HELP PLEASE !

One difference between cellulose and starch is:

-starch consists of glucose, while cellulose does not.

-starch is made by plants, while cellulose is not.

-starch is used for storing energy, while cellulose is not.

-starch is a polysaccharide, while cellulose is not.

HELP PLEASE !One Difference Between Cellulose And Starch Is:-starch Consists Of Glucose, While Cellulose

Answers

Answer 1

Answer:

starch is made by plants whie cellulose is not


Related Questions

2 Select the correct answer from each drop-down menu. Complete the sentence to describe the effect of the given parasite on its host ___ is a parasite that lives in the gastrointestinal tract. It typically causes loss of ___ in the host animals ​

Answers

The effect of nematode parasites on their host animals can vary depending on the specific species and the severity of the infection.

However, one common effect of nematodes, particularly those that reside in the gastrointestinal tract, is the loss of nutrients in the host animals.

Nematodes are known to feed on the nutrients present in the host's gastrointestinal tract, including carbohydrates, proteins, and other essential substances.

Thus, as a result, the infected host may experience a reduced ability to absorb and utilize these nutrients for their own growth and maintenance.

Know more about parasites:

https://brainly.com/question/30669005

#SPJ1

Which of the following drugs impact RNA synthesis in bacteria?Choose one or more: A.amoxicillinB.lipiarmycinC.rifampinD.tetracycline

Answers

Amoxicillin affects bacterial RNA production.

A penicillin antibiotic is an amoxicillin. Infections caused by bacteria are treated with it, including abscesses in the mouth and pneumonia in the chest. Additionally, it can be used in conjunction with other antibiotics and medications to treat stomach ulcers.

Several bacterial diseases are treated with amoxicillin. Why doctors view it as a potent antibiotic because of its potency against numerous bacterial strains. The penicillin family of antibiotics includes amoxicillin. It treats bacterial infections the same way as other antibiotics. It has no antiviral properties, hence it has no effect on cold or flu viruses. Amoxicillin may be prescribed by medical professionals to treat infections of the respiratory system, urinary tract, ears, throat, and skin.

Option A is the proper response, so.

To learn more about RNA, refer:-

https://brainly.com/question/23893838

#SPJ4

Complete each calculation and report the answer using the correct number of significant figures. 5.170 kg + 4.20 kg = kg 11.8713 L – 6.2 L = L (3.14 mm)(1.173 mm) = mm2

Answers

Answer:

#1.  9.37 kg

#2  5.7 L

#3  3.68 mm^2

Explanation:

The amount of water a body requires for survival is dependent upon the climate and the individual’s level of physical activity.

Answers

The statement "The amount of water a body requires for survival is dependent upon the climate and the individual’s level of physical activity" is true because these factors directly influence the body's water needs.

Climate affects the rate of water loss through sweating and evaporation. In hot and humid climates, individuals tend to perspire more, leading to increased water loss and higher hydration requirements. Similarly, physical activity increases the body's temperature and triggers sweating, resulting in additional water loss.

Engaging in exercise or laborious tasks amplifies the demand for water to replenish the fluids lost during perspiration. Neglecting to meet these increased water needs can lead to dehydration, impaired physical performance, and potential health risks, the statement is true.

To learn more about climate follow the link:

https://brainly.com/question/3122713

#SPJ1

The correct question is:

The amount of water a body requires for survival is dependent upon the climate and the individual’s level of physical activity.

True or False

Heavy growth in the incubator after bacterial strains were incubated in candle and anaerobic jars

Answers

Answer:

Heavy growth in the incubator refers to the significant increase in the number of bacteria that were being cultured or grown in a controlled environment. The incubator refers to the device that provides the optimal conditions, such as temperature and humidity, for the growth of microorganisms.

Explanation:

When bacterial strains were incubated in candle and anaerobic jars, it means that the bacteria were placed in two different environments to observe their growth. The candle jar is used to create a low-oxygen environment, while the anaerobic jar creates a completely oxygen-free environment. The fact that there was heavy growth observed indicates that the bacteria thrived and multiplied rapidly in both the candle jar and anaerobic jar. This means that the bacterial strains were able to adapt and survive in low-oxygen or oxygen-free conditions. Overall, the observation of heavy growth in the incubator after incubating the bacterial strains in candle and anaerobic jars highlights the ability of these bacteria to flourish in specific environments with limited or no oxygen availability.

