Answer:
1. not sure I think B 2. is D
Explanation:
3. ¿Cuál es el valor de la constante efectiva de dos resortes idénticos conectados en serie que está utilizando un artista para una instalación de la próxima bienal, si la constante de cada uno de ellos es de 200 N/m y sobre los cuales cuelga un determinado peso?
Alguien me ayuda
The effective spring constant of the two identical springs connected in series is 100 N/m.
The effective spring is a constant of two identical springs connected in series, each with a spring constant of 200 N/m, that an artist is using for an installation at an upcoming art exhibition.
When springs are connected in series, their effective spring constant is less than the spring constant of each individual spring. The effective spring constant is given by the equation:
1/keff = 1/k1 + 1/k2 + ...
where keff is the effective spring constant, k1, and k2 are the spring constants of the individual springs, and the ellipsis represents any additional springs in the series.
In this case, since there are only two springs connected in series, the equation simplifies to:
1/keff = 1/200 + 1/200
1/keff = 2/200
1/keff = 1/100
Solving for keff, we get:
keff = 100 N/m
To learn more about spring constant
https://brainly.com/question/14670501
#SPJ4
Complete question:
What is the value of the effective constant of two identical springs connected in series that an artist is using for an installation of the next biennial, if the constant of each of them is 200 N/m and on which a certain weight hangs?
what direct effect does carbon dioxide have on otters
When otters are in an environment with a lot of carbon dioxide l, they breathe more quickly to get rid of the excess. This also means that they are also taking in more oxygen.
Hope this helps :)
Question 5
From the broadest to the most specific, list the levels of ecological organization?
Your answer:
Cell, tissue, organ, organ system, organism
Organization, population, community, ecosystem, biosphere
Organism, cell, tissue, organ system, population
Biosphere, ecosystem, community, population, organism
Complete the table by filling in the missing information. Use these choices:
frameshift
substitution
7. UGU-CCG-GAA-CGA
UGC-CGG-GAA-CGA
8. GAA-CGU-AGC-GGU
GAU-CGU-AGC-GGU
9. UGU-UUC-CCU-UAA
UGU-UCC-CUU-AA
Answer:
7. Substitution mutation
8. Substitution mutation
9. Frameshift mutation
Explanation:
A substitution mutation is any kind of mutation that involves replacement of one or more nucleotide base by another in a sequence.
A frameshift mutation, on the other hand, is a mutation that changes the reading frame of the sequence. Two types of mutations cause frameshift viz: insertion and deletion mutation.
In the following sequences, mutation has occured as follows:
7. UGU-CCG-GAA-CGA to UGC-CGG-GAA-CGA - Substitution mutation has occured because nucleotides C and G has replaced C and U in the first and second codons respectively.
8. GAA-CGU-AGC-GGU to GAU-CGU-AGC-GGU- A substitution mutation because nucleotide U has replaced A in the first codon.
9. UGU-UUC-CCU-UAA to UGU-UCC-CUU-AA - A frameshift mutation because nucleotide U has been removed from the second codon, hence, causing a change in the reading frame.
a) Describe the mental preoccupation, mood dependency and idealization "symptoms of romantic infatuation. b) What is the average time course of infatuation, reasons that it eventually declines, and its theorized function? c) In theory, what is the underlying neurochemistry of the infatuation and attachment phases? d) Name and define the two most important factors in determining whether an infatuation will develop into an attachment bond.
a) Symptoms of romantic infatuation include mental preoccupation: People who are in love frequently have constant thoughts about the person they are in love with. They could fantasize about them, consider their relationships frequently, and idealize their traits.
Dependency on mood: The presence or absence of the person you're infatuated with might have a significant impact on how you're feeling. The level of attention and affirmation they receive from the subject of their infatuation may determine how happy and emotionally stable they are.
b) Infatuation normally lasts between a few months and a number of years, however, the duration might vary. Infatuation eventually fades for a number of reasons, including:
Familiarity: As the novelty and early thrill fade off, people begin to view the object of their love more realistically, taking into account all of their defects.
Lack of reciprocation can result in disappointment and a fall in the mood if the enamored sentiments are not reciprocated or the relationship does not develop as desired.
c) Various neurotransmitters and hormones are involved in the neurochemistry that underlies the infatuation and attachment phases. Neurotransmitters including dopamine and norepinephrine, which are linked to reward, motivation, and pleasure, are in high concentration during the infatuation period. Infatuation is characterized by strong pleasure and excitement, which are facilitated by these neurotransmitters.
d) To assess if an infatuation will turn into an attachment connection, the following two characteristics are crucial:
Mutual attraction is necessary for the infatuation to possibly develop into a deeper relationship. Both people must sense mutual attraction and interest. It is improbable that an infatuation between two people would survive if the other person does not share the same sentiments.
