Answer:
A,C,D
Explanation:
Produce spores, Contain hyphae, Contain a fruiting body
Fungi produces spores containing hyphae and a fruiting body. So, the correct options are A, C and D.
What is Fungi?A fungus is defined as a member of a group of eukaryotic organisms which includes microorganisms such as yeast and mold, as well as the more familiar mushrooms.
Fungi are described as eukaryotic, non-vascular, non-motile and heterotrophic organisms which can be unicellular or filamentous. They reproduce by means of spores which exhibit the phenomenon of alternation of generations. Fungi lack chlorophyll and therefore cannot photosynthesize.
Fungi are classified in four divisions such as the Chytridiomycota (chytrids), Zygomycota (bread molds), Ascomycota (yeasts and sac fungi), and the Basidiomycota (club fungi).
Thus, Fungi produces spores containing hyphae and a fruiting body. So, the correct options are A, C and D.
Learn more about Fungi, here:
https://brainly.com/question/1261179
#SPJ6
Will this movement re hire an input of energy?
Their movement will require the input of energy. That is option B.
What is an active transport?An active transport is defined as the movement of molecules across the cell membrane from different compartments in the living organism.
The active transport makes use of energy because of the need to move molecules from a semi permeable membrane that is against a concentration gradient.
Learn more about cell membrane here:
https://brainly.com/question/30395471
#SPJ1
Which of the following would a prokaryote have?
A. Golgi apparatus
B. Cytoplasm
C. Mitochondria
D. Nucleus
Answer:
The answer is B)
Explanation:
Prokaryots have cytoplasm
inquiry based pedagogy is being embraced in principle across the globe. in the last decade , it has been supported by an increasing body of research on its effectiveness. illustrate your understanding of the concept of inquiry based pedagogy with a relevant example
Inquiry-based pedagogy involves fostering curiosity and active learning. For example, students investigating real-world environmental issues and proposing solutions.
Inquiry-based pedagogy is a teaching approach that promotes active learning and critical thinking through inquiry and exploration. One relevant example of inquiry-based pedagogy is a science classroom where students are encouraged to design and conduct their own experiments. Instead of simply following instructions, students formulate research questions, develop hypotheses, plan and execute experiments, collect and analyze data, and draw conclusions. For instance, students may investigate the effect of different variables on plant growth by manipulating factors like light, water, or soil composition. This approach allows students to engage in authentic scientific practices, develop problem-solving skills, and gain a deeper understanding of the scientific method. By actively participating in their learning process, students develop a sense of ownership and become more engaged, fostering a love for learning and nurturing their ability to explore and discover knowledge independently.For more such questions on Pedagogy:
https://brainly.com/question/32239495
#SPJ8
Which gas has recently increased in the mesosphere, creating a rise in water vapor which has led to the formation of high-altitude clouds that are visible at night?
A) Ozone
B)Methane
C)Carbon Dioxide
D)Hydrogen
Answer:
I'm not 100% sure but I'm positive the answer was or is Methane, correct me if I'm wrong!
Methane levels in the mesosphere have lately risen, causing an increase in liquid water, that has resulted in the production of high-altitude storms visible at night.
So, option B) is correct.
Define Mesosphere.The mesosphere is the third layer of the atmosphere, located directly above the stratospheric and under the thermosphere. Temperature falls as altitude climbs in the mesosphere.
Methane levels in the mesosphere have lately risen, causing an increase in liquid water, that has resulted in the production of high-altitude storms visible at night.
Methane is a chemical molecule that has the formula \(CH_{4}\).
So, option B) is correct.
Find out more information about mesosphere here:
https://brainly.com/question/12663525?referrer=searchResults
What connective tissue is replaced by bone in the epiphyseal plates?
Answer:
A band of hyaline cartilage, the epiphyseal plate, forms between the two ossification centers. 8. Layers of cartilage cells undergoing mitosis make up the epiphyseal plate. matrix and are replaced with bone- building osteoblasts that deposit bone in place of calcified cartilage.
Explanation:
Describe the physical defense the tuberculosis bacteria will encounter as they move into your respiratory system?
The physical defense that the tuberculosis bacteria will encounter as they move into your respiratory system includes physical barriers such as respiratory epithelia and then inside the tissue white blood cells that attack pathogenic bacteria.
