The best choice is B. In contrast to homoplastic qualities, homologous traits are transmitted from a shared ancestor.
A homoplastic structure is what?On the other hand, many structures that appear to be identical have very distinct evolutionary antecedents. These are referred to as homologous or homoplastic structures because they have evolved to have the same or a similar function while having different origins.
How can you tell whether two traits are homologous?A characteristic is referred to as homologous when it was existent in the ancestor species. A characteristic is said to have arisen through evolutionary convergence if it was absent in the ancestor species but separately developed within the two lineages.
To know more about Homoplastic Traits visit :
https://brainly.com/question/29570150
#SPJ4
The Complete Question :
How are homologous and homoplastic traits different?
A. Homoplastic traits are inherited from a common ancestor; homologous traits are not.
B. Homologous traits are inherited from a common ancestor; homoplastic traits are not.
C. There is no difference; they are synonyms.
D. Homologous traits are common to all life on Earth; homoplastic traits are not.
E. Homoplastic traits are common to all life on Earth; homologous traits are not.
Base your answer(s) to the following question(s) on the information and diagram below and on your knowledge ofbiology. The diagram represents some cells on a microscope slide before and after a substance was added to the slide.BeforeAfterIdentify a substance that was most likely added to the slide to cause the change observed.
The process seen in the diagram is plamolysis. In this process, the cell (within a cell wall) loses water because it is in a hypertonic solution. The solute added could be (but it is not limited to) salt, which creates the hypertonic solution.
Complete the following statements regarding the investment and harvesting of energy during glycolysis ADP +P ATP is broken down in the step of glycolysis that activates glucose, resulting in 2 Breaking down ATP glucose so that they may undergo reactions. energy that is used to activate axidized Atfter being activated, glucose isor electrons are lost In the end, glyoolysis invests ATP and produces ???, resulting in a net gain of- ATP. Reset Prev 5 of 38 Next > MacBook Air F6 F7 F8 3
ATP is broken down in the step of glycolysis that activates glucose, resulting in 2 ADP+P. Breaking down ATP releases energy needed to activate glucose so that it may undergo further reactions. After being activated, glucose is oxidized, or electrons are lost. In the end, glycolysis invests 2 ATP and produces 4 ATP, resulting in a net gain of 2 ATP.
The correct statements regarding the investment and harvesting of energy during glycolysis are:-
Learn more about glycolysis: https://brainly.com/question/28940912
#SPJ11
Calculate the acceleration of a 300,000 kg jumbo jet just before takeoff when the thrust for each of its four engines is 30,000 N.
Answer:
a = F / m = 4
Explanation:
a = F / m = 4 (30,000 N) / (300,000 kg) = 0.4 m/s^2
Early in development, the nervous system begins as a ______. A. tube surrounding a fluid-filled cavity B. spherical structure in the center of the embryo C. diffuse system of cells scattered throughout the body D. single layer of cells covering the heart and other internal organs
Early in development, the nervous system begins as a tube surrounding a
fluid-filled cavity.
The tube which surrounds the fluid-filled cavity is referred to as neural tube.
The tube gives rise to the central and peripheral nervous system as
development occurs.
The inner part of the tube thickens to form the central nervous system
which consists of the brain and spinal cord while the outer region forms
the peripheral nervous system.
Read more on https://brainly.com/question/869589
Genes in identical organisms can be expressed differently casing the orangish to appear different due to _____ factors ?
Answer:It can be due to the Mutation.
Explanation:
It is the explanation for Genes in identical organisms can be expressed differently casing organism it to appear differently.Basicaaly it can be defined as change in one or more gene.It can be of 4 type substitution,deletion, insertion and translocation.
Which single-stranded nucleic acid could form a hairpin structure? Select one:
a. 5’ TTTGCGATACTCATCGCATT 3’
b. 5’ TTTGCGATACTCACACTATT 3’
c. 5’ TTTGCGATACTCTGCGATTT 3’
d. All of the sequences above could form a hairpin loop.
e. None of these sequences could form a hairpin loop.
The sequence that could form a hairpin loop is 5’ TTTGCGATACTCACACTATT 3’
So the correct option is (b)
The hairpin loop structure is formed by the self-complementary base pairing within the same strand of a single-stranded nucleic acid. In this sequence, the complementary bases are present at the 3’ and 5’ ends, allowing the formation of a hairpin loop structure.
The hairpin loop structure is essential for many biological processes such as gene expression, RNA interference, and regulation of protein synthesis. Therefore, the sequence b. could form a hairpin loop structure.
