I need a hard 8th-grade math question (ON LEVEL) please don't give me the answer also tell me how I can use it in real life

Answers

Answer 1
The lengths of two sides of a triangle are 20 mm and 13 mm. Which of these lengths cannot represent the length of the third side.
35 mm
10 cm
20 mm
45 mm

Related Questions

PLS ANSWER CORRECT
I WILL REPORT OR BAN YOU IF INCORRECT
I WILL MARK HIM BRAINLIST AND RATE 5 WHO ANSWERS CORRECT
THANKS A LOT​

PLS ANSWER CORRECTI WILL REPORT OR BAN YOU IF INCORRECTI WILL MARK HIM BRAINLIST AND RATE 5 WHO ANSWERS

Answers

Step-by-step explanation:

The AB is equal to AC because They are straight lines that both came from the same point Which is A. which shows congruecy or similarity

match the metric measurements below
a. 2.4 meters
b. 0.4 kilometers
c. 0.04 hectometers
d. 240 decimeters


_ 40 dekameters
_ 0.24 hectometers
_400 centimeters
_ 2400 millimeters

Answers

Metric measurement are given below:

What is metric measurement?

The meter, liter, and gram are the corresponding base units for length (distance), capacity (volume), and weight (mass) in the metric system. To measure smaller or larger amounts, we use units that are derived from metric units.

The three most used base units in the metric system are the meter, gram, and liter. The liter is a unit of volume equal to 1.05 quarts, the meter is a unit of length equal to 3.28 feet, and the gram is a unit of mass about equivalent to 0.0022 pounds (or roughly the mass of a paper clip).

Given Data

a) 2.4 meters

b. 0.4 kilometers

c. 0.04 hectometers

d. 240 decimeters

_ 40 dekameters

_ 0.24 hectometers

_400 centimeters

_ 2400 millimeters

a) 2.4 meters = 2400 millimeters

b) 0.4 kilometers = 400 centimeters

c) 0.04 hectometers =  40 dekameters

d) 240 decimeters = 0.24 hectometers

To learn more about metric, visit:

https://brainly.com/question/24248807

#SPJ13

can you guys help with this math problem

can you guys help with this math problem

Answers

Answer:

D. 9/4

Step-by-step explanation:

Answer: D

Step-by-step explanation:

-1 1/4 + -3 2/4

Cross out the negative sign because we're working with negatives in this equation. Due to taking away the negative sign, we would subtract.

3 2/4 - 1 1/4 = 9/4

Have a good day :D

solve for x each figure is a parallelogram please

solve for x each figure is a parallelogram please

Answers

Answer:

UW = EW+UE=2×EW because, EW=UE

7x-2=2×6= 12

7x=14

x=14/7

x=2

2 is the right answer.

There is a 0 9988 probability that a randomly selected 33-year-old male lives through the year. A life insurance company charges $195 for insuring that the male will live through the year. If the male does not survive the year, the policy pays out $90,000 as a death benefit Complete parts (a) through (c) below. a. From the perspective of the 33-year-old male, what are the monetary values corresponding to the two events of surviving the year and not surviving? The value corresponding to surviving the year is $ The value corresponding to not surviving the year is (Type integers or decimals Do not round) b. If the 33-yem-old male purchases the policy, what is his expected value? The expected value is (Round to the nearest cent as needed) c. Can the insurance company expect to make a profit from many such policies? Why? because the insurance company expects to make an average profit of $on every 33-year-old male it insures for 1 year (Round to the nomest cent as needed)

Answers

a. The value corresponding to surviving the year is $0, and the value corresponding to not surviving the year is -$90,000.

b. The expected value for the 33-year-old male purchasing the policy is -$579.06.

c. Yes, the insurance company can expect to make a profit from many such policies because the expected profit per 33-year-old male insured for 1 year is $408.06.

a. The monetary value corresponding to surviving the year is $0 because the individual would not receive any payout from the insurance policy if he survives. The monetary value corresponding to not surviving the year is -$90,000 because in the event of the individual's death, the policy pays out a death benefit of $90,000.

b. To calculate the expected value for the 33-year-old male purchasing the policy, we need to multiply the probability of each event by its corresponding monetary value and sum them up. The probability of surviving the year is 0.9988, and the value corresponding to surviving is $0. The probability of not surviving the year is (1 - 0.9988) = 0.0012, and the value corresponding to not surviving is -$90,000.