1. Pretend you are taking a balloon ride through the layers of Earth's
atmosphere. Name and describe the properties of each layer as you move up
from the surface of the planet. What objects might you see in each layer?

Answers

The Earth's atmosphere is divided into several layers, each with different properties and features including the troposphere, stratosphere and soon.

What are the different atmospheres?

The Troposphere: This is the lowest layer of the atmosphere and extends from the Earth's surface up to about 7-20 kilometers. It is the layer where weather occurs, and the temperature decreases with altitude. The air pressure is also highest at the surface and decreases with altitude. You might see clouds, rain, snow, and other weather patterns in this layer.

The Stratosphere: This layer extends from the top of the troposphere to about 50 kilometers. The temperature in this layer increases with altitude and is characterized by the presence of ozone, which absorbs ultraviolet radiation. The stratosphere is also home to high-altitude aircraft, weather balloons, and some satellites.

The Mesosphere: This layer extends from the top of the stratosphere to about 80-85 kilometers. The temperature in this layer decreases with altitude, and it is where meteoroids burn up as they enter the Earth's atmosphere.

The Thermosphere: This layer extends from the top of the mesosphere to about 600 kilometers. It is characterized by high temperatures and low air pressure, and it is home to the aurora borealis, which is visible as northern and southern lights.

The Exosphere: This is the outermost layer of the Earth's atmosphere and extends from the top of the thermosphere to several thousand kilometers. This layer is thin, and the air particles are so far apart that they can escape the Earth's gravitational pull and become part of space.

Find out more on earth's atmosphere here: https://brainly.com/question/25526298

#SPJ1

Amylase, albumin, hemoglobin, keratin, and collagen are all
O carbohydrates
Onucleic acids
Oproteins
Olipids

Answers

Amylase, albumin, hemoglobin, keratin, and collagen are all option(c) i.e, proteins.

An incredibly complex, naturally occurring molecule known as a protein is made up of amino acid residues connected by peptide bonds. All living things contain proteins, which are the building blocks of numerous vital biological substances like enzymes, hormones, and antibodies.

The three basic classes of proteins—globular, fibrous, and membrane—that correspond to typical tertiary structures can be arbitrarily grouped into three groups. Plant-based foods (fruits, vegetables, grains, nuts, and seeds) frequently lack one or more essential amino acids, but animal-based foods (meat, chicken, fish, eggs, and dairy products) are frequently good sources of complete protein.

The body uses protein for a variety of purposes. It promotes metabolic reactions, supports tissue growth and repair, and synchronizes biological processes. Proteins give your body a structural foundation while also ensuring optimal pH and fluid balance.

To know more about Proteins refer to:  https://brainly.com/question/17095120

#SPJ9

What is the article, "World Without Waste" by Rick
about.

Answers

The article, "World Without Waste" by Rick is all about about recycling as well as reuse as a part of sustainable packaging form of initiatives.

What is the  "World Without Waste"  about?

There are a lot of plastic trash litters the seashore close to Athens, Greece. For every person on the planet, the globe has produced more than 1 metric ton of plastic, much of which is said to be clogging up the oceans and the environment.

Landfills are overflowing with plastic garbage, polluting cityscapes, choking waterways with vast fields of detritus, and killing aquatic life that eats everything from used fishing gear to disposable food containers.

Hence, Environmentalists and others want to limit plastic trash by recycling it or lowering the amount of plastic that is produced.  

Learn more about recycling from

https://brainly.com/question/2055088

#SPJ1

What are the stages of bee development (eggs,larvae,pupae)

Answers

The stages of bee development are egg, larva, pupa, and adult. Eggs hatch into larvae, which then transform into pupae. Finally, adult bees emerge and undergo further maturation.

The stages of bee development are:

1. Egg: The bee life cycle begins when the queen bee lays an egg in a honeycomb cell.

2. Larva: The egg hatches into a larva, which is a legless, grub-like creature. The larva is fed a special diet called royal jelly, which stimulates its growth.