What is the relative role of white blood cells in the immune system?The role of white blood cells such as killer T cells that attack pathogenic bacteria is to create a line of defense in the immune system against this type of pathogenic agent.
Therefore, with this data, we can see that White blood cells are able to attack and kill pathogenic bacteria.
Learn more about white blood cells here:
https://brainly.com/question/87658
#SPJ1
Which actions could be categorized in the “aerobic” section of the Venn diagram?
Answer:
Starts process with a glucose molecule (Obtaining ATP begins with a breakdown of a glucose molecule (hence the name of glycose), and this is in common with the anaerobic process since this step does not require oxygen.)
Explanation:
❣️ꈍ jess bragoli ꈍ❣️#keep learning!!
Answer:
If your doing the test on edgen then the answers are A.)consists of three stages, B.)yields 36 ATP molecules and, E.)starts process with a glucose molecule
Explanation:
I really hope his helps :) !!!!!!!!!!!!
Please push that thank you button and have a great day!!!!!!!!!
What are some components that makeup lipid envelopes on viruses?
Answer:
Some of the components that make up lipid envelopes on viruses include:
Phospholipids: The main component of the lipid bilayer in the viral envelope is phospholipids, which are made up of a hydrophilic (water-loving) head and a hydrophobic (water-fearing) tail.Proteins: Viral envelope proteins are embedded in the lipid bilayer and help the virus to interact with host cells, infect them, and evade the immune system.Glycoproteins: Some viruses have glycoproteins on their envelope allowing them to bind to specific receptors on host cells and initiate infection.Cholesterol: Some viruses incorporate cholesterol into their envelope to help stabilize the lipid bilayer.Lipid rafts: These are specialized regions within the lipid bilayer containing high concentrations of cholesterol and glycolipids. Lipid rafts facilitate viral entry into host cells by concentrating viral envelope proteins in a specific region.Other lipids: Viral envelopes may also contain other lipids, such as sphingolipids and gangliosides, which influence the interaction between the virus and host cells.The composition of viral envelopes can vary depending on the type of virus. These components determine the virus ability to infect host cells, evade the immune system, and replicate within the host.
Explanation:
Which group predates the other?
A) Dinosaurs
B) humans
This is a Ella question
Answer:
Dinosaurs preditate the humans
Explanation:
This is really obvious and I'm sure this is a joke from the picture? I'll take the points though
Movement of the lithospheric plate
Answer:
Movement of the lithospheric plate
The movement of lithospheric plates is known as the plate tectonics, this was a theory before but now it is widely accepted as true and actually happening around the planet.
These movements in the lithospheric plates of the planet, is the reason why the planet looks like what it is today. The continents, countries and all land formations and underwater features are products of plate tectonics.
#CarryOnLearning
Answer:
Explanation:
Movement of the lithospheric plate is a major topic in the theory of plate tectonics. the motions of two plates against each other can cause subduction of plates, volcanoes to form and earthquakes to happen.
Where are the A, B and RH antigens located
Answer: The A, B, and Rh antigens are located on the surface of red blood cells.
Explanation:
Which letter would represent the Sun on the
HR-Diagram below?
A
D
B
A
Brightness
C
B
Temperature
E
D and E
с
The Science Duo
x
QUE
*
Answer: A
Explanation:
It has the highest temperature + brightness
IM GIVING YALL 5 MIN TO ANWSER
Question 14 (Essay Worth 10 points)
(04.05 HC)
Analyze the given diagram of the carbon cycle below.
An image of carbon cycle is shown. The sun, a cloud, two trees, one towards left and the other towards right, an animal, lake, and a factory are included. Arrow A points from the sun to the left tree. Arrow B points from the air above the clouds to the left tree. Arrow C points from the factory towards the air above the clouds. Arrow D points from the air to the lake labeled Carbonates in Water. Arrow E points from the label Dead Organism under the animal to label Fossils and Fossil Fuels. Arrow F points from the right tree to the air.
Part 1: Which process does arrow F represent?
Part 2: Explain how matter is conserved during the process.
Part 3: Justify why this process is a recycling of carbon in the carbon cycle.