Expected value = (Probability of surviving * Value of surviving) + (Probability of not surviving * Value of not surviving)

Expected value = (0.9988 * $0) + (0.0012 * -$90,000)

Expected value = -$108 + -$471.06

Expected value = -$579.06 (rounded to the nearest cent)

c. The insurance company can expect to make a profit from many such policies because the expected value for the 33-year-old male purchasing the policy is negative (-$579.06). This means, on average, the insurance company would pay out $579.06 more in claims than it collects in premiums for each 33-year-old male insured for 1 year. Therefore, the insurance company expects to make an average profit of $579.06 on every 33-year-old male it insures for 1 year.

For more questions like Company click the link below:

https://brainly.com/question/30532251

#SPJ11

HELP PLS THIS IS A TEST QUESTION


Which linear inequality is represented by the graph?
y<1/2x+2
y>1/2x+2
y<1/3x+2
y>1/3x+2

HELP PLS THIS IS A TEST QUESTION Which linear inequality is represented by the graph?y&lt;1/2x+2y&gt;1/2x+2y&lt;1/3x+2y&gt;1/3x+2

Answers

Answer:

y<1/2+2

Step-by-step explanation:

Answer:

I think the answer is A because I learned about slope last year

A sofa costs $371 and sells for $593.60, which is 160% of the cost. a. Find the rate of markup. b. Find the markup.a. The rate of markup is ___%b. The markup is $___enter your response here. (Type an integer or a decimal.)

Answers

Answer:

• (a)The rate of the markup is 60%.

,

• (b)The markup is $222.60.

Explanation:

• The cost price of the sofa = $371

,

• The selling price of the sofa = $593.60

(a)Given that the selling price is 160% of the cost price:

\(160\%-100\%=60\%\)

The rate of the markup is 60%.

(b)to find the markup, subtract the cost price from the selling price.

\(Markup=593.60-371=\$222.60\)

The markup is $222.60.

Juan received a $350,000 annuity from his grandmother as an inheritance. The annuity will be
scheduled to be paid out over 15 years, at an annual rate of 6.35%. How much will Juan receive
yearly over the next 15 years? $

Answers

The amount Juan will receive over the next 15 years from the annuity is $34,946 yearly.

How to calculate the amount Juan will receive from the annuity?

We shall use the formula for the present value of an annuity, to estimate the amount Juan will receive yearly over 15 years from the $350,000 annuity:

\(P = A * (1 - (1 + r)^{-n} )\)/ r

where:

P = present value (initial amount of the annuity)

A = the annual payment

r = interest rate per period

n = number of periods

Given:

P = $350,000

r = 6.35% or 0.0635 (annual rate)

n = 15 years

We are solving for A, the annual payment.

Putting the values into the formula:

350,000 = \(A * (1 - (1 + 0.0635)^{-15})\)/ 0.0635

To isolate A, we can multiply both sides of the equation by 0.0635:

350,000 * 0.0635 = \(A * (1 - (1 + 0.0635)^{-15})\)

Simplifying:

22, 225 =\(A * (1 - (1 + 0.0635)^{-15})\)

Next, we calculate the value inside the parentheses:

1 - 1.0635⁻¹⁵ = 0.635981

Then, we solve for A:

22, 225 = A * 0.635981

Divide both sides by 0.635981:

A = 22, 225/0.635981

A = 34, 946.01

Therefore, Juan will receive $34,946 yearly over the next 15 years from the annuity.

Learn more about present value of an annuity at brainly.com/question/25792915

#SPJ1

An equation is given.

2x = 26

which calculation would need to be done to solve the equation?

a. divide both sides by 2
b. divide both sides by 26
c. multiply both sides by 2
d. multiply both sides by 26

Answers

Answer:

option A is correct answer

divide both sides with 2

hope it helps

Answer:

option A is the right condition to be fulfilled to solve the equation.


These two polygons are similar.
4
2
9
16
15
w
w = [? ]


45 points asap for anyone who can answer

These two polygons are similar.4291615ww = [? ]45 points asap for anyone who can answer

Answers

6/2=3
The scale factor is 3
3x3=9
w=9

Select the correct answer. sara goes on a slingshot ride in an amusement park. she is strapped into a spherical ball that has a radius of centimeters. what is the volume of air in the spherical ball? use this formula: , where r is the sphere’s radius. a. b. c. d.

Answers

The volume of air in the spherical ball is \(\frac{4}{3}\cdot \pi\cdot 3^3\cdot 10^6\). So the option A is correct.

In the given question, we have to find the volume of air in the spherical ball.

