Answer:
B or A I think B
SER
Which of the following is not a contributing factor to environmental policy decisions?
a. human health
b. availability of natural resources
environmental health
d. none of the above
C.
Please select the best answer from the choices provided
Оооо
Answer:
D. None of the above
Explanation:
I took the quiz.
Answer:
It's D. None of the above
Explanation: hope it helps ^w^
Describe the life cycle of a pine tree.
Answer:
The life cycle of a pine tree, like most coniferous trees, goes through several stages:
Seed Germination: The life cycle of a pine tree begins with the germination of a pine seed, stored in a cone. When favorable conditions, such as moisture and warmth, are present, the seed germinates, and a new pine seedling emerges.
Seedling Stage: The germinated seed develops into a seedling, with a single stem or shoot with a few small, needle-like leaves called cotyledons. The seedling relies on stored nutrients within the seed until it develops its own root system for nutrient uptake.
Sapling Stage: During this stage, the pine tree develops more branches and foliage. The sapling continues to grow in height and expands its root system to access water and nutrients from the soil.
Maturation and Reproduction: As the pine tree reaches maturity, it enters the reproductive stage. This typically occurs when the tree is around 10 to 20 years old, but it varies depending on the pine species. The pine tree produces cones, which contain the reproductive structures. Male cones release pollen, which is carried by wind to female cones for fertilization. Fertilized female cones develop seeds within them.
Cone Development and Seed Dispersal: The fertilized female cones undergo maturation and development. This process can take several months to years, depending on the species. Once mature, the cones open, releasing the seeds, which are dispersed by wind or animals.
Senescence and Regeneration: After seed dispersal, the pine tree enters a phase of senescence, or decline. This stage can span many years or even decades, depending on the lifespan of the pine species. The tree's growth slows, and its overall health deteriorates. Eventually, the tree dies, either naturally or due to environmental factors, making way for new seedlings to grow in the surrounding area and continue the cycle.
Explanation:
Can you list more than four traits that are inherited in plants?
Answer:
flower color, flower position, seed color, seed shape, seed pod shape, pod color, leaf pattern, and stem length.
Explanation:
Some common inherited characteristics
what usually accompanies a cold spell in minnesota?
In Part 3 of this field study, you determined percentages of land use around your home. Would you describe the area in your study as diverse? Support your answer with your data and submit your data table.
Answer:
Please see below
Explanation:
The supporting data has been organized in a table and attached as an image herein. As can be clearly seen from the data table, the zones under study are nothing alike. The home area is mostly for residential use and gives the greatest percentage for being used for housing purposes. However, the Mount Pinatubo area is mostly being for vegetation.
ATP can be produced via two cellular respiration pathways. one that occurs in the presence of oxygen and one that occurs in its absence. Name and explain how these two mechanisms differ.
Aerobic and anaerobic respiration are the two different types of cellular respiration processes that are used to produce ATP.
ATP (adenosine triphosphate) is a molecule used by cells for energy storage and transfer. Two types of cellular respiration pathways are present for ATP production: aerobic respiration and anaerobic respiration. The primary difference between these two is the presence of oxygen.ATP production during aerobic respiration occurs in the presence of oxygen. This process occurs in three stages: glycolysis, the Krebs cycle, and oxidative phosphorylation. In the first stage, glucose is broken down into pyruvate, which is then moved to the mitochondria in the second stage, the Krebs cycle, where it is further processed. The last stage is oxidative phosphorylation, in which the electron transport chain and chemiosmosis use the energy generated to create ATP.Anaerobic respiration occurs in the absence of oxygen, and it is a less efficient method of ATP production. Anaerobic respiration begins with glycolysis, the same as aerobic respiration. Instead of moving to the Krebs cycle, pyruvate is transformed into lactate or ethanol. These pathways are not as effective at producing ATP, but they can supply ATP during periods of low oxygen. In summary, the main difference between these two pathways is the presence or absence of oxygen during the process.For more questions on adenosine triphosphate
https://brainly.com/question/897553
#SPJ8
Help (Brainliest!) (19 POINTS!!!)
Answer:
The fourth one
Explanation:
3. Critique At lunch, your friend stated that her
apple was a living thing, because if she put a
piece under the microscope, she'd see cells.
