas to a liquid.  You will see clouds forming when this happens = Condensation

Learn more about water cycle:https://brainly.com/question/1151425

#SPJ1

help please don’t understand

help please dont understand

Answers

hello sister the answer is very easy it is 2 miles of oxygen

Plz help on question 4

Plz help on question 4

Answers

A.) corn syrup, dish soap, water, vegetable oil
You know thy vegetable oils is going to be at the top because it is the lightest. So, there are really only two possible choices; a or b. B is incorrect because water and soap have the same volume, but soap has a larger mass meaning it would be beneath the water. Therefore, the correct answer is A.) corn syrup, dish soap, water, vegetable oil. Hope this helps!

PLEASE ANSWER! 5 STAR RATING - THANKS (PROFILE TOO) - BRAINLIEST IF 2 ANSWERS
A 14 V battery powers the headlights of a car. What is the resistance of the
headlights if they draw 3.0 A of current when turned on?

Answers

Answer: 9514 1404 393

 4 2/3 ohms

The resistance is the ratio of voltage to current.

 R = V/I

 R = (14)/(3) = 4 2/3 . . . ohms

Explanation:hi ^^ have a great day hope this helps xlXCherryColaXlx (nice pfp btw)

Food contains a sugar called , which is broken down in a process called cellular . This process uses to break down food molecules and provide energy for cells

Answers

Answer:

glucose

respiration

oxygen

Explanation:

Answer:

Oxygen

Explanation:

Took the test

provide a flow chart for the workup procedure for isolating cyclohexanone from all the by-products

Answers

A flow chart for the workup procedure for isolating cyclohexanone:

Transfer reaction mixture to separation funnel.Add aqueous solution and shake.Allow layers to separate.Collect organic layer.Wash organic layer with water.Dry organic layer with anhydrous salt.Transfer organic layer to a distillation apparatus.Distill cyclohexanone to separate from by-products.

After the reaction, transfer the entire reaction mixture to a separation funnel to separate the organic and aqueous phases.

Add an aqueous solution (such as water) to the separation funnel and vigorously shake to extract cyclohexanone into the aqueous phase.

Allow the layers to separate, with the organic phase (containing cyclohexanone) forming the upper layer.

Carefully collect the organic layer and transfer it to a separate container.

Wash the organic layer with water to remove any impurities or remaining by-products.

Dry the organic layer by adding anhydrous salt (such as sodium sulfate) to absorb any remaining water.

Transfer the dried organic layer to a distillation apparatus for distillation to separate cyclohexanone from other volatile by-products.

Collect the purified cyclohexanone as the final product.

To learn more about cyclohexanone visit;

https://brainly.com/question/32929499

#SPJ11

(20 points and excuse any offensive or seemingly bad language in this question) Budding and regeneration are two types of asexual reproduction.

Answers

Answer: true

Asexual reproduction is the process by which an organism is produced from a single parent cell. There are four major forms of asexual reproduction - budding, binary fission, regeneration and parthenogenesis. ... Regeneration is a type of asexual reproduction in which the organism is capable of regrowing certain body parts.

Explanation:

id k what u r talking abt but hope this helps

5. The number of atoms in 9.2 g of Na will be: A. 6.2 x 1023 atoms B. 2.408 x 1023 atoms C. 9.2 x1023 atoms D. 23 atoms E. 9.2 atoms

Answers

Answer:

The answer is "Option B"

Explanation:

Formula:

Na atoms= Na atoms moles \times  NA

               \(= \frac{mass}{Na \ Molar\ mass} \times 6.022 \times 10^{23}\\\\= \frac{9.2}{23} \times 6.022 \times 10^{23}\\\\=0.2875 \times 6.022 \times 10^{23}\\\\=2.4 \times 10^{23}\ atoms \\\\\)

                                     

Using dimensional analysis, convert 523.7 cm into feet. (1 in= 2.54 cm; 12 in=1 ft)
-15962
-2471
-17.18
-43.64

Answers

Answer:

17.18

Explanation:

(1 in = 2.54 cm; 12 in = 1 ft)

Formula:- Divide the length value by 30.48

523.7 ÷ 30.48 = 17.181

Thus, The answer is 17.181

-TheUnknownScientist

Answer:

17.18

Explanation:

I hope its helpful......

add one hydrogen atom, one electron pair, and one formal charge to complete the oxonium ion. do not modify the water molecule or add curved arrows.

Answers

Complete the oxonium ion, we need to add one hydrogen atom, one electron pair, and one formal charge. We do this by adding a hydrogen atom to the oxygen atom, adding an electron pair to the oxygen atom, and calculating the formal charge of the oxonium ion.