A sphere's capacity is measured by its volume. It is the area the sphere calls home. Cubic units are used to express the volume of a sphere. The sphere has a three-dimensional, rounded shape. Its shape is defined by its three axes, which are the x, y, and z axes.

Since the cross-section of the sphere is a circle, the volume in this situation is dependent on the radius's diameter. A sphere's surface area is the area or region of its outside. The following formula can be used to determine the volume of a sphere whose radius is "r":

V = \(\frac{4}{3}\pi r^{3}\)

As given r = 3·10^2. So,

V = \(\frac{4}{3}\pi (3\cdot 10^2)^{3}\)

V = \(\frac{4}{3}\cdot \pi\cdot 3^3\cdot 10^6\)

V = \(4\cdot \pi\cdot 3^2\cdot 10^6\) cm^3

Hence, the option A is correct.

To learn more about volume of sphere link is here

brainly.com/question/9994313

#SPJ4

The complete question is given below:

Select the correct answer. sara goes on a slingshot ride in an amusement park. she is strapped into a

An animal shelter currently has 40 cats in it. Next month they expect the number of cats to increase by 15% over the number this month. Which of the following is the number of cats they expect next month

Answers

Answer:

46

Step-by-step explanation:

15% of 40 is 6 so you add 6 to 40

Answer:46

Step-by-step explanation:

15% of 40=?

multiply 15 by 40 and divide by 100

15 * 40 / 100 = 6

add 6 to 40

40+6=46

Therefore, the number of cats that they expect is 46.

Given h(x)=4x-5 find h(-3)

Answers

Answer:

-17

Step-by-step explanation:

Plug -3 into the function in place of x.

1. h(-3)= 4(-3) - 5

2. h(-3)= -12-5

3. h(-3)= -17

The value of the function h(x) at x = -3 is - 17.

What is a function ?

A function can be thought of as the outputs for the given input and input decides the output we get.

The set of all inputs are called independent variables and the set of all outputs are called dependent variable.

According to the question a function h(x) = 4x - 5 is given we have to find h(-3).To find h(-3) we have to substitute x = -3 in h(x).

∴ h(-3) = 4(-3) - 5.

h(-3) = -12 - 5

h(-3) = -17.

learn more about functions here :

https://brainly.com/question/5975436

#SPJ2

why do you need to tare a kitchen scale before weighing an ingredient

Answers

Taring a kitchen scale before weighing an ingredient is essential to obtain accurate measurements by removing the weight of the container, streamlining the process, and ensuring precise and reliable results in culinary preparations.

Taring a kitchen scale before weighing an ingredient is necessary to accurately measure the weight of the ingredient without including the weight of the container or vessel in which it is placed. Taring essentially resets the scale to zero, accounting for the weight of the container so that only the weight of the ingredient being added is measured.

By taring the scale, you eliminate the need to manually subtract the weight of the container from the final measurement. This allows for more precise and efficient measurements in recipes or other culinary applications.

Taring is particularly important when working with small or precise quantities of ingredients, where even a slight variation in weight can significantly impact the final outcome of a dish. It ensures that the weight of the container does not contribute to the measurement, providing accurate and reliable results.

Additionally, taring simplifies the weighing process by eliminating the need to calculate or estimate the weight of the container separately. It saves time and reduces the chances of errors in measurements, promoting consistency and precision in cooking and baking.

Learn more about baking at: brainly.com/question/20692796

#SPJ11

A classroom of children has 18 boys and 19 girls in which five students are chosen at random to do presentations. What is the probability that more boys than girls are chosen

Answers

Answer: 76/8547

Step-by-step explanation:

two possibilities

3 boys or 4 boys it would end up as

(18C3+18C4)/37C5

if the eigenvectors of a are the columns of i, then a is what sort of matrix? if the eigenvector matrix p is triangular, what sort of matrix is a?

Answers

If the eigenvectors of a are the columns of the identity matrix (i), then a is a diagonal matrix. If the eigenvector matrix p is triangular, then a is a triangular matrix.

If the eigenvectors of a are the columns of the identity matrix (i), then a is a diagonal matrix. This is because the eigenvectors of a diagonal matrix are simply the columns of the identity matrix, and the eigenvectors of a matrix do not change under similarity transformations.

If the eigenvector matrix p is triangular, then a is a triangular matrix. This is because the eigenvector matrix p is related to the matrix a through the equation:

A = PDP⁻¹

where D is a diagonal matrix whose diagonal entries are the eigenvalues of a, and P is the matrix whose columns are the eigenvectors of a. If the matrix P is triangular, then the matrix A is also triangular. This can be seen by noting that the inverse of a triangular matrix is also triangular, and the product of two triangular matrices is also triangular.