3. Pupa: The larva undergoes metamorphosis and transforms into a pupa. Inside the sealed cell, the pupa undergoes various changes, developing into an adult bee.

4. Adult Bee: After completing the pupal stage, the fully developed adult bee emerges from the cell. The bee then undergoes further maturation, such as its exoskeleton hardening, wings expanding, and adult coloration appearing.

It's important to note that there are three castes of bees: queen, worker, and drone. The development process for each caste is similar, but the diet and size of the cells they are raised in differ, leading to their distinct roles within the colony.

For more questions on bee development:

https://brainly.com/question/28696131

#SPJ8

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Answers

Answer:

what I don't understand what is the Ctcagt

How did the results of Gerya's model provide evidence for what formed the novae on Venus?

Answers

Answer:

he model results matched the novae onVenus. This provided evidence that Gerya's idea that a thinner crust and higher surface temperature might allow melted rock to push up toward the surface, forming novae. ... Gerya's Venus model helped him to get evidence about how landforms on Venus were formed

Explanation:

The results of Gerya's model provided evidence that novae was formed on Venus since the result of the model matched the novae that were formed.

Gerya wanted to know how novae was formed on Venus. Gerya's model illustrated ideas relating to how novae were formed.

According to Gerya and his team, the novae were formed on Venus due to the fact that Venus had thinner crust and a higher surface temperature.

The model illustrated the above point as it showed that the higher surface temperature led to the melted rocks that were pushed up which then formed novae.

In conclusion, Gerya's model illustrated how novae was formed on Venus.

Read related link on:

https://brainly.com/question/18228340

What would most likely happen to this ecosystem if all of the gray wolves
were removed?
Secondary
consumers
Primary
consumers
Primary
producers
Red fox
Red squinel
Pine
Snowshoe
hore
Gray woll
Roven (debivore)
Moose
Beaver
WA
Maple Bolsam Fir Cottonwood Aquatic plants
OA. The cottonwood population would decrease.
OB. The snowshoe hare population would decrease.
OC. The fox population would decrease.
OD. The moose population would decrease.

Answers

C. the fox population would decrease

The diffrence of a number and 4 thirds 11 thirds. What is the number?

Answers

For the word problem, If the difference of a number and the fraction \(\frac{4}{3}\) is \(\frac{11}{3}\), then the number is 5.

How do we solve for the number?

The above mathematical problem is a word problem. Word problems are problems that are written in words, rather than in symbols.

To solve for the difference or mystery number, we say, Let x be the number.

The problem states that x -  \(\frac{4}{3}\) =  \(\frac{11}{3}\),

movin -  \(\frac{4}{3}\) to the other side of the equation,

we get x = \(\frac{11}{3}\) + \(\frac{4}{3}\) = \(\frac{15}{3}\)

We solve the fraction by dividing 15 by 3

\(\frac{15}{3}\) = 5

Find more exercises on word problem;

https://brainly.com/question/29027588

#SPJ1

-. In general, what are three main components
of a transport system?

Answers

Although part of your question is missing, you might be referring to this full question:  what are the three main components of a transport system of the human body?

The three main components of a transport system are the Heart, Blood, and Blood vessels.

The function of the first main component, the heart, is to pump oxygenated blood throughout the body and receive the deoxygenated blood from the other various parts of the body. This impure blood is then sent to the lungs for oxygenation. The function of the blood is to transport the gases oxygen and carbon dioxide between the lungs and the rest of the body.

Blood also transports nutrients absorbed in the digestive system to all the other organs in the body. The function of the blood vessels is to act as the vessels required to transport blood throughout the body.

Learn to know more about the Heart on

https://brainly.com/question/16566688

In birds, having long feathers (L) is dominant to short feathers (l). A homozygous dominant bird and homozygous recessive bird mate. After creating a punnett square, give the genotypes and phenotypes of the four resulting offspring (include the number of each)

Answers

Answer:

All the genotypes would be heterozygous (L l) and the phenotypes would be long feathers

Explanation:

what is the respiratory organ of insect​

Answers

Answer:

Oxygen and carbon dioxide gases are exchanged through a network of tubes called tracheae. Instead of nostrils, insects breathe through openings in the thorax and abdomen called spiracles.