To complete the oxonium ion, we need to add one hydrogen atom, one electron pair, and one formal charge. The first thing to note is that the oxonium ion is a type of ion that is formed when a water molecule gains a hydrogen ion (H+). The H+ ion is then attached to the oxygen atom in the water molecule, creating a positively charged ion.

Now, to add the hydrogen atom, electron pair, and formal charge, we need to look at the structure of the water molecule. Water is made up of two hydrogen atoms and one oxygen atom. The oxygen atom has two lone pairs of electrons and two covalent bonds with the hydrogen atoms.

To complete the oxonium ion, we need to add a hydrogen atom to the oxygen atom. This will create a third covalent bond between the oxygen and hydrogen atoms. The oxygen atom will now have a full octet of electrons, as it will have two lone pairs of electrons and two covalent bonds with the hydrogen atoms.

Next, we need to add an electron pair to the oxygen atom. This is because the oxygen atom will have a positive charge after gaining the hydrogen atom. A positive charge means that the oxygen atom has lost an electron, and it now needs another electron to balance out the charge. The extra electron will come from another molecule or ion that has a negative charge.

To know more about  electron pair visit:-

https://brainly.com/question/29427403

#SPJ11

The following is an example of a renewable source of energy:
coal
pretroleum
nuclear energy
hydroelectric

Answers

Answer:

hydroelectric

Explanation:

calculate the number of (a) nitrogen molecules (n2 molecules) and (b) nitrogen atoms (n atoms) in 0.253 g of nitrogen gas (n2)

Answers

The number of nitrogen molecules and nitrogen atoms in 0.253 g of nitrogen gas (N2) are as follows:a) Number of nitrogen molecules = 1.55 × 10²² N2 molecules

Number of nitrogen atoms = 3.1 × 10²² N atoms calculate the number of nitrogen molecules and nitrogen atoms In 0.253 g of nitrogen gas (N2), we use the following Firstly, we calculate the molar mass of nitrogen gas (N2).The molar mass of nitrogen gas (N2) is = 14 × 2 = 28 g/mol This means that one mole of nitrogen gas has a mass of 28 g. Next, we use the following formula to calculate the number of moles of nitrogen gas :N = m / MM where, N = Number of mole sm = Mass of the substance MM = Molar mass of the substance On substituting the values, we get:N = 0.253 g / 28 g/mol = 0.0090357 mol

Now, to calculate the number of nitrogen molecules and nitrogen atoms, we use the following formulas Number of nitrogen molecules = Avogadro's number × Number of moles of nitrogen gas Number of nitrogen atoms = 2 × Avogadro's number × Number of moles of nitrogen gas where, Avogadro's number = 6.022 × 10²³On substituting the values, we get  Number of nitrogen molecules = 6.022 × 10²³ × 0.0090357 = 1.55 × 10²² N2 molecules) Number of nitrogen atoms = 2 × 6.022 × 10²³ × 0.0090357 = 3.1 × 10²² N atoms In summary, 0.253 g of nitrogen gas (N2) contains 1.55 × 10²² nitrogen molecules (N2 molecules) and 3.1 × 10²² nitrogen atoms (N atoms).

To know more about molecules Visit;

https://brainly.com/question/30465503

#SPJ11

5.Summarize Which of the following is not an
advantage of using SI units?
A allows scientists to compare observations
and results
B can compare measurements made years
apart
C based on the number 5, which is easy to use
in calculations
D uses prefixes to express measurements that
are small or large

Answers

Answer:

C based on the number 5, which is easy to use  in calculations

Explanation:

The SI unit system is not based on the number 5.


9.32 L of pentane reacts with 36.4 L of oxygen. how many liters of carbon dioxide are formed?

Answers

Answer:

22.75 L CO2

Explanation:

Balance the Equation

C5H12  +  O2 ==>   CO2 + H2O        Balance the Carbons

C5H12  +  O2 ==>   5CO2 + H2O     Now balance the Hydrogens

C5H12  +  O2 ==>   5CO2 + 6H2O   Now count up the oxygens on the right.

5*O2 + 6O ==> 10 O + 6 O ===> 16 Oxygens.

You have 2 on the left. You have to multiply the oxygens by 8

C5H12  +  8O2 ==>   5CO2 + 6 H2O

The equation is now balanced.

Now find out how much oxygen is needed to burn 9.32 L of Pentane

1 Liter Pentane / 8 Liters Oxygen = 9.32 L Pentane / x     Cross multiply

x = 8 * 9.32

x = 74.56

Read this next sentence very carefully. You need 74.56 Liters of oxygen to burn all the pentane you have. There's not that much there. You only have 36.4 Liters of Oxygen. Some of the pentane won't get burned. Consequently there will be a shortage of CO2 as well.