To know more about eigenvectors here

https://brainly.com/question/31043286

#SPJ4

-- The given question is incomplete, the complete question is

"If the eigenvectors of A are the columns of I, then A is what sort of matrix? If the eigenvector matrix P is triangular, what sort of matrix is A?"

Find the equation. please help

Find the equation. please help

Answers

y= 6/5x + 20

the slope is 30/25 which if simplified is 6/5. the y-intercept is 20 so it is +20.

(THIS FOR A TEST. WILL GIVE BRAINLIEST) 5. A banquet hall has two types of tables, rectangular and round. The rectangular tables can fit 8 people sitting around them. The round tables can fit 6 people sitting around them. The hall will be hosting a banquet for 192 people. Assume all tables will have the maximum number of people seated at the table.

a. Write an equation in standard form showing the relationship between the number of rectangular tables, z, and the number of round tables, y, that are needed to seat 192 people.

b. Find the z-intercept and explain its meaning in the context of the problem.

c. Find the y-intercept and explain its meaning in the context of the problem.

Answers

b find the z - intercept and explain its meaning in the context of the problem

Answer:

its A.

Step-by-step explanation:

3=-2(x+7)+5x+12-8x Please help me ASAP

Answers

Answer:

3=-2x-14+5x+12-8x

3+14-12=-2x+5x-8x

5=-5x

x=(-1)

please help ! Struggling with this one :(

please help ! Struggling with this one :(

Answers

Answer A becouse:

x-=20

y=55

y-35=2(x-10)

y=2x-20+35=40-20+35=55

Can someone help me! Please show pictures of the number line thank you!

Can someone help me! Please show pictures of the number line thank you!

Answers

The graph is an open circle at -1 with the line going towards the positive numbers.
Can someone help me! Please show pictures of the number line thank you!

First, we have to make \(w\) the subject of the equation:

\(w - 0.9 > -2.1\\w > -2.1 + 0.9\\w > -1.2\)

This shows that \(w\) is less than but not equal to \(-1.2\). So we are going to use an arrow that has a non-shaded circle. Since the symbol is the greater than symbol, or >, the arrow will point to the right. Thus, the arrow we choose will be the last arrow.

Now since we are comparing \(w\) with \(-1.2\), we place the arrow above the \(-1.2\) point. That's how he place the arrow in the number line.

The equation of the line that is perpendicular to the line 5x + 6y = 18 and passes through the point (10,7)

Answers

Answer:

y = ( 6 / 5 )x - 5;

Step-by-step explanation:

Perpendicular Line Theory

y = - ( 1 / m )x + c;

Algebra

Convert dual intercept to standard form.

5x + 6y = 18;

Subtract 5x from both sides.

6y = - 5x + 18;

Divide both sides by 6.

y = ( - 5x + 18 ) / 6;

y = ( - 5x / 6 ) + ( 18 / 6 );

y = ( - 5 / 6 )x  + 3;

Get the perpendicular line.

y = ( 6 / 5 )x + c;

Substitute the point.

7 = ( 6 / 5 )( 10 ) + c;

7 = 12 + c;

Subtract 12 from both sides.

- 5 = c;

c = - 5;

y = ( 6 / 5 )x - 5;

30points!!!!
Solve for x in this figure.



Enter your answer in the box.

30points!!!!Solve for x in this figure.Enter your answer in the box.

Answers

Answer: 8 degrees

101+112= 213

125+96= 221

221-213= 8

x=8

Step-by-step explanation:

Hope this helps!  =D

Please help me I'm stuck. I will give 30 points for this one. Given triangle ABC tilde triangle PQR and your scale factor Complete the hotspots for these similar triangles and show work

Please help me I'm stuck. I will give 30 points for this one. Given triangle ABC tilde triangle PQR and

Answers

The value for the hotspots of the similar triangles ∆ABC and ∆PWR are:

(1). angle B = 68°

(2). PQ = 5cm

(3). BC = 19.5cm

(4). area of ∆PQR = 30cm²

What are similar triangles

Similar triangles are two triangles that have the same shape, but not necessarily the same size. This means that corresponding angles of the two triangles are equal, and corresponding sides are in proportion.

(1). angle B = 180 - (22 + 90) {sum of interior angles of a triangle}

angle B = 68°

Given that the triangle ∆ABC is similar to the triangle ∆PQR.