How will you respond?
I would respond by acknowledging that indeed an apple does have cells, but that does not necessarily make it a living thing. While it is true that living things have cells, there are other criteria that must be met in order for something to be considered living.
Living things are characterized by their ability to grow, reproduce, respond to stimuli, and maintain homeostasis. An apple, on the other hand, does not have the ability to do any of these things. It cannot grow or reproduce, nor can it respond to stimuli or maintain homeostasis.
Additionally, while an apple does contain living cells, those cells are not actively carrying out the functions necessary for life. They are essentially in a state of suspended animation until the apple begins to decompose.
Overall, while it is understandable that someone might assume an apple is a living thing due to the presence of cells, a more comprehensive understanding of what constitutes life would lead one to conclude otherwise.
What do all signals that are used to communicate have in common?
There’s a second part to this guys I just posted it so look at that but we have to use this photo and find a pic online so we can asses the biodiversity of the selected environment in different ways
Assessing biodiversity of a selected environment can be done in various ways, including species richness, habitat, genetic and functional diversities among others.
What is biodiversity?Biodiversity is the variety and variability of life on Earth, including the diversity of species, ecosystems, and genetic variation within species.
Various ways to assess the biodiversity of a selected environment are:
Species richness and diversity: The number of different species present in an environment can indicate its level of biodiversity. A high species richness and diversity suggests a healthy ecosystem with many interdependent relationships between organisms.Habitat diversity: The range of different habitats in an environment can also indicate biodiversity. Different habitats support different species and can be used to measure the range of biodiversity in an area.Genetic diversity: Genetic variation within a species can be an indicator of biodiversity, as genetic diversity is important for adaptation and survival in changing environments.Functional diversity: This refers to the range of ecological roles and functions that different species perform in an environment. A higher functional diversity indicates a more resilient ecosystem.To find out more about biodiversity, visit:
https://brainly.com/question/13073382
#SPJ1
Which of the following is the best explanation in how the lac operon in E. coli bacteria functions in the absence of lactose?
The image provided shows a schematic diagram of the lactose operon, which is a system of genes involved in the metabolism of lactose in bacteria.
What happen in the absence of lactose?In the absence of lactose, the repressor protein is active and can bind to the operator region of the DNA, preventing RNA polymerase from transcribing the genes involved in the metabolism of lactose.
What is lac operon in E?Therefore, the best explanation of how the lac operon in E. coli bacteria functions in the absence of lactose is that the repressor protein is active and binds to the operator region of the DNA, preventing RNA polymerase from transcribing the genes involved in the metabolism of lactose. This ensures that the bacteria only produce the necessary enzymes to metabolize lactose when it is present in the environment.
To know more about lactose operon visit:-
brainly.com/question/13740993
#SPJ1
Classify each cell as haploid or diploid. 1. microspore:
2. first polar body:
3. spermatid:
4. ovum:
5. secondary oocyte:
6. primary spermatocyte:
7. microsporocyte:
8. oogonium:
9. megaspore:
10. spermatogonium:
Answer:
microspore: haploid
2. first polar body: haploid
3. spermatid: haploid
4. ovum: haploid
5. secondary oocyte: haploid
6. primary spermatocyte: diploid
7. microsporocyte: diploid
8. oogonium: diploid
9. megaspore: haploid
10. spermatogonium: diploid
Your answer
Explanation:
1. Microspore is a haploid spore produced by mostly ferns. They give rise to male gametophytes, which in turn produces sperm cell.
2. Polar body is one of the haploid cells that forms during the process of oogenesis (gametogenesis), specifically when the primary oocyte undergoes an unequal division.
3. A spermatid is an haploid cell that arises from the second meiotic division of the spermatogonia.
4. The ovum is the female gamete of most sexual reproducing organisms. It is also called the EGG CELL. It is haploid.
5. Secondary oocyte are haploid cells that results from the meiotic division of the primary oocyte.
6. Primary oocyte is the diploid cell that starts the meiotic division during oogenesis. It arises from the mitotic division of the oogonium.
7. The microsporocyte is the diploid cell that undergoes meiotic division to produce microspores in ferns and other land plants.
8. Oogonium are the diploid stem cells that initially starts the oogenesis process. It undergoes mitosis to form the primary oocyte, which divides meiotically till the ovum is formed.