Find out the number of Liters of Pentane that will be burned up.

1 / x =  8 / 36.4               Cross multiply

8x = 36.4                        Divide by 8

8x/8 = 36.4/8

x = 4.55 Liters of Pentane will be  used up.

Find the number of Liters of CO2

For every Liter of Pentane, 5 Liters of CO2 will be produced.

1/5 = 4.55/x                      Cross Multiply

x = 5 * 4.55

x = 22.75

The diagram below shows the different phase transitions that occur in matter.
0000
Solid
2345
Liquid
Gas
Which arrow would most likely represent the phase change that involves the same amount of energy as arrow 1?
02
6

The diagram below shows the different phase transitions that occur in matter.0000Solid2345LiquidGasWhich

Answers

The phase diagram represents the different phase transitions that occur in matter. The arrow labeled "1" represents the transition from a solid to a liquid state, which is commonly known as melting or fusion.

When a substance undergoes melting, it absorbs a specific amount of energy known as the latent heat of fusion. To identify the arrow that most likely represents a phase change involving the same amount of energy as arrow 1, we need to consider the specific phase transitions and their associated energy changes. The phase transition directly opposite to melting on the phase diagram is the transition from a liquid to a solid state, known as freezing or solidification. This transition involves the release of the same amount of energy that was absorbed during melting.

Hence, the arrow that most likely represents the phase change involving the same amount of energy as arrow 1 is arrow "6," which signifies the transition from a liquid to a solid state. Both melting and freezing involve the same amount of energy exchange, as they are reversible processes occurring at the same temperature.

For more questions on fusion, click on:

https://brainly.com/question/17870368

#SPJ8

What is the difference between a heterogeneous mixture and a homogeneous mixture? *

1) You can not see the parts in a heterogeneous mixture, but you can in a homogeneous mixture.
2) You can see the parts in heterogeneous mixture, but you can not see them in a homogeneous mixture
3) Homogeneous mixtures may settle out while heterogenous mixture never settle out.

Answers

The answer is option 2) You can see the parts in heterogeneous mixture, but you can not see them in a homogeneous mixture.

Answer:

Since,Homogenous mixture is a mixture with uniform composition,appearance and properties.

So option no.2 is correctly.

Question 9 of 10
A team of engineers has decided to design a new shoe for people suffering
from a painful foot condition. What should the engineers do during the
planning stage of their project?
A. Look at the trial's results to see how the design can be improved.
O B. Estimate how much potential consumers would be willing to pay
for this new shoe.
C. Have patients wear the new shoe in an experimental trial to see if
symptoms improve.
D. Build a variety of shoe models.

Answers

Answer: A. Look at the trial’s results to see how the design can be improved.

In an experiment you find the density of water to water to be 1.23 g.Ml.The theoritical value of the water's density is 1. 00 g/ml. Find the percent error

Answers

Answer:

The percent error is 23%

Explanation:

To find the percent error for the experiment carried out,

Percent error is given by the formula below

\(PE = \frac{AE}{TV}\) ×\(100\)%

Where PE is the percent error

AE is the Absolute error

TV is the Theoretical value

Also, Absolute error (AE) can be determined from

Absolute error (AE)  = /Theoretical value(TV) - Experimental value (EV)/

Now, from the question,

Experimental value (EV) = 1.23 g/mL

Theoretical value (TV) = 1.00 g/mL

From,

Absolute error (AE)  = /Theoretical value(TV) - Experimental value (EV)/

Absolute error (AE) = /1.00 g/mL - 1.23 g/mL/

Absolute error (AE) = / - 0.23 g/mL/

Absolute error (AE) = 0.23 g/mL

This is the Absolute error

Now, for the Percent error

\(PE = \frac{AE}{TV}\) ×\(100\)%

\(PE = \frac{0.23}{1.00}\) ×\(100\)%

\(PE = 23\) %

Hence, the percent error (PE) is 23%

A bicyclist decelerates with a force of -350 N. If the cyclist and bicycle have a total mass of 100 kg, what is the acceleration?