To learn more about preoccupation here
https://brainly.com/question/3499330
#SPJ4
Guys, please. I genuinely need help! If you don't know- don't answer. And please don't look it up on g00gle, those type of answers are always unrelated to the topic.
I need this question answered and an explanation.
I will give brainliest to whoever answered correctly, plus a thanks and a five-star rating.
Answer:
I want to say Substitution.
Explanation:
They removed the number 5, and inserted an A, which makes me believe its substitution.
At first, I thought it was Insertion when they added the A, but i had to look back again and see that the 5 was removed.
Can't be duplication, since no number/letter was duplicated.
And it can't be Deletion, since another thing was inserted,
I hope this helps!!
#teamtrees #WAP (Water And Plant) #ELM (Every Life Matters)
In which of the following would competition not occur?
A Rabbits grazing in a field
B Owls and foxes hunting for mice
с Daisies and dandelions growing in a lawn
D Algae and fish in a loch
HELP PLS‼️ *due today* THANK UU
Write T or True if the statement is true; write F or False if the statement is false.
1. All living things are composed of one or more cells. True or False?
2. Vacuoles can store water, nutrients, and waste in animal cells. True or False?
3. DNA is found in the nucleus. True or false?
4. The rough ER does not have ribosomes attached to it. True or False?
This statement is true according to the cell theory. The cell theory is a fundamental scientific theory of biology that states that all living organisms are composed of cells. Cells are the basic units of structure and function in living things. Cells can be either unicellular (consisting of a single cell) or multicellular (consisting of many cells). Cells can only arise from preexisting cells by cell division. The cell theory was first proposed by German scientists Theodor Schwann and Matthias Schleiden in 1838 and later refined by Rudolf Virchow in 1858. The cell theory is one of the core principles of biology that explains the diversity and unity of life.
-------------------------------------------------------------------------------------------------------------
This statement is true but not complete. Vacuoles are membrane-bound organelles that can be found in both animal and plant cells. In animal cells, vacuoles are generally small and help sequester waste products. They also play a role in transporting materials into and out of the cell. However, vacuoles can also store water, nutrients, and other substances in animal cells, depending on the needs of the cell. For example, some animal cells have contractile vacuoles that regulate water balance by expelling excess water from the cell1. Some animal cells also have food vacuoles that store nutrients obtained by phagocytosis or pinocytosis. Therefore, a more accurate statement would be: Vacuoles can store water, nutrients, and waste in animal cells, but they also have other functions.
----------------------------------------------------------------------------------------------------------
This statement is true but is also a not complete. DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms. Nearly every cell in a person’s body has the same DNA1. Most DNA is located in the cell nucleus (where it is called nuclear DNA), but a small amount of DNA can also be found in the mitochondria (where it is called mitochondrial DNA or mtDNA). Therefore, a more accurate statement would be: DNA is mostly found in the nucleus, but also in the mitochondria.
----------------------------------------------------------------------------------------------------------
This statement is false. The rough endoplasmic reticulum (rough ER) is a part of the endomembrane system of the cell and a subset of the endoplasmic reticulum (ER). This organelle is primarily concerned with the synthesis, folding and modification of proteins, especially those that need to be delivered to different organelles within the cell, or secreted from the cell. The rough ER is characterized by the presence of membrane-bound ribosomes that give it a distinctive appearance under the microscope. These ribosomes look like studs and distinguish the organelle from the smooth sections of the ER. Some proteins are also synthesized by strings of ribosomes, called polysomes. Therefore, a correct statement would be: The rough ER does have ribosomes attached to it.
----------------------------------------------------------------------------------------------------------
certain biologists are currently investigating the role played by spindle fibers in chromosomes movement toward the poles. Check your text for the discussion of one hypothesis, and briefly summarize it.
The role played by spindle fibers in chromosome movement toward the poles is that certain biologists are investigating the hypothesis that the spindle fibers actively move the chromosomes by exerting force on them.
This hypothesis is based on the observation that spindle fibers are organized in a specific way during cell division and that they are connected to the chromosomes at specific locations called kinetochores.
The explanation behind this hypothesis is that the spindle fibers are composed of microtubules, which are protein structures that can grow and shrink in length. During cell division, the spindle fibers attach to the chromosomes at the kinetochores and then begin to exert force on them by growing or shrinking in length. This force causes the chromosomes to move toward the poles of the cell, where they will eventually be separated into two daughter cells.
