HELP PLEASEE
Ardipithecus ramidus had a small, chimpanzee-like body that was adapted to which condition?
the water
the cold
the heat
the trees

Answers

Answer 1
The answer is option D. The trees
Answer 2
The answer is: the trees!

Related Questions

Which of the following statements is true?
Cardiac muscles are only found in the heart.
Red blood cells are produced by bone marrow.
Calcium is an important nutrient for healthy bones.
All of the above

Answers

Answer:

All the above

Explanation:

Cardiac muscle tissue is only found in your heart, where it performs coordinated contractions that allow your heart to pump blood through your circulatory system.

A calcium-rich diet is good for your bones, and calcium helps to build and protect them.

Red blood cells, most white blood cells, and platelets are produced in the bone marrow.

Answer:

Explanation:

All of the above!

Hope it helps ^^

Nematodes are which type of worm?
A. tapeworm
B. roundworm
C. earthworm
D. flatworm

Answers

Answer:

B. roundworm

Explanation:

Answer: Roundworm

Explanation:

The above flowchart traces the energy transformations for the process described in paragraph
three. Which of the choices below, in the order of (1), (2), (3), wi_(1)_energy from the sun II
correctly fill the blanks in the chart?
A.
Heat, Chemical, Light
B.
Heat, Light, Chemical
C.
Light, Chemical, Heat
D.
Chemical, Heat, Light

Answers

d :) have a good day.

Give two possible ways that negative human impact on the pH of Earth’s oceans can be reduced.

Worth: 15 points

Answers

Answer:

There are several ways in which negative human impact on the pH of Earth's oceans can be reduced. Here are two possible approaches:

Reducing carbon dioxide (CO2) emissions: The primary cause of ocean acidification, which lowers the pH of the oceans, is the increased absorption of CO2 from the atmosphere. To address this, it is crucial to reduce carbon dioxide emissions at their source. This can be achieved by transitioning to cleaner and renewable energy sources, promoting energy efficiency, and implementing policies to limit greenhouse gas emissions from industries, transportation, and power generation. By reducing CO2 emissions, we can slow down the rate of ocean acidification.

Promoting sustainable fishing and aquaculture practices: Overfishing and destructive fishing practices can disrupt marine ecosystems and contribute to the decline in ocean health. By promoting sustainable fishing practices, such as implementing fishing quotas, protecting marine reserves, and avoiding the capture of non-target species (bycatch), we can maintain the ecological balance of marine ecosystems. Additionally, supporting responsible and sustainable aquaculture practices that minimize environmental impacts and avoid the use of harmful chemicals can help reduce the negative human impact on ocean pH.

It's important to note that these are just two examples, and addressing ocean acidification requires a multi-faceted approach involving various stakeholders, including governments, industries, scientists, and individuals. Other measures, such as protecting coastal habitats, reducing pollution runoff, and raising awareness about the importance of ocean conservation, can also contribute to mitigating the negative human impact on ocean pH.

Explanation:

Which of the following is not an example of defensive communication?

Answers

The statement that is not an example of defensive communication is “I would love to talk about this with you if you have the time.” That is option C.

What is a defensive communication?

A defensive communication is defined as the type of communication that has the ability to stimulate anxiety and threat in an individual by another person.

Typical examples of defensive communication include the following:

“Why can’t you think about someone else for a change?”"You never listen to me.”"You always do this.”

These statements above are able to trigger anxiety and threat to the person it's been referred to.

Therefore, the statement that is not an example of defensive communication is “I would love to talk about this with you if you have the time.”

Learn more about communication here:

https://brainly.com/question/26152499

#SPJ1

Complete question:

Which of the following is not an example of defensive communication?

Which of the following is not an example of defensive communication?

a.“Why can’t you think about someone else for a change?”

b.“You never listen to me.”

c.“I would love to talk about this with you if you have the time.”

d.“You always do this.”