The answers include the following below:
The process F means oxygen from plant goes into the atmosphere.Matter is conserved in this process because plants take carbon dioxide from the atmosphere for photosynthesis then produces oxygen into the atmosphere and then animals feed on plants and their faeces is released into the soil for plants use which is how it is conserved.This is because absorb light energy and convert it to chemical energy and plants absorb carbon dioxide which is exhaled by humans and animals in a cyclic manner.What is Carbon cycle?This is referred to as the circulation of carbon in various forms through nature and involves various processes such as photosynthesis, respiration etc.
The process F which points from the right tree to the air means that oxygen from the plant goes into the atmosphere after the process of photosynthesis and is then used by animals.
Read more about Carbon cycle here https://brainly.com/question/12005308
#SPJ1
what is a structure that develops in the mesoderm and allows for more complex internal organ formation
The structure that develops in the mesoderm and allows for more complex internal organ formation is coelom.
what is coelom?
The coelom develops within the mesoderm during embryogenesis. In most animals, the coelom (or celom) is the major bodily cavity that surrounds and contains the digestive tract and other organs.
What are the functions of coelom?
Coelom acts as a shock absorber and protects against mechanical shock. It allows the body organs to move more freely and protects them from damage caused by minor bends by cushioning the internal organs.The coelomic fluid also helps in gaseous transport and transport of nutrients and waste products.Coelom provides the additional room that organs require to grow and function. Because of coelom, things like heart pumping, bearing a kid in the womb, and so on are conceivable.The structure that develops in the mesoderm and allows for more complex internal organ formation is coelom.
To know more about Coelom, check out:
https://brainly.com/question/210560
#SPJ1
The segment of DNA that codes for fur type is called a?
Which of the following statements apply to leukocytes? Select all that apply.
Multiple select question.
They eject major organelles when mature.
They are capable of protein synthesis.
They live approximately 120 days.
They retain their organelles throughout their life time.
They are not uniform in form and function.
Explanation:
leukocytes are white blood cells. mainly 4 killing bacterial infections.
Leukocytes are the specialized cells which are a part of blood. These are known as white blood cells. These protects the body. These produce antibodies. Thus, the correct options are B, D, and E.
What are Leukocytes?
Leukocytes are the white blood cells. These are a type of specialized cell type which is present in blood along with erythrocyte and plasma. Leukocytes are primarily responsible for protecting the body from pathogens and germs by producing antibody proteins which fight against these organisms.
Leukocytes are irregular in shape. They can change their shape to engulf or kill the bacteria which enters the blood to prevent disease. Erythrocytes change their shape which allows them to pass through the capillaries which are very tiny.
Therefore, the correct option is B, D, and E.
Learn more about Leukocytes here:
https://brainly.com/question/12857838
#SPJ2
Urgent!! Can somebody please answer this for me.
Answer:
TAGCTTTAAAGCGTCGATGCT
Explanation:
A AND T are complimentary and G and C for DNA
help I dropped my hamster and now he is missing his two bottom teeth what do I do. He is very scared and it is bleeding. His gums look swollen.
Answer: Take him to the vet
Explanation:
Answer:
Rinse out the blood and smear a small amount of honey on the infected area. The honey prevents infection, take it to the vet immediately.
Explanation:
Fish that spawn in fresh water but feed in continental shelf waters are:__________ a. Lecithotrophic b. Polytomous c. Catadromous d. Anadromous
Answer:
D. Anadromous
Explanation:
Hope this helped!
Fish that spawn in freshwater but feed in continental shelf waters are Anadromous, Option B is correct. This is further explained below.
What is Anadromous fish?Generally, Anadromous fishes are simply defined as fishes that spawn in freshwater but eat on continental shelf seas and are called migratory fish.
In conclusion, Anadromous spawn in freshwater but feed in continental shelf waters.
Read more about Animal
https://brainly.com/question/11957660
#SPJ2
which of the following correctly ranks the structures in order of size, from smallest to largest? group of answer choices nucleotide, codon, gene, chromosome chromosome, gene, codon, nucleotide nucleotide, chromosome, codon, gene gene, codon, nucleotide, chromosome
The correct ranks of the nucleic acids structures in order of size from smallest to largest is b)Chromosome-gene-codon-nucleotide. So, option b is correct.