9. Megaspore is a haploid spore that gives rise/germinates to the female gametophyte in ferns. The female gametophyte produces the haploid eggs.
10. Spermatogonium are undifferentiated stem cells that produces the sperm cells in males via the process of spermatogenesis. The spermatogonia is diploid in nature
when on enzyme is subject to excess heat
Answer:
Enzymes rely on molecular movement and collisions with the compounds they are meant to bind with -- called substrates -- so they can speed up certain chemical reactions. Increases in temperature increase molecular activity, and can result in a higher rate of collisions between enzymes and substrates. If the temperature rises too high, however, the enzymes could become denatured, and the positive effects of the temperature increase could be nullified.
Explanation:
Many enzymes lose function at lower and higher temperatures. At higher temperatures, an enzyme's shape deteriorates. Only when the temperature comes back to normal does the enzyme regain its shape and normal activity unless the temperature was so high that it caused irreversible damage.
Where does the exchange of oxygen and carbon dioxide?
The exchange of oxygen and carbon dioxide occurs in the alveoli of the lungs.
What is gas exchange?Oxygen and carbon dioxide are transferred between the circulation and the lungs through a process called gas exchange.
The oxygen in the lungs is transferred to the bloodstream during gas exchange. During this process, carbon dioxide travels from the blood to the lungs. This occurs in the lungs between the alveoli and a collection of microscopic blood vessels known as capillaries that are found inside the alveolar walls.
Learn more about gaseous exchange at: https://brainly.com/question/17920029
#SPJ1
identify whether cd4 t cells, cd8 t cells, and/or b cells are responsible for autoimmune disease.
All the CD4+ T cells, CD8+ T cells, and B cells are responsible for autoimmune diseases.
Autoimmune disorders are the diseases wherein the body's defense system attacks its own normal cells due to the inability to distinguish between the natural cells and foreign particles that enter inside the body. In general, all persistent autoimmunity is due to the breach in T helper cells tolerance because these cells aid in CD8 (MHC Class I) activation and antibody/B cell activation. Myasthenia gravis, Addison disease and Hashimoto thyroiditis are some examples of autoimmune diseases. CD8+ T cells play a regulatory role in autoimmune disease. CD4+ T cells are the memory cells which play a pivotal role in defending the body against pathogens.
Learn more about autoimmune diseases at:
brainly.com/question/18733724
#SPJ4
Mendel found that the allele for tallness in plants (T) is dominant to the allele for shortness (t). What would possible results be if a heterozygous plant self-fertilizes?
_____ x _____
genotypic ratio: ____ : ____ : ____
phenotypic ratio: ____ : ____
What is the probability of having a homozygous tall plant? _____
When a plant self-fertilizes, is there still genetic variation between offspring and parent? ________
If a heterozygous plant self-fertilizes, the possible results are that the offspring will be either homozygous dominant (TT), heterozygous (Tt), or homozygous recessive (tt).
The genotypic ratio for the offspring of a heterozygous plant that self-fertilizes is 1:2:1, meaning that there is a 1 in 4 (25%) chance that the offspring will be homozygous dominant (TT), a 2 in 4 (50%) chance that the offspring will be heterozygous (Tt), and a 1 in 4 (25%) chance that the offspring will be homozygous recessive (tt).
The phenotypic ratio for the offspring of a heterozygous plant that self-fertilizes is 3:1, meaning that there is a 3 in 4 (75%) chance that the offspring will have the dominant trait (tallness) and a 1 in 4 (25%) chance that the offspring will have the recessive trait (shortness).
The probability of having a homozygous tall plant is 1 in 4 (25%) if a heterozygous plant self-fertilizes.
Even when a plant self-fertilizes, there is still genetic variation between the offspring and the parent. This is because self-fertilization only involves the mixing of the genes that are present in the parent plant, and it does not create new genetic variation. Therefore, the offspring of a plant that self-fertilizes will have the same genetic variation as the parent plant, but the specific combination of genes in each individual offspring may be different from the parent.