You do a Gram stain on a known mixed culture and all you see are red-stained bacteria. It had been a long time since you did a Gram stain, and you did not have a written procedure to follow so you may have messed up a step. Choose all of the following scenarios which could be true.
Select one or more:
a. The culture contains only Gram-negative bacteria
b. You may have decolorized too long
c. The culture could contain Stapylococci that are older than 24 hrs
d. You forgot to add iodine

Answers

There are exclusively Gram-negative bacteria present in the culture. Maybe you've been decolorizing too long. The Stapylococci in the culture may be older than 24 hours. You failed to include iodine.

Where can you often find gram-negative bacteria?

Sink drains, refrigerator condensate pans, and other sources of standing water are the principal sources of Gram-negative bacteria contamination in ISO-classified environments.

Gram-negative bacteria: beneficial or harmful?

Gram-negative bacteria (GNB) are among the most serious public health issues in the world because of their high level of antibiotic resistance. Hospitals must take these bacteria seriously because they put patients in the intensive care unit (ICU) at risk and increase morbidity and mortality.

To know more about Gram-negative bacteria visit:

https://brainly.com/question/13756030

#SPJ1

What type of boundary is this?

What type of boundary is this?

Answers

The image represents the continental-continental boundary. When two continental plates collide, that's another kind of convergent plate boundary. The continental lithosphere is very thick and has a low density. The continental lithosphere cannot subduct. So when two mainland plates impact, they simply crush together.

Plate tectonic boundaries come in three varieties: plate boundaries that are transformed, divergent, and convergent. The three primary types of plate boundaries are depicted in this image: transform, convergent and divergent.

Learn more about continental-continental boundaries, here

https://brainly.com/question/2507413

#SPJ1

You are researching an enzymatic protein in the lab and make the following observations. The usual form of the protein is globular (spherical) however, when a sample of the protein is treated with a chemical that reduces disulfide bonds, the rate of enzymatically driven product formation decreases dramatically and multiple globular proteins can be detected in the sample. From these observations you conclude: A. The primary structure of the protein contains multiple cysteine residues that are hydrolyzed by the chemical reductant. B. The protein is most likely composed of multiple polypeptide chains that are held together by disulfide bonds C. The protein is most likely composed of a helices that are held together by disulfide bonds. D. The primary and secondary structure of the protein depends on disulfide bonds. E. None of the provided statements are reasonable conclusions based on the observations,

Answers

Answer:The protein is most likely composed of multiple polypeptide chains that are held together by disulfide bonds

Explanation:

The Disulfide bonds in protein membranes are usually seen in bacteria and eukaryotes.

Answer:

Option B

Explanation:

Since the usual shape of the protein is supposed to be globular and even after treatment, it still produces the same globular proteins despite the reduction of its disulphide bonds.

The disulphide bonds should have disrupted the shape formation if it had been a mechanism for its shape formation but since multiple globular polypeptide resulted from the treatment it can be assumed that the multiple polypeptide chains are held together by disulfide bonds which are hydrolyzed by the chemical.

what is the difference between photosynthesis and respiration


for friendly purpose only ​

Answers

Answer:

photosynthesis utilizes carbon dioxide and water in the presence of light to produce glucose and oxygen, whereas respiration uses oxygen and glucose to power the activities of the cell.

What are the seven 7 levels of
classification?

Answers

Answer:

from largest to smallest the 7 levels of classification are: Kingdom, Phylum, Class, Order, Family, Genus, Species

Explanation:

^

what are the different characteristics of a single celled organism.

Answers

Answer:

Single-celled organisms are able to carry out all the processes of life without help from other cells

Use the skills to identify and describe evidence to support the idea that evolutionary relationships can be inferred through the comparison of anatomical structures to support which modern organism is most closely related to the tapir.

A: Evidence. List information from the skulls that you could use as support for the claim you identified in question 2.