Nucleic acid structures design alludes to the construction of nucleic acids like DNA and RNA. Synthetically speaking, DNA and RNA are basically the same. Nucleic acids design is frequently separated into four distinct levels: essential, auxiliary, tertiary, and quaternary.
Essential design comprises of a direct succession of nucleotides that are connected together by phosphodiester bond. This straight arrangement of nucleotides make up the essential construction of DNA or RNA. Nucleotides comprise of 3 parts:
1. Nitrogenous base
AdenineGuanineCytosine2.Thymine (present in DNA as it were)
3.Uracil (present in RNA as it were)
5-carbon sugar which is called deoxyribose (tracked down in DNA) and ribose (tracked down in RNA). At least one phosphate groups.
Hence, option b is correct.
To know more about nucleic acids, visit here:
https://brainly.com/question/11309892
#SPJ4
(Complete question) is:
Which of the following correctly ranks nucleic acid structures in order of size, from smallest to largest?
a. chromosome, gene, codon, nucleotide
b. chromosome, nucleotide, gene, codon
c. gene, chromosome, nucleotide, codon
d. nucleotide, chromosome, gene, codon
e. nucleotide, codon, gene, chromosome
list three pros and three cons of each separation techniques: decantation, gravity filtration, and vacuum filtration.
Decantation: Pros: Simple and straightforward process. No special equipment or filter media is required. Suitable for separating mixtures with a large difference in densities.
Cons: Inefficient for separating small or closely sized particles. Can result in loss of small suspended particles or the liquid layer if not done carefully. Not suitable for separating particles that are prone to chemical reactions or degradation.
Gravity Filtration:
Pros: Easy to set up and operate. Suitable for separating solids from liquids. Can handle a wide range of particle sizes.
Cons: Can be slow and time-consuming for larger volumes. Can clog if the filter paper is not chosen carefully. Not suitable for separating particles that require high pressure.
Vacuum Filtration:
Pros: Quick and efficient method of filtering large volumes. Suitable for separating a wide range of particles sizes. The process can be easily scaled up.
Cons: Can be expensive as it requires specialized equipment. Not suitable for filtering heat-sensitive or reactive materials. Can result in loss of small particles if not done carefully.
To learn more about Decantation
https://brainly.com/question/30067228
#SPJ4
What is the product of 1 2/3 and -3 1/2
Answer:
-5 5/6
Explanation:
So the same thing as the last question I answered, we have to multiply the top row and the bottom row. However, the fractions in the photo are actually mixed numbers so we first have to make them into improper fractions.
1 and 2/3 would be: 5/3
-3 and 1/2 would be: - 7/2
So now we have to multiply them: 5/3 * - 7/2:
Same steps: 5 * 7 = 35; 3 * 2 = 6:
- 35/6, or we could simplify and make it a mixed number so and also add the negative sign:
6 goes into 35 5 times so: -5 and 5/6 or -5 5/6
Cells were treated with a chemical that inhibits the first step of the electron transport chain. How would this affect the levels of the inputs and outputs of the electron transport chain?
Answer:
The levels of inputs and outputs will be negatively affected
Please find the detailed explanation below
Explanation:
The electron transport chain consists of a series of molecules that transfers electrons to one another in a group called COMPLEXES. The major aim of the ETC is to build a proton gradient needed for the synthesis of ATP. The first step in the ETC is as follows:
The process of ETC starts when two electron carriers/donors viz: NADH and FADH2 transfers their electrons to COMPLEX I. If this does not occur, the ETC cannot function. Hence, in a case where cells were treated with a chemical that inhibits the first step of the electron transport chain, the input and output (ATP) will be greatly affected in the sense that other inputs will not be used or the output will not be produced.
4. How of Earth's upper layers flows very
slowly?
A)asthenosphere
B) continental crust
C)lithosphere
D)ocean crust
The asthenosphere is the Earth's upper layer which flows very slowly.
What is the asthenosphere ?The Earth's upper mantle contains the ductile and mechanically feeble asthenosphere. It stretches as far as 700 km beneath the lithosphere, between 80 and 200 km below the surface. The asthenosphere's lower border, however, is not clearly defined.