Answers

Answer:Acceleration = 3.5 [m/s^2]

Explanation: students
For parents
Textbook Solutions
For teachers
Honor code
Brainly App
Brainly Tutor
User avatar
mshannon4688
02/05/2020
Physics
Middle School
answered
A bicyclist slow with a force of 3.5 x 10^2 N. if the bicyclist and bicycle have a total mass of 1.0 x 10^2 kg, what is the acceleration

1
SEE ANSWER

ADD ANSWER
+5 PTS

Advertisement
mshannon4688 is waiting for your help.
Add your answer and earn points.
Answer
0
author link
rafaleo84
Expert
1.3K answers
1.8M people helped
Answer:

Acceleration = 3.5 [m/s^2]

Explanation:

We can solve this problem using Newton's second law, which states that the sum of forces on a body is equal to the product of the mass by the acceleration

F = 350 [N]

m = 100 [kg]

Using Newton's second law we have:

F = m*a

where:

F = force [N]

a = acceleration or desacceleration [m/s^2]

therefore:

a = 350/100

a = 3.5 [m/s^2]

After hockey practice, Carissa and Keenan were playing a game where they were pushing some objects to get them to crash. They were using a cone and two different pucks—a black one with more mass for Crash 1 and a blue one with less mass for Crash 2. They want to know what happened to the cone. Use the information from the diagram to answer. In which crash did the cone experience a stronger force? How do you know?

Answers

The crash where the cone experience a stronger force is option D because: Crash 1: the force on the black hockey puck was stronger in this crash, so the force on the cone was also stronger.

Does it take a stronger force to slow something down?

The ball is drawn back to Earth by gravitational force. The ball returns to Earth as a result of friction. The ball is forced back toward Earth by magnetic force.

A puck's velocity changes when a player makes contact with it when it is still. He causes the puck to speed up, in other terms. The hockey stick's force, which causes the acceleration, is responsible. The velocity grows as long as this force is in motion.

Therefore, the force applied to an object must be larger than what is required for a progressive slowing down if the object must be slowed down quickly. For instance, a bicycle's brakes will slow or stop it more quickly the more force is given to it.

Learn more about Force from

https://brainly.com/question/12785175
#SPJ1

See full question below

After hockey practice, Carissa and Keenan were playing a game where they were pushing some objects to get them to crash. They were using a cone and two different pucks—a black one with more mass for Crash 1 and a blue one with less mass for Crash 2. They want to know what happened to the cone.

Use the information from the diagram to answer.

In which crash did the cone experience a stronger force? How do you know?

answer choices

There was no force on the cone. In both crashes, only the hockey puck experienced a force.

The diagram doesn’t tell you anything about the force on the cone. It only gives information about the force on the pucks.

It was the same force in both crashes; the hockey puck changed speed by the same amount in each crash, so the force on the cone was the same each time.

Crash 1; the force on the black hockey puck was stronger in this crash, so the force on the cone was also stronger.

After hockey practice, Carissa and Keenan were playing a game where they were pushing some objects to

Can someone please definition of atomic radius using , nucleus, valence electrons and energy.❤️

Answers

Answer:

Explanation:

-The Atomic Radius of an element is the distance between the center of an atom

-nucleus and its outermost, or valence electrons. ... These changes are caused by the interaction between the positive charge of the protons

- nucleus and the negative charge of all the atom's electrons.

HELP NOW! What happens during the process of digestion?

Answers

Answer:

As food passes through the GI tract, it mixes with digestive juices, causing large molecules of food to break down into smaller molecules. The body then absorbs these smaller molecules through the walls of the small intestine into the bloodstream, which delivers them to the stomach

Answer:

Food contents that the animal or creature has swallowed goes into the stomach. The contents gets broken down. The energy from the contents will then go through the body.

How many moles of NaOH are
needed to react with 200g of H2SO4
using the equation below?
H2SO4 + 2NaOH -> Na2SO4 + 2H2O

Answers

Answer:

4.08moles

Explanation:

The balanced equation of this reaction is given as:

H2SO4 + 2NaOH -> Na2SO4 + 2H2O

From the above balanced equation, 1 mole of H2SO4 is needed to react with 2 moles of NaOH.

Using the formula below to calculate the number of moles in 200g of H2SO4;

mole = mass/molar mass

Molar mass of H2SO4 = 1(2) + 32 + 16(4)

= 2 + 32 + 64

= 98g/mol

number of moles = 200g ÷ 98g/mol

n = 2.04mol

Since 1 mole of H2SO4 is needed to react with 2 moles of NaOH.

Then, 2.04mol of H2SO4 is needed to react with 2.04 × 2/1 = 4.08moles of NaOH.

Which of the following elements has the greatest electron affinity (largest positive value)? Br Ar K As I

Answers

Among the elements listed chlorine has the greatest electron affinity, indicating the largest positive value. It represents the energy change when an atom gains an electron to form a negatively charged ion.