(second image is question 2)
B: Reasoning. Use the evidence you listed above to write out a detailed argument in support of the claim answering the question, “which organism is most closely related to the tapir”. Remember that you are supporting the overall idea that evolutionarily relationships can be inferred through the comparison of the anatomical structures and traits.

Use the skills to identify and describe evidence to support the idea that evolutionary relationships
Use the skills to identify and describe evidence to support the idea that evolutionary relationships

Answers

Answer:

evidence towards the tapir

Explanation:

since a xray is required to abduct inffared images and structures of the tapir, you need comical evidence to use towards the tapir.

The shape of cells doesn't matter when it comes to doing their jobs.

True
False?

Answers

Answer:

true, because there are the basis of life

True it’s not false cause I took the quiz


Based on the SCIENTIFIC EVIDENCE, life on earth:

1) has always been about the same as it is now

2) started out simple and has gotten more complicated and diverse

3) began with members of all domains

4) soon after Earth's formation

Answers

Answer:

2) started out simple and has gitten more complicated and diverse.

2) is correct, or Life on earth started out simple and has gotten more complicated and diverse. This is like a Big Bang question, where the earth had its origins, then constantly began expansion at a rapid pace. As we speak, galaxies are transitioning farther and farther from each other.

Local tropical ranforest and tundra in both Figure 1 and Figure 3. Describe the generalclimate and global location of both biomes.

Answers

Tropical rainforest are places with heavy precipitation loads, along high primary productivity, high arboreal density and high temperatures. They are around the tropics, from the earth's equator to the Cancer and Capricorn's tropics. On the other hand, Tundra is a cold, dry biome. With very low productivity and few plant density. It is located in the northern latitudes, just before the arctic. Tundra's distribution is ring-like, around the North Pole.

Important of studying zoology in Forestry​

Answers

Zoology makes a huge impact on our world through the scientific study of the evolution, anatomy, physiology, behavior, habitats, and health of animals and humans. It includes diverse approaches such as electron microscopy, molecular genetics, and field ecology.

Each of the following statements is either true or false.
1. The microscope lens may be cleaned with any soft tissue.
A. True
B. False
2. The microscope should be stored with the ail immersion lens in position over the stage.
A. True
B. False
3. When beginning to focus, use the ssanning objective lens.
A. True
B. False
4. When focusing on high power, always use the coarse adjustment knob to focus.
A. True
B. False
5. A coverslip should always be used with wet mounts.
A. True
B. False

Answers

Answer:

1.false.

There are special lense tissues for this which will not scratch the lense so that  the focal power will nit be affected. Grit -free lens paper,Kimwipes or Kodak lens are ideal cleaning  materials.

2.This is also false. Microscope should be covered with dust cover, and even in the cabinet,It should never be left without am eyepiece.

3.True.

This gives he lowest magnification, which allows for wide view of the specimen in order get the specific spot to focus on.It has  magnification power  of 10x eyepiece  lens.Thus a 4x scanning objective lens therefore  gives  total magnification of 40x.

4.False,

This will break the objective lens.Fine adjustment knob should be use.This will gives the sharpest focus,using a coarse knob will crack the lens because the working distance for focusing will be too small, and suing this will damage the objective lens,

5.False,only the wet mount should be used.High power and oil lens should not be used as this will reduce the efficiency of the microscope.

an introduction of a new food resource into the environment may cause a new species to appear. an introduction of a new species of predator may cause the evolution of new defenses in some prey species. a predator not eating a bright colored prey again because the previous time the taste was unpleasant. an increase in temperature may select against cold-adapted genotypes. an increase in a population of one species may case the extension of another species with the same food ration.

Answers

Examples that support my reasoning are:

An increase in temperature may select against cold-adapted genotypes.A predator not eating a bright colored prey again because the previous time the taste was unpleasant.An introduction of a new food resource into the environment may cause a new species to appear.An introduction of a new species of predator may cause the evolution of new defenses in some prey species.

The answer is A, B, D and E.