Match the type of reproductive isolation with the example that describes it. Some types of isolation do not have a matching example.
a. Gametic isolation
b. Mechanical isolation
c. Hybrid sterility
d. Zygote death
e. Hybrid performance
f. Ecological isolation
g. Behavioral isolation
1. Two lizards from different islands mate together to produce offspring with patchy scales that dehydrate very quickly.
2. A coral egg fertilized by the sperm of another coral does not reach the larval stage.
3. During mass spawning events, multiple species of coral release sperm and eggs that cannot fuse.
4. One coral spawns in the morning and the other spawns in the evening.
5. Lizards on different islands attract mates with up-and-down head bobs or side-to- side head bobs.
Answer:
1. e. Hybrid performance
2. d. Zygote death
3. a. Gametic isolation
4. f. Ecological isolation
5. g. Behavioral isolation
Explanation:
Hybrid performance is a postzygotic isolation mechanism associated with the ability to produce hybrid offspring, which are adaptively less fit than their progenitors (for example, in this case, hydric stress is a limiting factor for the viability of the hybrids). Zygote death is another postzygotic barrier where the zygote parents' genes fight one another and thus impair the development of the hybrid zygote, causing its death. Gametic isolation is a prezygotic isolation mechanism associated with the incompatibility between female and male gametes (i.e., egg and sperm in animals), which join to form a viable zygote. Ecological isolation, also known as habitat isolation, is a reproductive prezygotic barrier caused by the separation of organisms because they live in different areas or have different ecological/ environmental requirements. Finally, behavioral is another prezygotic barrier where closely related species have different mating rituals. Behavioral isolation is a common practice in many species of invertebrates (such as, for example, arachnids).
What is the law of hydrodynamics?
Answer:
The law of hydrodynamics is a fundamental principle of fluid dynamics that describes the behavior of fluids in motion, particularly liquids and gases. It is also known as the principle of continuity or the law of conservation of mass.
Explanation:
In your own words***Do you think there may be other effects besides deforestation caused by the human activities listed in the photo?
The cited human activities summarize well the anthropological causes of the deforestation process, covering extractive, illegal, and urban sprawl practices.
Suppose a scientist measures the amount of DNA per cell of a particular diploid species at various stages of meiosis. She finds that the meiotic cells contain 3.7 pg, 7.3 pg, or 14.6 pg of DNA. Match each stage of the cell cycle to the corresponding amount of DNA contained within a cell at that stage.
Answer:
search sailesh xettri on messenger
Explanation:
bike guy
Please select the word from the list that best fits the definition
help relieve the symptoms of a viral infection
genetic material
active
inactive
vaccines
over-the-counter medications
ability to multiply
Answer: vaccines
Explanation:
Vaccines refer to biological preparation
which helps in the provision of immunity to a certain infectious disease.
Vaccines help relieve the symptoms of a viral infection. Vaccines help in the stimulation of the immune system of a person and this helps in producing immunity to a particular disease, and hence protects the individual from the disease. It should be noted that vaccines are typically given through needle injections.
what is this called the last choice is meiosis
Answer:
b binary fission
Explanation:
Although Jean-Baptiste Lamarck's theory of transformation proved to be incorrect, he contributed some important ideas to the study of evolution. Which of the following statements are Lamarck's ideas? Choose the two statements that apply.
A. Similar animals originate from a common ancestor
B. Evolution takes place by small, gradual steps
C. Some organisms lived in ancient times, but they no longer exist today
D.Processes that made land features in the past are still in action today.
E.Simple organisms can develop into more complex organisms over many generations
Answer:
B. Evolution takes place by small, gradual steps. E. Simple organisms can developed into more complex organisms over many generations.
Lamarck's theory of Evolution states that evolution takes place by small, gradual steps.
What was Lamarck's theory of Evolution?Lamarck's theory of Evolution states that evolution takes place by gradual steps where traits acquired by parents ate transferred to offspring.
Lamarck's theory of Evolution was called the theory of the use and disuse of body parts.
Therefore, Lamarck's theory of Evolution states that eolution takes place by small, gradual steps.
Learn more about Lamarck's theory of Evolution at: https://brainly.com/question/2398051
#SPJ2
Which of the following describes a change in a biotic factor that will be a disadvantage for a certain species of fish living around coral reefs in shallow seas?
A decrease in the number of small invertebrates that serve as prey for the fish would be a disadvantage for the certain species of fish living around coral reefs in shallow seas.