Explanation:

The 2 meters of DNA that makes up the human genome is able to fit in one cell because the chromatin is ______.
Multiple choice question.

A. only used once and then packed into rodlike chromosome
B. organized around proteins
C. digested and reformed on a regular basis
D. wound around the inner circumference of the cell membrane

Answers

Answer:

B. Organized around proteins

Explanation:

Because the chromatin is arranged around proteins, the 2 meters of DNA that make up the human genome may fit in one cell.

How does a DNA fit into every cell?

Because the entire DNA strand must fit inside the cell's nucleus, it must be wrapped very tightly. The DNA is wound around structural histone proteins, which serve as a scaffolding for the DNA to be wound around, to achieve this.

Do 2 meters of DNA exist?

Human cells contain around 2 meters of DNA if it were stretched end to end. Yet, the nucleus, which contains the DNA, has a diameter of only around 6 micrometers. This is equivalent to stuffing 40 km (24 miles) of extremely, geometrically speaking.

To know more about chromatin visit:-

https://brainly.com/question/11073325

#SPJ1

please please please help​

please please please help

Answers

Answer: 1) Answer is B 2) answer is B 3) answer is C

Explanation:

A student has a bag of Takis. They accidentally rip a hole in the bag and
the takis begin to fall onto the floor. As the takis fall they are losing
potential energy and gaining what type of energy?

Answers

Answer:

kinetic energy

Explanation:

Potential energy is the energy of an object while it is not moving, kinetic energy is an energy of an object while it is moving.

When an object is losing potential energy, it slowly starts moving.

when an object loses kinetic energy it slowly starts stopping.

So in a nutshell, the Takis are falling and losing their potential energy, while gaining kinetic energy.


19. What's the main sugar that's transported in your blood and used to produce energy?
A. Glucose
B. Fructose
C. Sucrose
D. Maltose

Answers

Answer: A. Glucose

Explanation:

Glucose is a simple sugar, also known as a monosaccharide, that is produced by the digestion of carbohydrates in the foods we eat. It is then absorbed into the bloodstream and transported to the cells throughout the body to provide energy for various cellular processes. Glucose is the primary fuel source for the brain, muscles, and other organs in the body.

Poop that is burned and used for energy is an example of...

a. Solar Power
b. Biomass
c. Wind Power
d. Hydro Power

Answers

Answer:

B. biomass

Explanation:

plz mark brainliest if correct.

reasons why science teachers think practical sciences is a good thing.

rubric
identify reasons 4 marks
explanation and practical example 16 marks ​

Answers

Science teachers consider practical sciences to be a valuable component of science education for several reasons:

Hands-on Learning: Practical sciences provide students with the opportunity to engage in hands-on learning experiences. This approach allows students to actively explore and manipulate materials, conduct experiments, and make observations.

Example: In a biology class, students may conduct a dissection of a preserved specimen to study the anatomy and structure of organisms. By physically dissecting and examining the different organs and systems, students gain a tangible understanding of the subject matter.

Application of Theory: Practical sciences enable students to apply theoretical knowledge acquired in the classroom to real-world situations. By engaging in practical activities, students can bridge the gap between abstract concepts and their practical applications, fostering a more comprehensive understanding of scientific principles.

Example: In a chemistry class, students might perform experiments to understand chemical reactions and concepts like stoichiometry. By actually mixing and observing different substances, measuring quantities, and analyzing the results, students can see how theoretical concepts translate into practical applications.

Development of Scientific Skills: Practical sciences help students develop essential scientific skills, such as critical thinking, problem-solving, observation, data analysis, and communication. Through practical activities, students learn to formulate hypotheses, design experiments, collect and analyze data, draw conclusions, and communicate their findings effectively.

Example: In a physics class, students could design and conduct an experiment to investigate the relationship between force and motion. By planning the experiment, taking measurements, analyzing the data, and presenting their findings, students enhance their scientific skills and develop a deeper understanding of physics concepts.