Evolution is the process by which species adapt to their environment in order to survive and reproduce. Changes in an organism’s environment can select for or against certain traits, which can lead to changes in the organism’s phenotype (visible characteristics) over time. These changes help the organism to survive and reproduce in its new environment.

Choose examples to support your reasoning. Select all that apply:

A) An increase in temperature may select against cold-adapted genotypes.

B) A predator not eating a bright colored prey again because the previous time the taste was unpleasant.

C) An increase in a population of one species may case the extension of another species with the same food ration.

D) An introduction of a new food resource into the environment may cause a new species to appear.

E) An introduction of a new species of predator may cause the evolution of new defenses in some prey species.

Learn more the Evolution:

https://brainly.com/question/27748371

#SPJ4

an introduction of a new food resource into the environment may cause a new species to appear. an introduction

Exept from plants,what are the other organisms able to produce oxygen?

Answers

Answer:

The answer is tiny organisms known as cyanobacteria, or blue-green algae. These microbes conduct photosynthesis: using sunshine, water and carbon dioxide to produce carbohydrates and, yes, oxygen.

Explanation:

Is precipitation abiotic or biotic

Answers

Answer:

abiotic

Explanation:

Biotic- Living things

Abiotic- Nonliving things

Precipitation- Rain, snow, sleet, hail, etc.

Rain, snow, sleet, hail are not living things or biotic because they dont move, or do anythings that humans or plants or animals do. Instead, they are abiotic or nonliving things!

match each virtualization component on the left with the appropriate description on the right. each type of component may be used once, more than once, or not at all.

Answers

The matching of the virtualization component with respect to the appropriate description is as follows:

The virtual machine completely simulates a physical computer system: Full virtualization. Operating systems do not need modification to run within virtual machines: Full virtualization. Only some of the components of a virtual machine are virtualized: Partial virtualization. Guest operating systems directly access hardware resources in the hypervisor host system: Partial virtualization.

What is Full virtualization?

Full virtualization may be defined as a type of virtualization technique that is significantly utilized in order to provide a VME that completely simulates the underlying hardware. This allows most OS and applications to run in virtual machines without modifying them in any way.

Partial virtualization involves some components of the virtual machine being virtualized. The OS uses some virtual components and some real physical hardware components on the actual device running the hypervisor.

To learn more about Virtualization, refer to the link:

https://brainly.com/question/23372768

#SPJ1

In Yellowstone National Park, grizzly bears and wolves are both top predators in the ecosystem. Grizzly bears eat plants as well as fish, elk, and bison. Wolves only eat meat and will hunt in packs to kill moose, elk, and other deer. How would you classify the relationship between bears and wolves?

Answers

Wolves facilitate hunting opportunities for bears, but bears modify the predatory behavior of wolves in several ways, making them primarily hostile to wolves. So the relationship between bears and wolves is of competition.

Describe interference and exploitative competition among apex predators?

Competition is a fundamental ecological concept that drives everything from long-term evolutionary processes and large-scale community structures to real-time individual behavior.

Brown bears (Ursus arctos) and gray wolves (Canis lupus) are the two most widespread apex predators in the northern hemisphere (Ordiz, Krofel, et al., 2020). Recent studies have shown that sympathizing with bears reduces wolf kill rates (i.e., increases the time between kills) (Tallian, Ordiz, et al., 2017). However, the mechanisms that cause changes in wolf predatory dynamics remain. Unknown if bears are present. Existence. Here we use GPS-derived migration and predation data of wolves and data describing the presence of brown bears from two long-term research projects in Europe (Scandinavia) and North America (Yellowstone National Park, USA). and the role of intervention and exploitative competition with brown bears on the predatory behavior of wolves.

We assessed how the presence of bears affected foraging and processing times in wolves during two seasons with different potential interspecies interactions.