(2). PQ/7.5cm = 12cm/18cm

PQ = (12cm × 7.5cm)/18cm {cross multiplication}

PQ = 5cm

(3). 13cm/BC = 12cm/18cm

BC = (13cm × 18cm)/12cm {cross multiplication}

BC = 19.5cm

(4). area of ∆PQR = 1/2 × 12cm × 5cm

area of ∆PQR = 6cm × 5cm

area of ∆PQR = 30cm²

Therefore, the value for the hotspots of the similar triangles ∆ABC and ∆PWR are:

(1). angle B = 68°

(2). PQ = 5cm

(3). BC = 19.5cm

(4). area of ∆PQR = 30cm²

Read more about similar triangles here:https://brainly.com/question/14285697

#SPJ1

The file sequences.mat contains a set of fictitious bio-sequence in a cell array sequences {mu}(t). Thus sequences {3}(:) is the third sequence, GTCTCCTGCCCTCTCTGAAC which consists of 20 timesteps. There are 20 such sequences in total. Your task is to cluster these sequences into two clusters, assuming that each cluster is modelled by a Markov chain. State which of the sequences belong together by assigning a sequence v^n to that state for which p(h∣v^n) is highest. You may wish to use mixMarkov.

Answers

The exact code or specific sequence assignments cannot be provided without knowledge of the programming context or access to the mixMarkov function and the sequences data.

Clustering bio-sequences into two clusters using Markov chains can be achieved by applying a mixture model approach. In this case, the mixMarkov function can be utilized to assign the sequences to their respective clusters based on the highest conditional probability.

Given the file sequences.mat containing the bio-sequences in the cell array sequences, the mixMarkov function can be employed to perform the clustering. This function models each cluster as a separate Markov chain and calculates the conditional probability of each sequence belonging to a particular cluster.

By running the mixMarkov algorithm on the sequences data with two clusters, the function will assign each sequence to the cluster for which the conditional probability p(h∣v^n) is highest. The resulting clustering will group together sequences that share similar characteristics based on their Markov chain modeling.

It is important to note that the implementation details of the mixMarkov function and the specific assignment of sequences to clusters will depend on the programming language or software used for analysis.

Therefore, the exact code or specific sequence assignments cannot be provided without knowledge of the programming context or access to the mixMarkov function and the sequences data.

To learn more about sequence from the given link

https://brainly.com/question/12491544

#SPJ4

Which property best describes the congruence statement below?
ДАВС = ДАВС
A. Symmetric property
OB. Reflexive property
OC. Commutative property
O O O
D. Transitive property

Which property best describes the congruence statement below? = A. Symmetric propertyOB. Reflexive propertyOC.

Answers

Answer:

I think B.Reflexive property

The property best describes the congruence statement is

Symmetric property.

What is Congruence?

Congruent means same shape and same size. So congruent has to do with comparing two figures, and equivalent means two expressions are equal. So to say two line segments are congruent relates to the measures of the two lines are equal.

We know,

The Symmetric Property states that for all real numbers

if x = y then y=x

and, Transitive Property

The Transitive Property states that for all real numbers

if x = y and y = z then z=x.

and, Reflexive Property

for any x, x = x.

Here, the property used is Symmetric.

Learn more about symmetric Property here:

https://brainly.com/question/29206759

#SPJ5

24. 123456 is the code for FATHER, 4526 is the code for?

Answers

FATHER = 123456

That means that each letter of father represents the following numbers:

F = 1A = 2T = 3H = 4E = 5R = 6

Now,

Let's see the given code

4526

Which letters are they representing, Let's see:

4 = H5 = E2 = A6 = R

Thus, 4526 is the code for the word Hear...

Use Lagrange multipliers to maximize the product zyz subject to the restriction that z+y+22= 16. You can assume that such a maximum exists.

Answers

By using  Lagrange multipliers to maximize the product zyz subject to the restriction that z+y+22= 16 we get answer as  z = -3 and y = -3, satisfying the constraint.

To maximize the product zyz subject to the constraint z + y + 22 = 16 using Lagrange multipliers, we define the Lagrangian function:

L(z, y, λ) = zyz + λ(z + y + 22 – 16).

We introduce the Lagrange multiplier λ to incorporate the constraint into the optimization problem. To find the maximum, we need to find the critical points of the Lagrangian function by setting its partial derivatives equal to zero.

Taking the partial derivatives:

∂L/∂z = yz + yλ = 0,

∂L/∂y = z^2 + zλ = 0,

∂L/∂λ = z + y + 22 – 16 = 0.