Engagement and Motivation: Practical sciences often increase student engagement and motivation in science education. Hands-on activities provide a more interactive and dynamic learning environment, making science more interesting and accessible to students. It can spark curiosity, promote active participation, and cultivate a sense of wonder and excitement about the natural world.

Example: In an environmental science class, students may visit a local ecosystem to conduct field observations, collect samples, and analyze the data they gather. By immersing themselves in the real environment and actively participating in the scientific process, students are more likely to be motivated and engaged in their learning.

To know more about science education:

https://brainly.com/question/28309499

#SPJ1

Which of the following statements is/are true relative to laboratory glassware. (Mark all correct responses)


Some laboratory glassware, such as graduated cylinders and volumetric flasks, are relatively precise and are suitable for accurately measuring volumes in most scientific experiments


Beakers and Erlenmeyer flasks are very handy in the laboratory because they allow for very precise measurement of fluid volumes


One should always use a device which has a total volume close to the volume being measured, for instance, a 10-ml pipette would be suitable for measuring a volume of 8.3 ml.


A fluid volume in a pipette should be read from the bottom of the meniscus, not the top of the meniscus.

Answers

The following statements which are true relative to laboratory glassware include the following below:

Some laboratory glassware, such as graduated cylinders and volumetric flasks, are relatively precise and are suitable for accurately measuring volumes in most scientific experiments.One should always use a device which has a total volume close to the volume being measured, for instance, a 10-ml pipette would be suitable for measuring a volume of 8.3 ml.A fluid volume in a pipette should be read from the bottom of the meniscus, not the top of the meniscus.

What is a Erlenmeyer flask?

This is also known as a conical flask or titration flask and it is a type of laboratory flask which is chiefly used for transport, storage, and mixing. It has a tapered shape which makes it unsuitable for a measuring instrument.

The  fluid volume in a pipette should be read from the bottom of the meniscus, not the top of the meniscus so as to avoid error due to parallax which makes the measurement inaccurate.

Read more about Laboratory glassware here https://brainly.com/question/1553692

#SPJ1

How does eating food benefit an animal

Answers

Answer:

Because it give you energy and some of the food animals eat has protiens in it

Explanation:

Which two parts of the cell are unique to plant cells?

Answers

Answer:

Cell wall, chloroplast, vacuole. Plant cells have a cell wall, chloroplasts and other specialized plastids, and a large central vacuole, whereas animal cells do not.

Explanation:

The main difference between plant cells and animal cells are cell wall and chloroplast , whereas for the vacuole plants have a vacuole called vescile which is not the same as the vacuole in plant cells.

Vacuoles are very large as they are needed to store water and they mostly contain water and sugars . On the other hand, vesicles are small and contain water, nutrients, enzymes, wastes, solution of water or food etc. This is the key difference between vacuoles and vesicles. hope it helps :)


Name two causes of environmental change associated with
residential construction.

Answers

Answer:

Pollution – Construction causes both air and water pollution. Harmful chemicals used during construction can be harmful to both workers and the environment. Waste – The process of constructing new infrastructure produces a lot of waste that ends up in landfills.

Explanation:

9. Javier is a navigator for the navy His ship has just lost all power in the middle of the ocean, including access to your GPS. Which astronomical tool would be MOST helpful in this situation?

Answers

sextant is the correct answer


Muscle contractions occur when myofibrils
in the muscle shorten and lengthen to make
the muscle contract and extend. Which
types of muscles use these muscle
contractions?
All muscle types
Only smooth muscles.

Answers

This type of contraction occurs in all muscle types

Brainliest is appreciated

How do the layers of the atmosphere help to understand better the dynamics of the atmosphere and its relationship to the hydrosphere and lithosphere?

Answers

There are various layers that make up the atmosphere, and each has distinct properties and functions. Both weather generation and energy transmission take place in the troposphere, which is closest to the Earth's surface.

The stratosphere shields the Earth from damaging UV radiation along with the ozone layer. Most auroras happen in the mesosphere, where meteors burn up. Modern technology is dependent on the thermosphere, where the majority of the Earth's satellites orbit and where communication signals are sent.

The dynamics of the atmosphere and its interactions with the hydrosphere and lithosphere are better understood thanks to these layers. Foreseeing and minimising environmental problems like climate change and preserving our world, it is essential to understand the significance of each layer.