Electron affinity is a measure of an atom's tendency to accept an electron. A larger positive value for electron affinity indicates a stronger attraction for an additional electron. Among the elements provided: Bromine (Br) has a high electron affinity but a slightly lower value compared to chlorine. Argon (Ar), being an inert gas with a complete electron shell, has a very low electron affinity as it is stable and does not readily accept additional electrons.

Potassium (K) has a relatively low electron affinity since it is more likely to lose an electron to achieve a stable electron configuration. Arsenic (As) has a higher electron affinity than bromine but lower than chlorine, indicating its ability to accept an electron but not as strongly as chlorine. Iodine (I) has a lower electron affinity compared to bromine and arsenic.

Therefore, among the given elements, chlorine (Cl) exhibits the greatest electron affinity, indicating the largest positive value.

To learn more about ion, click here: brainly.com/question/18534048

#SPJ11

chemical reaction between

Answers

Bet week what thing like what items

Enter the condensed electron configuration for Ni³. Express your answer in condensed form in the order of orbital filling as a string without blank space between orbitals. for example, [He]2s²2p² should be entered as He]2s^22p^2.

Answers

The condensed electron configuration for Ni³ is [Ar]3d⁷. The order of orbital filling for this configuration is: 1s²2s²2p⁶3s²3p⁶4s²3d⁷.

Arrangement of electrons within an atom or ion is called electron configuration and it describes the distribution of electrons into various energy levels, sublevels, and orbitals within an atom.

Electron configuration is written using the notation known as the Aufbau principle, which follows the order of filling the atomic orbitals based on increasing energy. The four quantum numbers (n, l, m, and s) are used to describe the properties of electrons and distribution within an atom.

To know more about electron configuration, refer

https://brainly.com/question/26084288

#SPJ11

Define Transportation plants:

Define Respiration Plants:

Answers

Answer:

Define Transportation in plants: Transportation in plants is when the plant transports water and other mineral throughout the whole plant from the roots to the stem and finally specific parts of a plant.

Define Respiration In Plants: Is when plants use photosynthesis to make their own food to make energy for the plant's growth

Other Questions
What is the dramatic purpose of act 3 Scene 3? Is Snowball a good guy in Animal Farm? How do Cis and Trans regulatory elements interact? a. Cis elements are transcribed and translated and bind to Trans elements b. Trans elements are the sites where basal transcription occurs. c. Cis elements are DNA sites where Trans elements can bind d. They are independent and to not interact Which of the following terms best represents the molecules that carbon can form? Options : heavy, long, diverse, simple What is the function of the school district supervisor your answer? Hola, esto no es una tarea pero me gustara saber su opinin general de la pelcula "JUEGO DE HONOR", por favor NO me pongan un resumen de la pelcula (ya la vi), slo una opinin corta y general. Gracias Buen Da :) Sophies friend gave her 1/2 of a chocolate bar. She ate 1/5 of it. How much did she eat? Which statistical measurement informs a CTRS about how well the assessment results compare to what is being measured?A.Equivalent-forms reliabilityB.Criterion-related validityC.Test-retest reliabilityD.Construct validity Aball thrown horizontally from the too of a building hits the groundin 1.00s. If it had been thrown woth twice the soeed in the samedirection, it would have hit the ground in:a. 4.00sb. 2.00sc.1 7. A university would like to construct a mathematical model to predict first-year marks for incoming students based on their achievement in grade 12 . a) Create a scatter plot and line of best fit for these data. (use Desmos)(3 marks) b) Determine the correlation coefficient using the formula and describe the relationship between the variables. (4 marks) c) Write the equation of the line of best fit(use Desmos). (2 marks) d) Predict your first-year mark if you have an average of 83 for grade 12 . (1 mark) Describe Apollo Creed's attitude towards Ivan Drago before their fight. How does hisintroduction reflect that attitude How do you know if its discontinuous? A circle has a radius of 8 ft. What is the area of the sector formed by a central angle measuring 225 degrees? Use 3.14 for pi. Enter your answer as a decimal in the box. ____ft In lines 72-73 the narrator says that balboas hindsight is always good cite two examples from the story that support this statement Help I'm confused!This is the beginning sequence of the first exon in the mRNA sequence:AUGAAGCUCUUUUGGUUGCUUUUCACCAUUGive the DNA/genomic sequence it was transcribed from. the nurse is completing the health history of a 6-month-old infant with retinoblastoma with the child's parents. which symptom should the nurse expect that the parents have observed? what is the primary difference between gram+ and gram- bacteria? Using survey data, i can conclusively determine that one thing causes another thing. True or false 2(x-3)+5>39Thanks!!!!!!!!!!! What is the resolution in hey come on out