Simplifying these equations, we have:

Yz + yλ = 0,

Z^2 + zλ = 0,

Z + y = -6.

From the first equation, we can solve for λ in terms of y and z:

Λ = -z/y.

Substituting this into the second equation, we get:

Z^2 – z(z/y) = 0,

Z(1 – z/y) = 0.

Since we are assuming a maximum exists, we consider the non-trivial solution where z ≠ 0. This leads to:

1 – z/y = 0,

Y = z.

Substituting this back into the constraint equation z + y + 22 = 16, we have:

Z + z + 22 = 16,

2z = -6,

Z = -3.

Therefore, the maximum value occurs when z = -3 and y = -3, satisfying the constraint. The maximum value of the product zyz is (-3) * (-3) * (-3) = -27.

Learn more about Lagrange multipliers here:

https://brainly.com/question/4746494

#SPJ11

what is the algebraic expression for: the quotient of 5 and y added to 3 is at least 5

Answers

the quotient of 5 and y:   5÷y

added to 3:   3 + 5÷y

is at least (AKA is greater than or equal to) 5:  3 + 5÷y  ≥ 5

Answer:   3 + 5÷y ≥ 5

   

If you go out to eat with 3 friends and you mea was $72.50 there is a 6.75% slaes tax and you should tip the waiter 15% how much should each person pay.

Answers

Answer:

$29.42

Step-by-step explanation:

Total cost of meal for the 3 friends = $72.50

sales tax = 6.75%

percent tip = 15%

Total %paid on meal = 6.75%+15% = 21.75%

Increment paid = 21.75% of  $72.50

Increment paid =  21.75/100 * 72.50

Increment paid = 21.75 * 0.7250

Increment paid = $15.7685

Total amount paid = original cost + increment

Total amount paid = $72.50+$15.7685

Total amount paid = $88.26875

If the 3 friends paid $88.26875

Each person will pay $88.26875/3 = $29.42

Hence each person will pay $29.42

Other Questions
Bubble sort algorithm in C++ sophie finds a vintage fur coat at a consignment shop. while she really likes it, she is concerned that wearing it will make her the target of animal activists. this is an example of which type of risk? S is the midpoint of RT. If RS= 9x and ST = x + 8, what is RS?Simplify your answer and write it as a proper fraction, mixed number, or integer. PLZZZZ DO THE WHOLE THINGGGGNO WORK = NO CREDIT = REPORTGIVING BRAINLIEST find a function f such that f '(x) = 5x3 and the line 5x + y = 0 is tangent to the graph of f. Which number is ninetythree and six hundredths Which correctly reflects a conflict of character vscharacter?O The weather has been filled with lightning and windmaking travel difficult.O Antony and Octavius must join forces to win in battleagainst the combined forces of Brutus and Cassius.O Ocatvius is doubting his own abilities to be equal toAntony in his leadership.O Cassius and Octavius have both worked to turnsociety against the cause of the other. according to herzberg, in which instance could an employee experience both job satisfaction and job dissatisfaction at the same time? group of answer choices when the job is monotonous and the pay is low when the job is pleasant and the pay is high when the job is exciting and the pay is high when the job is interesting and the pay is low Find the general solution to the given system. X' = (12 -9)X(4 0) suppose the government imposes a $16 per month tax on internet service. if the demand curve for internet service is perfectly elastic, and the supply curve is upward-sloping, the monthly price for internet service will: Based on the function and symbolic representation, the ambum stone is more similar to? The value of 6 nickels is _____% of the value of a dollar.60504030NEED HELP RIGHT AWAY!!! Why does Miep feel this way?She is relieved that the frightening officers have left.She is shocked and disappointed by the days events.She is overwhelmed by her work at Mr. Franks office.She is scared by the threats of the Austrian officer. What can be learned about the Yaqui culture from the folktale?how they felt about weather what they stole from the godswhat they believed which animals they worshiped School organizations should be organized by utilizing bullet points and short explanatory sentences true or false Pleaeeeeee helppp!!! Maria decides to reduce her homework time of 8 hours per week by 15%. Calculate her new homework time. Give your answer in hours and minutes. .. Which of the following fractions is less than 1options: a) 1 1by4 b) 3/4 c) 5/4 d) 2 3by4 Are most car loans secured or unsecured?. when mary believes that it is ethical to use a hiring method that is illegal in the u.s. in another country in which it is legal to use, she is probably applying which ethical approach?