While this hypothesis is still being investigated, it has the potential to provide new insights into the complex process of cell division and could lead to the development of new treatments for diseases that involve abnormal cell division, such as cancer.
To know more about kinetochores refer to
https://brainly.com/question/29035736
#SPJ11
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
which is not a way that ancient people classified plants and animals
One way that ancient people did not use to classify plants and animals is based on their genetic or evolutionary relationships.
Ancient classifications of plants and animals were typically based on observable characteristics such as appearance, behavior, and usefulness. They relied on morphological features like shape, size, color, and habitat to group organisms together.
Ancient classifications often focused on practical aspects such as medicinal uses, edible properties, or cultural significance. For example, plants might have been classified based on their healing properties or their suitability for food or construction materials. Animals might have been categorized based on their physical traits, such as their ability to fly or swim.
However, ancient people did not have access to the scientific understanding of genetics or the tools to study DNA sequences, which are fundamental in modern taxonomy. They lacked the knowledge of shared ancestry and evolutionary relationships that form the basis of modern classification systems such as cladistics and phylogenetics.
Therefore, the genetic or evolutionary relationships between organisms were not considered in ancient classifications, distinguishing them from the approach used in modern biological taxonomy.
Know more about evolutionary relationships here:
https://brainly.com/question/28244924
#SPJ8
the goal of thermoregulation is to maintain the core temperature of the body steady at around .
The goal of thermoregulation is to maintain the core temperature of the body steady at around 97.7-99.5 degrees F.
Thermoregulation- Through a process known as thermoregulation, mammals carefully and independently control their body temperature. Temperature regulation is a technique for preserving the normal internal temperature (homeostasis) required for living.
Homeostasis- Any self-regulating process, such as homeostasis, helps an organism retain stability while responding to environmental factors that are favorable for its survival. If homeostasis is effective, life goes on; if it is not, the organism dies or suffers a catastrophe. For Example, Body temperature control in humans is one of the most familiar examples of homeostasis.
To know more about the Thermoregulation, click on the below link,
https://brainly.com/question/7450241
#SPJ4
Angiosperms are more advanced than gymnosperms because gymnosperm lack which structure?
Angiosperms are more advanced than gymnosperms because gymnosperms lack ovarian structure.
How their seeds are made is the primary distinction between angiosperms and gymnosperms. A protective fruit surrounds the developing angiosperm seeds, which are found in the ovaries of flowers.
Gymnosperms cannot thrive in as many different types of settings as flowering plants can. Gymnosperms mature more slowly than flowering plants, which also yield more seeds. Angiosperm woody tissues are considerably more intricate and specialized.
The primary sexual reproduction-related adaptation of angiosperms is flowers. Angiosperms have pollen that is only 3 cells long, resulting in more effective pollination and fertilization. Pollen is produced by stamens, which facilitates diverse pollination strategies.
To learn more about angiosperms refer to:
https://brainly.com/question/9416370
#SPJ4
Select all inheritance patterns in which 50% of the functional protein is sufficient to produce a wild-type phenotype: 1) Simple Mendelian dominant alleles 2) An X-linked dominant allele in a heterozygous female 3) Haploinsufficient genes 4) Incomplete dominance
The inheritance patterns in which 50% of the functional protein is sufficient to produce a wild-type phenotype are: Haploinsufficient genes and X-linked dominant allele .
Haploinsufficient genes: In haploinsufficient genes, a single copy of a functional allele is sufficient to produce a wild-type phenotype. This is because the presence of a single functional allele produces enough functional protein to perform its normal cellular functions.
X-linked dominant allele in a heterozygous female: In this inheritance pattern, a dominant allele located on the X chromosome results in a wild-type phenotype when present in a heterozygous female. This is because females have two X chromosomes, so the presence of a single functional allele on one X chromosome is sufficient to produce enough functional protein to produce a wild-type phenotype.
These inheritance patterns contrast with Simple Mendelian dominant alleles and incomplete dominance, in which both copies of the allele must be functional to produce a wild-type phenotype. In simple Mendelian dominant alleles, an individual with a single dominant allele will express the dominant phenotype. In incomplete dominance, neither allele is completely dominant, and a blend of the two alleles' phenotypes is expressed.
Learn more about inheritance patterns at : https://brainly.com/question/25632001
#SPJ4
How can we prevent climate change on Earth?