The other two sequences do not contain a palindromic sequence and thus cannot form a hairpin structure.
Learn more about nucleic acid Here:
https://brainly.com/question/11309892#
#SPJ11
K, L, M, N are examples for?
Which statement best describes the climate of Rome?
A. winter have lower temperature and more precipitation than summers.
B. There is more precipitation in the summer months than in the winter months.
The winters in Rome have a lower temperature and they have more precipitation as compared to the summers.
The correct option is option A.
During the winter season in Rome, the temperature goes below 10 degree Celsius. According to the given graphs, the winter season probably lasts from January to about April after which the temperatures rise and are 20 degrees and above during the summer. The temperature drops again from October to December.
It is also observed from the graphs that the precipitation in the winters is much more than the precipitation seen in the summer.
Hence, the correct option is option A.
To know more about precipitation
https://brainly.com/question/20925010
#SPJ1
Based on Bronfenbrenner's theory, what support systems could be put in place to help Sipho overcome his academic struggles?
According to Bronfenbrenner's ecosystem theory, people are affected by the environment at different levels, from the surrounding microsystem to the larger macrosystem.
It is important to note the various support networks that span these ecological layers to help Sipho overcome their educational difficulties. It is important to note that each person has different demands, and the specific support systems set up for Sipo need to be adapted to their specific needs. Implementing efficient support mechanisms that help Sipo overcome their academic difficulties requires collaboration among various stakeholders, including teachers, parents, school officials, and community resources.
Learn more about Bronfenbrenner's ecosystem theory, here:
https://brainly.com/question/30762006
#SPJ1
I need someone find a Name for each species (from the Tropical Rainforest)
Invasive species:
Indicator species:
Native species:
Native species are species that are native to a particular ecosystem. Indicator species are tools for understanding and managing the health of ecosystem. Invasive species are non-native species that have been introduced to a new environment.
Examples of native species in a tropical rainforest include the red maple tree, which is native to eastern North America and is an important source of food and shelter for many species of animals, and the eastern gray squirrel, which is native to North America and is an important seed disperser in many forests. All other examples also given below.
These species have evolved in response to the specific environmental conditions of the ecosystem and have developed unique adaptations to survive in that environment. When discussing species in a tropical rainforest, it is important to consider whether they are invasive, indicator, or native species.
Invasive species are non-native species that have been introduced to a new environment and have the ability to outcompete native species for resources. Invasive species can cause significant harm to the ecosystem by altering the balance of species and disrupting the natural processes that maintain the ecosystem.
Some examples of invasive species in a tropical rainforest include lionfish, which are native to the Indo-Pacific but were introduced to the Atlantic Ocean and have become a invasive species there, and kudzu, which is native to Japan but was introduced to the United States.
Indicator species are species that can be used to indicate the health of an ecosystem. These species can be used to monitor changes in the ecosystem over time and to identify potential threats to the ecosystem. For example, the tiger swallowtail butterfly is an indicator species in a tropical rainforest because it is sensitive to changes in the environment and can be used to monitor the health of the ecosystem.
To know more about ecosystem .visit:-
https://brainly.com/question/31459119
#SPJ11
Explain how seed germination is caused by a combination of genetic and environmental factors? please help me im failing science!!
Answer:Germination is the process of seeds developing into new plants. First, environmental conditions must trigger the seed to grow. Usually, this is determined by how deep the seed is planted, water availability, and temperature. When water is plentiful, the seed fills with water in a process called imbibition. The water activates special proteins, called enzymes, that begin the process of seed growth. First the seed grows a root to access water underground. Next, the shoots, or growth above ground, begin to appear. The seed sends a shoot towards the surface, where it will grow leaves to harvest energy from the sun. The leaves continue to grow towards the light source in a process called photomorphogenesis.
Explanation:
HELP NOW 70 POINTS! In the United States, Canada, and many European nations, the total fertility rate has fallen below the replacement rate. What economic and social consequences do you think might result from below replacement fertility rates?
Answer:
Answer in bold
When the fertility rate falls below replacement level, the population grows older and shrinks, which can slow economic growth and strain government budgets.
Explanation:
I am a unicellular microorganism that lives in the hypersaline waters of Southeastern Australia. What Kingdom do I belong to?
Answer:
The correct answer is - Archaea or archaebacteria.
Explanation:
Archaea is the domain and the kingdom of the single-cell prokaryotic organisms as they lack a nucleus. These organisms are present in extreme habitats such as hot springs, high saline water. These organisms can live in extremely aggressive environments which makes it a uniqe characteristic of this organism.