To know more about Competition, visit:

https://brainly.com/question/28062759

#SPJ1

Translate the DNA, mRNA, amino acid shown in picture (DNA sample)

DNA:
mRNA:
amino acid:

TACGCCTTTACT TACTCGTCAATT TACCCGACGACCACT TACTACTAGATC TACCACCACACT TACTCATCGATC TACTGGTAAGTAACT TACTTTCAGGGTACT

Translate the DNA, mRNA, amino acid shown in picture (DNA sample)DNA: mRNA: amino acid:TACGCCTTTACT TACTCGTCAATT

Answers

DNA: DNA stands for Deoxyribonucleic Acid, which is a molecule that contains the genetic instructions for the development, functioning, and reproduction of all living organisms.

It is a long, double-stranded molecule made up of four types of nucleotides: adenine (A), thymine (T), guanine (G), and cytosine (C).

TACGCCTTTACTTACTCGTCAATTTACCCGACGACCACTTACTACTAGATCTACCACCACACTTACTCATCGATCTACTGGTAAGTAACTTACTTTCAGGGTACT

mRNA:

mRNA stands for Messenger Ribonucleic Acid, which is a type of RNA molecule that carries the genetic information from DNA to the ribosomes, where it serves as a template for protein synthesis.

mRNA is synthesized through a process called transcription.

AUGCGGAAAUGAAUGAGCAGUAAAUUGGGCUGUGCUGGUGAAUGAUGGUGGUGUGAUGAGUAGUAGGUGGUAGAUGAUGACCAUUCACCCAUUGAGUCA

Amino acid:

Amino acids are the building blocks of proteins. They are organic compounds made up of an amino group (-NH2), a carboxyl group (-COOH), and a side chain that is specific to each amino acid. There are 20 different amino acids that are commonly found in proteins, each with a different side chain that gives it unique properties.

Met-Arg-Lys-Asp-Arg-Gln-Stop-Leu-Gly-Leu-Cys-Trp-Val-Asn-Asp-Val-Val-Val-Asp-Ser-Val-Gly-Asp-Met-Leu-Pro-Leu-Glu-Ser

To know more about amino acid, visit :

https://brainly.com/question/14583479

#SPJ1

A week bond between two hydrogen molecules;found between water molecules and nucleotides in DNA

Answers

Answer:The weak bond between two hydrogen atoms, which is commonly found between water molecules and nucleotides in DNA, is called a hydrogen bond.

Explanation:

Answer: Hydrogen Bond

Explanation:

Normally, igneous and metamorphic rock
are great materials from which to form aquifers.
are found throughout the United States.
are impermeable to water flow.
are very porous.

Answers

Answer: Impermeable to water flow

Explanation:

Describe the steps of a muscle contraction.

Answers

(1) A message travels from the nervous system to the muscular system, triggering chemical reactions.

(2) The chemical reactions lead to the muscle fibers reorganizing themselves in a way that shortens the muscle--that’s the contraction.

(3) When the nervous system signal is no longer present, the chemical process reverses, and the muscle fibers rearrange again and the muscle relaxes.

what is biology ? definition of biology ​

Answers

Biology is the scientific study of life and living organisms, including their physical structure, chemical processes, molecular interactions, physiological mechanisms, development, and evolution. It is a natural science that seeks to understand the characteristics, behaviors, and interactions of all living things, from the smallest microorganisms to the largest animals and plants. The study of biology encompasses a wide range of topics, including genetics, ecology, physiology, microbiology, biochemistry, and many others. The ultimate goal of biology is to understand the fundamental principles and processes that underlie life, as well as to use this knowledge to address real-world problems and improve human well-being.

Answer:

The study of living organisms divided into many specialized fields that cover their morphology physiology anatomy behavior origin and distribution

An unknown organism is found in the forest and the gene is sequenced as follows:

Unknown: C C A T G G A A T C G A

What kind of an animal do you think this is? Explain why:

Answers

Answer:

I beleive its somthing close to a  pig

Explanation:

The DNA sequence is closest to the pig . The amino acids Gly, Thr, Leu, and Ala are from the "unknown animal." On the worksheet, the pigs amino acids are Gly, Thr, Phe, and Ala. There is only one different amino acid between the two.