1. Urge government to take bold, ambitious climate action.
2. Use energy wisely.
3. Get charged up with renewables.
4. Eat for a climate-stable planet
5. Start a climate conversation
6. Green your commute
7. Consume less, waste less
8. Invest in renewables and divest from fossil fuels
9. Mobilize for local climate action
10. Get politically active and vote
Scientific models are based on a set of observations.
Please select the best answer from the choices provided
OT
0 F
Answer:
Scientific models are based on a set of observations. Scientific models are based on current knowledge, which can limit their effectiveness when new discoveries are made. ... Scientists utilize models for a variety of different purposes, but each type of scientific model has limitations.
Explanation:
thank me later
When the nerve cell is said to be resting this is interepreted to mean: O The cell is depolarized, the outisde is negative and the inside is positive O The cell is depolarized, the outisde is positive and the inside is negative. O The cell is polarized, the outisde is positive and the inside is negative O The cell is polarized, the outisde is negative and the inside is positive.
When the nerve cell is said to be resting, it means that the cell is polarized, the outside is positive and the inside is negative.
What is a nerve cell? A nerve cell, also known as a neuron, is an electrically excitable cell in the nervous system that communicates with other cells through specialized connections called synapses. A nerve cell is the structural and functional unit of the nervous system in charge of carrying electrical impulses throughout the body.
What is polarization?Polarization is a term used to describe the separation of electrical charges across a cell membrane. A resting nerve cell is polarized, indicating that the electrical charge of the cell's interior is negative in comparison to the charge of the cell's exterior. The inside of the cell is negative in comparison to the outside, so the resting potential is negative. During resting, the membrane potential of a nerve cell ranges from -60 to -70 mV.
Learn more about resting nerve cell at https://brainly.com/question/32138044
#SPJ11
Different microscopic organisms cause different diseases. When a dangerous microscopic organism is transferred from one person to many people, the disease it carries will spread. Why is this considered a theory instead of a hypothesis or a law? It is a statement of fact about how nature works instead of an explanation. It provides an explanation for many observations and accepted hypotheses. It describes how to test a possible explanation of one specific relationship. It has not changed over time even though new technology has been developed.
Answer:
The correct answer is - it provides an explanation for many observations and accepted hypotheses.
Explanation:
The theory is well tested or substantiated explanation for the observation of the natural phenomenon, that included or incorporated various laws, hypothesis, or facts.
It is not just a possible explanation but a well-tested and proven explanation with the help of scientific experiments in a scientific method.
Thus, the correct answer is - it provides an explanation for many observations and accepted hypotheses.
Answer:
Explanation:
the answer is B. for a short answer
chloroplasts were only examined and labeled in the spirogyra slide. relate the function of these organelles to explain why they were not present in the onion root tip slide.
The onion fruiting body (bulb), which is utilized for storing energy rather than photosynthesis, is the reason why the clear epidermal cells are found in a single layer and lack chloroplasts.
A big vacuole, cytoplasm, cell wall, cell membrane, and nucleus are all components of a plant cell. Because they are underground, the roots are shielded from the sun. As a result, they are independent of chloroplasts. Organelles found in plant cells called chloroplasts use the photosynthetic process to change light energy into relatively stable chemical energy. They ensure that life on Earth continues.
The two membranes that surround chloroplasts also include a third complex membrane system called the thylakoids, which includes grana and lamellae. In addition, key chloroplast structures include starch grains, plastoglobules, stromules, eyespots, pyrenoids, etc. It is largely agreed that a free-living, photosynthetic cyanobacterium gave rise to chloroplasts before being absorbed by a eukaryotic cell. The majority of the chloroplast proteins are encoded by nuclear genes, and the gene products are carried into the chloroplast through complicated import machinery. Chloroplasts retain a limited genome. The biogenesis and dynamic three-dimensional structure of chloroplasts depend on these activities.
Learn more about chloroplasts
https://brainly.com/question/13894892
#SPJ4
Leona uses a rechargeable electric toothbrush to brush her teeth as it is used the energy stored in a battery is depleted to make the toothbrush operate what happens when you wanna plug for toothbrush into an electrical outlet to recharge
Answer
the answer is...
electrical energy is converted to chemical energy
i hope i helped :)
Answer:
D: Electrical energy is transformed to chemical energy.
Explanation:
why does protease digest protein but not fat?
Stomach acid helps protease enzymes to destroy harmful microorganisms that may be present in the food. Fats and oils, or lipids, provide insulation and an energy store for our bodies. Helped by bile from the liver, lipase enzymes break down the lipids into fatty acids and glycerol, so they can be stored.
The controls the materials that enter and
leave the cell.