Learn more about  atmosphere at:

https://brainly.com/question/26767532

#SPJ1

In tomatoes, red fruit color is dominant to yellow. Round-shaped fruit is dominant to pearshaped fruit. Tall vine is dominant to dwarf vine.
a. Suppose you cross a true-breeding tall plant bearing red round fruit with a true-breeding dwarf plant bearing yellow pear-shaped fruit. Predict the appearance of the generation.
b. Assuming that the genes controlling the three traits are on three different pairs of chromosomes, what are the possible genotypes in the generation?
c. What are the expected phenotypic ratios?

Answers

Answer:

a) Al the offspring will have genotype - TtRrOo

b) Al the offspring will have genotype - TtRrOo

c) Tall, Red and Round

Explanation:

Given -

Red color of fruit is dominant to yellow color of fruit.

Round shape of fruit is dominant to pear shape of fruit

Also, Tall vine is dominant to dwarf vine

Crossing -  true-breeding tall plant bearing red round fruit (TTRROO) * true-breeding dwarf plant bearing yellow pear-shaped fruit (ttrroo)

a) Al the offspring will have genotype - TtRrOo

b) Al the offspring will have genotype - TtRrOo

c) Tall, Red and Round

Other Questions
Due to the potential for inappropriate disclosure of personal information in qualitative studies, protecting the ____________ of participants is especially important.Confidentiality and anonymity Which of the following is not an example of diffusion?A:a drop of food coloring spreading through a glass of waterB:perfume filling a roomC:salt spilled onto the tableD:air leaking from a tire find the period of revolution of a satellite moving in a circular orbit around the earth at a height of 3.6 x 10^6 m above the earths surface. Assume the earth is a uniform sphere of radius 6.4 x 10^6 m. The earths mass 6 x 10^24 kg and G= 6.7 x 10^-11 nm^2 I am looking for 1 on 1 tutoring for the next 6 weeks of classfor managerial finance. what type of developing spiritual wellness includes which intervention relieves integumentary itching, promoting comfort of the client exposed to poison ivy? saline rinse cold therapy heat therapy wet compress Please help me in this. I need to submit it in 1 hour!If Jania puts 12 eggs (y) inside of every carton (x) she sells. Which equation can help Jania find out how many eggs she will sell at the end of each day?A. y=12+xB. y=12xC. y=12+1+xD. y=12+1 (This is about dna)What would the Complimentary DNA strand be for?DNA 5 -CGTATG-3 What type of story would you expect if you saw only the following words:extraterrestrialNazca lines (crop circles)galaxytime travelinvasionrobotsPlease help me I cant go forward without When testing for an association between class level (Freshman, Sophomore, Junior, Senior) and IQ score, which of the following is NOT an appropriate way to write the alternative hypothesis? There is an association between class level and IQ Not all the population 1Q means are the same. At least one of the population IQ means will be different 5. Is the side that is 100 meters long the hypotenuse, opposite or adjacent side? *HypotenuseAdjacentOpposite 120% of the number is 24 What is the number Why was the discovery of DNA structure so important? A bus travels with a constant speed of 48 miles per hour. How long will it take to travel 60 miles? Write your answer as a decimal number ____[hours] Verify the identity by following the steps below sin(z)cot(x) Cos() 1) Write the left-hand side in terms of only sin) and cos) but don't simplify Preview 2) Simplify cos(z) Preview The first stage of demographic transition model is high birth rate and high death rate. what are three ways businesses meet customer needs and wants other than with pricing straiges you have $50 to spend while you're shopping you already spent $28 on clothes which inequality represents how much mire you can spend if you want to have at least $5 leftover? Edge 2022 Cumulative ExamWhat is a criticism of the two-party system?A) It impacts election outcomes by pulling voters from another candidate.B) It favors liberal over conservative ideologies.C) It is too polarizing and limits alternative viewpoints.D) It leads to spoiler candidates. Which text about types of music most clearly uses a topical text structure?A. One that describes types of music based on their country of originB. One that explains how jazz came about in the early 1900sC. One that lists important musicians who play each type of musicD. One that gives the history of music from ancient times to today