In the given condition the organism that lives in hypersaline water is most likely a member of the Archaea domain or Archaebacteria kingdom as it is found in the hypersaline waters of Southeastern Australia and unicellular organisms.
what is one role of calcium in plants
Answer:
to provide structure and some fuel
Explanation:
yes sir
large air tubes leading from the trachea to the lungs which convey air to and from the lungs; consist of primary, secondary or tertiary and right and left bronchioles
Answer:
Explanation:
Further down, the trachea divides into two tubes (left and right) called bronchi (BRAHN-kye). The bronchi connect the trachea to the lungs.
Consider the genome browser data associated with TP53. ((Given))
Track A provides genetic evidence of functionality.
True or False?
It is correct that the Genome browser information on the TP53 gene is track A provides genetic evidence of functionality.
A tumour suppressor protein with transcriptional activation, DNA binding, and oligomerization domains is encoded by this gene. The encoded protein reacts to various cellular stressors by controlling target gene expression, which causes cell cycle arrest, apoptosis, senescence, DNA repair, or adjustments in metabolism. A number of human cancers, including hereditary tumours like Li-Fraumeni syndrome, are linked to mutations in this gene. Multiple transcript variants and isoforms are produced by alternative splicing of this gene and the utilisation of alternative promoters. It has also been demonstrated that different translation beginning codons from identical transcript variants produce multiple isoforms.
Hence, TP53 is involved in basic cell functioning.
To know more about Apoptosis.
https://brainly.com/question/28275150
#SPJ4
why micro organisms so important in the production of medicines? Describe two different medicines that rely on technology in their production.
Answer:
chemical and heydrogen
Ciara is a 32-year-old female. She recently went to the doctor because she was experiencing dizziness, swelling, and difficulty sleeping. After a variety of tests, it was determined that her kidneys were retaining sodium. Due to the sodium retention, her body was experiencing an increase in blood volume. In this scenario, using the given information, how do these test results affect her blood flow and blood pressure?
Group of answer choices
A) decrease in blood flow, decrease in blood pressure
B) Increase in blood flow; increase in blood pressure
C) Increase in blood flow, decrease in blood pressure
D) Decrease in blood flow, increase in blood pressure
Answer:
Increase in blood flow; increase in blood pressure
Explanation:
Question # 2
Multiple Choice
According to the CDC article on noroviruses, food can be contaminated by all except
direct contact with contaminated hands
tiny droplets of vomitus that spray through the air when an infected person vomits
indirect contact with animal feces
direct contact with work surfaces that are contaminated with infectious stool or vomit
Answer:
I think Indirect contact with animal feces
hope it helped :)
Pick a type of cell. Muscle, Nerve, Brain, Cardiac, Digestive, etc. Include Picture and unique properties of that cell. What organelles does it contain? What organelles does it not have.
Answer: All cells have membranes (the building), DNA (the various blueprints), and ribosomes (the production line), and so are able to make proteins
Explanation:
Which vector contained the infectious agent, Yersinia pestis?
Answer:
Yersinia pestis is the causative agent of plague
Explanation:
Rodents, such as rats, carry the disease. It is spread by their fleas.
During which step of the replication-transcription-translation process does each type of RNA first play a role
During the replication-transcription-translation process, m-RNA first plays role in transcription. r-RNA and t-RNA first come into play during translation.
Replication is the process where copies of DNA are formed. The two strands of DNA are unwound and both act as parent or template strands. Daughter strands are formed from these strands. Transcription is the process of formation of m-RNA from the template of DNA. In this process only one strand acts as the template strand. Translation is the process where protein is formed from the single stranded m-RNA template.
All these processes are collectively termed as the central dogma of molecular biology.
To know more about replication-transcription-translation, here
brainly.com/question/4122859
#SPJ4
In the experiment to obtain pure water from ink , what colour will be steam be ?
Answer:
It should be just normal cloudy if the boiling point of water is less compared to ink if not then blue cause its evaporating.
Explanation:
Disinfection is important in killing any remaining bacteria or pathogens in the wastewater. True False
Answer:
True
Explanation:
It is typically a final step to remove organisms from the treated water before the effluent is released back into the water system. Disinfection prevents the spread of waterborne diseases by reducing microbes and bacterial numbers to a regulated level.
Disinfectants are used to rapidly kill bacteria. They kill off the bacteria by causing the proteins to become damaged and the outer layers of the bacteria cell to rupture. The DNA material subsequently leaks out.