What are the upper layers of Earth?Lithosphere is the Earth's thin, brittle crust and upper mantle make up its uppermost layer. The lithosphere is divided into slowly moving tectonic plates and is generally stiff.
Although the asthenosphere is nearly solid, its mechanical weakness is caused by a little amount of melting (less than 0.1% of the rock). The most significant source of magma on Earth is when the asthenosphere wells upwards because there is more extensive decompression melting there.
Hence, The asthenosphere is the Earth's upper layer which flows very slowly.
To know more about asthenosphere visit
https://brainly.com/question/7152935
#SPJ1
Which is required for both anaerobic respiration and aerobic respiration?
O oxygen
O water
O mitochondria
O glucose
what is the effect of Earth’s curvature and tilt
What might happen to the organisms in the food web below if the number of phytoplankton and vegetation drastically decreased? A food web titled Chesapeake Bay Waterbird Food Web. It shows a very complex food web with many different food chains of various species displayed in 5 categories: Producers, Herbivores, Primary consumers, Secondary consumers, Tertiary consumers. The small fish and wading birds would be affected. Only the small fish would be affected. The small fish, bivalves, and invertebrates would be affected. The entire food web would be affected.
Answer:
The entire food web would be affected.
Explanation:
The trophic web is the process of energy transference through a series of organisms, in which every organism feeds on the preceding one and becomes food for the next one. The first link is an autotroph organism or producer, such as a vegetable, that can synthesize organic matter from inorganic matter. These organisms are the base of the trophic chain, so whenever their population decreases, they inevitably affect the whole food web.
This is because when one of the links disappears, it affects the superior links as they will not have their food source. So if the primary producers population decreases, Herbivores will not have enough source of food, to feed on. Their growth rate will be limited by this lack. They might be so affected that their population will probably decline. This will affect primary consumers, and so on. The whole chain will be affected because the base of the trophic web is missing.
Answer:
D is your choice.
Explanation:
"Is it the year 2017?" might be an example of which concept?
a) Pneumograph
b) Detection cue
c) Control question
d) Pre-test
Answer: C. Control Question
Question 5 of 25
Which measurements could create more than one triangle?
A. Sides measuring 3 cm, 8 cm, and 15 cm
B. Sides measuring 10 cm and 20 cm and an included angle
measuring 50°
C. Angles measuring 100°, 10°, and 70°
D. Angles measuring 110°, 40°, and 40°
SUBMIT
The measurements that could create more than one triangle are options C and option D.
Explanation: For a triangle to exist, the sum of any two sides of a triangle must be greater than the length of the third side.
In option C, the angles measuring 100°, 10°, and 70° do not satisfy this condition, as the sum of the angles 10° and 70° is less than 100°, making it impossible to form a triangle. However, by rearranging the angles, such as 10°, 70°, and 100°, we can create a valid triangle.
In option D, the angles measuring 110°, 40°, and 40° also violate the condition for a triangle, as the sum of the angles 40° and 40° is less than 110°. However, by rearranging the angles, such as 40°, 40°, and 110°, we can create a valid triangle.
For more such answers on triangle
https://brainly.com/question/27401240
#SPJ8
Describe the mechanism of glycolysis in detail
The process of Glycolysis is a catabolic process in which two molecules glucose goes through a ten- step pathway and yield two molecules of pyruvate . It is a major part of carbohydrate metabolism .
Mechanism Of Glycolysis
The glycolysis is also known as EMP pathway and it is involved in both aerobic and anaerobic conditions .There are two phases in the mechanism of glycolysis in which 5 reactions takes place in each phase and the process of glycolysis takes place in cytosol
Preparatory phase refers to the generation of two molecules of glyceraldehyde 3-phosphate from one molecule of glucose which further goes into the payoff phase . In this phase two molecules of ATP are used and two regulatory enzymes were involved in this reaction .
Payoff phase refers to the further break down of two molecules of glyceraldehyde3-phosphate to two molecules of pyruvate . In this phase four molecules of ATP and two molecules of NADH are generated . In this phase only one regulatory enzyme is involved which is the breakdown of PEP to pyruvate .
Both the phases of glycolysis takes place in the cytoplasm and there are three enzymes that involved in regulating the glycolytic pathway .This process is also known as the catabolic process .
To learn more about glycolysis
https://brainly.com/question/26990754