Which process starts the formation of soil? O A. Bedrock breaks down into smaller particles. O B. Rock particles clump together in an aggregate. C. Sediment stays and settles in a location. O D. Sediment moves from one place to another place
Answer:
it is option A as rock needs to be broken down into sediments before it can become soil
PLEASE HELP ME! 5TH GRADE SCIENCE!
Wilbur made a prediction that changing the force applied to a race car would affect the distance it travels. Is Wilbur's prediction correct?
A. No, a weak or a strong force applied to the car does not affect motion.
B. No, the force applied to the car needs to be a strong force and cannot change.
C. Yes, the force applied to the car affects the motion.
D. Yes, the car will travel a longer distance when a weak force is applied.
Answer:
C. Yes, the force applied to the car affects the motion.
Explanation:
list out any four waste materials secreted by human body and describe any two of them?
Answer:
These chemical reactions produce waste products such as carbon dioxide, water, salts, urea and uric acid. Accumulation of these wastes beyond a level inside the body is harmful to the body. The excretory organs remove these wastes. This process of removal of metabolic waste from the body is known as excretion.
Answer:
Thechemical reactions produce waste products such as carbon dioxide, water, salts, urea and uric acid. Accumulation of these wastes beyond a level inside the body is harmful to the body. The excretory organs remove these wastes. This process of removal of metabolic waste from the body is known as excretion.
What instrument is used to measure the average kinetic energy in a substance? calorimeter thermometer spectroscope voltmeter?
Answer:
The instrument used to measure the average kinetic energy of particles in a substance is thermometer. A measure of the average kinetic energy of particles in a substance is temperature
Explanation:
Explain why so many substances are soluble in water.
Explanation:
Water is called the "universal solvent" because it is capable of dissolving more substances than any other liquid .It is water's chemical composition and physical attributes that make it such an excellent solvent. Water molecules have a polar arrangement of oxygen and hydrogen atoms—one side (hydrogen) has a positive electrical charge and the other side (oxygen) had a negative charge. This allows the water molecule to become attracted to many other different types of molecules. Water can become so heavily attracted to a different compound, like salt (NaCl), that it can disrupt the attractive forces that hold the sodium and chloride in the salt compound together and, thus, dissolve it.
Answer:
Universal Solvent
Explanation:
One of the properties of water is that it is a universal solvent. This means is dissolves more substances than any other liquid.
If you wanted to produce a listing of the file contents by last name, area code, city, state, or zip code, how would you alter the file structure?
You can alter the file structure by sorting the file contents by the last name, area code, city, state, or zip code to produce a listing of the file contents.
To produce a listing of the file contents by last name, area code, city, state, or zip code, one needs to alter the file structure. The file structure refers to the organization of data in a file. To sort the file contents by any of the fields mentioned, one would have to rearrange the contents of the file so that they appear in an ordered manner according to the chosen field.
For example, to produce a listing of the file contents by last name, one would need to rearrange the file's contents to appear in alphabetical order by last name. Similarly, to sort by area code, one would need to rearrange the contents of the file in numerical order by area code, and so on. By altering the file structure in this way, it is possible to produce a listing of the file contents that is more organized and easier to read.
Learn more about file structure here:
https://brainly.com/question/30332434
#SPJ11
In noncyclic photophosphorylation, the electrons passed down through the electron transport system are obtained from?.
In non cyclic photophosphorylation, the electrons passed down through the electron transport chain are obtained from water.
Non-cyclic phosphorylation have two Photosystems;
1. photosystem I
2. Photosystem II.
They work in series, first PS II and then PS I and are connected through electron transport chain. Electrons moved from PS II and then passed on to PS I.
The release of electrons from PS II can be replaced by some other electrons which can be came by splitting of the water molecule. The complex responsible for splitting of water molecule is present on PS II. Water molecule is converted into H⁺ , O and electrons are released which can be move through electron transport chain.
To know more about Non cyclic phosphorylation click here
brainly.com/question/14397399
#SPJ4
Which statement best describes what happens during a chemical change?
Both the identity and the properties of a substance change.
Some properties of a substance change, but its identity remains the same.
The chemical properties of a substance change, but its physical properties remain the same.
The physical properties of a substance change, but its chemical properties remain the same.
Answer:
Both the identity and the properties of a substance change
Explanation:
Answer:
Both the identity and the properties of a substance change.
Explanation:
In a chemical change, the matter gets transformed or changed into a new substance. In doing this, the identity of the substance, and its properties change as well.
- I got the question right on the quiz and got 100%
Hope this helps!