Option (D) is correct.
Biotic factors are living factors that affect an organism's ability to survive in an ecosystem. In this scenario, we are looking for a change in a biotic factor that will be a disadvantage for a certain species of fish living around coral reefs in shallow seas.
Option A states an increase in the availability of food for the fish, which would be an advantage rather than a disadvantage for the fish. Option B states a decrease in the number of predators that prey on the fish, which would also be an advantage rather than a disadvantage for the fish. Option C states an increase in the number of fish of the same species, which could lead to competition for resources, but may not necessarily be a disadvantage.
Option D, on the other hand, describes a decrease in the number of small invertebrates that serve as prey for the fish. This would be a disadvantage for the fish as they rely on these small invertebrates as a source of food. A decrease in the number of prey would lead to a decrease in the fish population as well, as they struggle to find enough food to survive.
Therefore, the correct answer is D) A decrease in the number of small invertebrates that serve as prey for the fish.
To learn more about invertebrates here
https://brainly.com/question/13285943
#SPJ1
The question is incomplete. the complete question is:
Which of the following describes a change in a biotic factor that will be a disadvantage for a certain species of fish living around coral reefs in shallow seas?
A) An increase in the availability of food for the fish
B) A decrease in the number of predators that prey on the fish
C) An increase in the number of fish of the same species
D) A decrease in the number of small invertebrates that serve as prey for the fish
Jamal investigates several interactions among organisms in a woodland ecosystem. He observes that coyotes hunt and kill white-tailed deer. He learns that lungworms live in the lungs of the deer, making it difficult for the deer to breathe. He also learns that larvae of nasal bot flies live in the nasal passages of the deer and cause them minor harm.
Which of the following relationships are examples of parasitism? Choose the two that apply.
A. coyote and deer
Answer:
The correct answers are B and D...
Good Luck!!
4. Synthesis of an mRNA molecule from a DNA template
a. Transcription
b. Translation
C.DNA Replication
d. RNA polymerase
The synthesis of an mRNA molecule from a DNA template is called transcription. Therefore, option A is correct.
It is a biological process in which genetic information encoded in DNA is converted into RNA molecules. It is a fundamental step in gene expression and is essential for protein synthesis.
During transcription, an enzyme called RNA polymerase binds to a specific region of DNA called the promoter, which signals the start of a gene. The RNA polymerase unwinds and separates the DNA strands, exposing the template strand. The template strand serves as a guide for synthesizing a complementary RNA molecule.
Learn more about transcription, here:
https://brainly.com/question/6604811
#SPJ1
Sustainability is defined as the ability of an ecosystem to survive over time. How does biodiversity affect the sustainability of an ecosystem?.
the increase of algae in a body of water
due to fertilizer runoff is called
O reclamation
O desertification
O eutrophication
O preservation
What is the mRNA sequence that would be made from the following DNA template sequence as a result of transcription?
AGGCATTGGCAATCATGTCAT
The mRNA sequence resulting from the given DNA template sequence AGGCATTGGCAATCATGTCAT is UCCGUAACCGUUAGUACAGUA.
To decide the mRNA grouping coming about because of record, we want to supplant the DNA bases with their comparing RNA bases. In DNA, adenine (A) matches with thymine (T), while cytosine (C) matches with guanine (G). In any case, in RNA, uracil (U) replaces thymine.
The given DNA layout arrangement is AGGCATTGGCAATCATGTCAT. To decipher this into mRNA, we supplant every DNA base as follows: A becomes U, G stays as G, C becomes G, and T turns into A. In this way, the relating mRNA grouping is UCCGUAACCGUUAGUACAGUA.
In rundown, the mRNA grouping coming about because of the given DNA layout arrangement is UCCGUAACCGUUAGUACAGUA.
To learn more about mRNA sequence, refer:
https://brainly.com/question/1129567
#SPJ1
In his study of pea plants , Gregor Mendel used which method to produce offspring?
Answer:
hope it helped
Explanation:
Gregor Mendel is known for his study on pea plants about the inheritance.
To understand the inheritance, he had experimented with pea plants.
He had performed a cross-pollination production method between two different plants of the pea and prevented self-pollination in it.