I might be wrong but there u go

Select all the correct answers.
Which organs perform both mechanical digestion and chemical digestion of food?

mouth
pancreas
small intestine
stomach

Answers

Answer: Mouth and Stomach are the correct answers.

Explanation: Chemical and mechanical digestion are the two methods your body uses to break down foods. Mechanical digestion involves physical movement to make foods smaller. Chemical digestion uses enzymes to break down food.

Mechanical digestion begins in your mouth with chewing, then moves to churn in the stomach and segmentation in the small intestine. Chemical digestion involves the secretions of enzymes throughout your digestive tract.

Once food particles reach your small intestine, the intestines continue to move. This helps keep food particles moving and exposes more of them to digestive enzymes. These movements also help to move the digested food toward the large intestine for eventual excretion.

To learn more about the Organs which perform the digestion of food,

https://brainly.in/question/6280786

What would happen to the concentrations of Pyruvate, NADH and intermembrane H+ if the ETC stopped working?

Answers

Answer:

"Proton decreases" would be the right approach.

Explanation:

The Kreb cycle or system plays a key role throughout a matrix of mitochondria. 3 NADH, 2 FADH2 as well as 1 ATP are synthesized. Whenever the Kreb process has been halted, the acetyl CoA throughout the Kreb cycle has not been used. Pyruvate doesn't at all, disintegrate via acetyl CoA. Therefore in cells, pyruvate accumulates. Unless the Kreb loop is halted, therefore the concentration of NADH and FADH2 declines.

Thus, they aren't used for the transportation chain of electrons. This is also why protons have not been discovered to be injected towards intermembrane space.

Other Questions
What is the radius of a sphere with a volume of 7961 cm", to the nearest tenth of acentimeter? Where did the first civilization of India arise A.along the Ganges RiverB.along the Indus and Sarasvati riversC.near the coast of the subcontinentD.on the central plateau HELP PLS ALL QUESTIONS GIVING BRAINLIEST! what is the neuromuscular junction? multiple choice question. it is where the synaptic bulb attached to the t-tubule. it is the site in the spinal cord where nerve impulses from the somatic receptors are received. it is the passageway into the muscle group for arteries and veins. it is the site where the nerve fiber innervates the muscle fiber. Why do large areas of water change how the wind blows?Lesson 1.03Question 5 options:water changes temperature slowlywater changes temperature quicklywater has no impact on weather Convert the heat of neutralization of acetic acid from -49,8 kj/mmol to calories permillimole and ROUND TO ONE DECIMAL PLACE (1 cal = 4.184 J)DO NOT INCLUDE UNITS The standard deviation of a sample of 100 elements taken from a very large population is determined to be 60. The variance of the populationa) can not be larger than 60b) can not be larger than 3600.c.must be at least 100.d.can be any value greater or equal to zero. What 2 numbers multiply to make -30 and combine to make -7? _____ and ____ the idea that a consumer is limited to selecting a bundle of goods that is affordable is captured by the multiple choice indifference curve. price changes. consumer equilibrium. budget constraint. the pillsbury doughboy and the jolly green giant are examples of ________. what did the tea act allow Study island 7th grade What are the organization levels in living beings and how these levels are related with homeostasis? The evidence of Evolution are.... bir bidonun 2/7 si dolu iken iinde 4 litre su bulunuyor bidon ka litre su alr Find the area of the parallelogram shown below.36square unitsStuc. TAI in business, what is the management framework within which decisions are made and accountability is determined? When a software program is purchased, the buyer is acquiring a(n) ____ that permits him or her to use the software. You spin the spinner once. Find the theoretical probability of the event. *show your work* Cmo se dice "crash" en espaol?I