Disinfection is the process designed to kill or inactivate most microorganisms in wastewater, including essentially all pathogenic organisms. Contrast this to sterilization, which is the removal and destruction of all living microorganisms, including pathogenic and saprophytic bacteria, vegetative forms and spores.
cells perform life functions for living things true or false
Answer:
True
Explanation:
Which statement explains something that the fossil record indicates?
Earth is 4.5 billion years old.
Mammals have always existed on Earth.
Mass extinctions have occurred several times on Earth.
The amount of water on Earth has decreased over time.
Answer:
Mass extincions have occured several times on Earth.
Explanation:
Answer:
C. Mass extincions have occured several times on Earth.
Explanation:
took the test :)
The family camelids includes camels and llamas. Do all the living members of the family form a clase? Explain?
Camelids are members of the biological family Camelidae, the only currently living family in the suborder Tylopoda. The 7 extant members of this group are: dromedary camels, Bactrian camels, wild Bactrian camels, llamas, alpacas, vicuñas, and guanacos. Camelids are even-toed ungulates classified in the order Cetartiodactyla, along with species like whales, pigs, deer, cattle, and antelopes.
Kingdom:AnimaliaPhylum:ChordataClass:MammaliaOrder:ArtiodactylaSuborder:TylopodaSuperfamily:CameloideaFamily:Camelidae
Gray, 1821Type genusCamelus
Tribes
Camelini Gray, 1821
Lamini Webb, 1965
Current range of camelids, all species
MARK YOU THE BRAINLIEST! DUE TODAY!
Select two specialized cells and identify at least 3 Biomolecules in different parts of the cell any kind of cells .
Answer:
Nerve cells, blood cells, and reproductive cells are examples of specialized cells.
Explanation:
Nerve cells consist of three components: the cell soma, dendrites, and axon.
Blood contains cells, proteins, and sugars. The middle white layer is composed of white blood cells (WBCs) and platelets, and the bottom red layer is the red blood cells (RBCs).
Gametes are an organism's reproductive cells. Female gametes are called ova or egg cells, and male gametes are called sperm. Gametes are haploid cells, and each cell carries only one copy of each chromosome.
~Kandy~
Hope this Helped!
Brainliest Please!
15
Approximately how many degrees does Earth rotate on its axis over this five-hour period?
15°
45
75"
90°
A
Eliminator
8
Line Reader
Reference
CA
Period
Over a five-hour period, Earth rotates approximately 75 degrees on its axis. This calculation is based on the proportion that relates the time taken for Earth's complete rotation (24 hours) to the corresponding degrees of rotation (360 degrees).
The rotation of the Earth on its axis takes approximately 24 hours to complete one full rotation, which equals 360 degrees. To calculate how many degrees Earth rotates over a specific time period, we can use a simple proportion.
In this case, we have a time period of 5 hours. We can set up the proportion:
5 hours is to x degrees as 24 hours is to 360 degrees.
Using cross-multiplication, we can solve for x:
5 hours * 360 degrees = 24 hours * x degrees
1800 degrees = 24x
Dividing both sides by 24:
1800 degrees / 24 = x degrees
75 degrees = x
For more such information on: rotation
https://brainly.com/question/11691986
#SPJ8
The process in which individual amino acids, whether of exogenous or endogenous origin, are connected to each other in peptide linkage in a specific order dictated by the sequence of nucleotides in dNA; this governing sequence is conveyed to the synthesizing apparatus in the ribosomes by mRNA, formed by base-pairing on the DNA template. A process where information is taken from DNA to acts as a blue print for creating a particular protein that is in demand by the body. This blueprint will allow the construction of the protein with the various materials required in its production.
The process in which individual amino acids, whether of exogenous or endogenous origin, are connected to each other in peptide linkage in a specific order dictated by the sequence of nucleotides in DNA is Protein Synthesis.
The process through which cells produce proteins is known as protein synthesis. Transcription and translation take place at separate times. Genetic information from DNA is transferred to mRNA in the nucleus by transcription. Beginning, extending, and ending are its three stages. Transcription is the process through which information from DNA is extracted to serve as a blueprint for producing a specific protein that is required by the body.
A fundamental biological process called protein biosynthesis, which takes place inside of cells, counteracts the loss of cellular proteins (via export or breakdown) by producing new proteins. As enzymes, structural proteins, or hormones, proteins carry out a variety of vital tasks.
To learn more about Protein Synthesis visit: https://brainly.com/question/18800216
#SPJ4