_______ involves developing marketing strategies as though the entire world (or its major regions) were a single entity.

Answers

Answer 1

Globalization involves developing marketing strategies as though the entire world (or its major regions) were a single entity.

What is Globalization?

This is referred to the integration of people and government worldwide through advances in technology etc.

This strategy promotes interactions between countries and ensures the products being used in any part of the world thereby making it the most appropriate choice.

Read more about Globalization here https://brainly.com/question/1133228

#SPJ1


Related Questions

A researcher wants to examine whether the degree of authoritarianism (as measured by a survey from 0-60) is a predictor of the number of instances of gender discrimination a person commits per year. What type of statistical test would be appropriate? one-way independent ANOVA Pearson Product Moment-Correlation simple linear regression

Answers

Simple linear regression would be an appropriate statistical test to examine the relationship between the degree of authoritarianism and the number of instances of gender discrimination a person commits per year.

Simple linear regression is used to assess the relationship between two continuous variables, where one variable (predictor variable) is used to predict the value of another variable (dependent variable). In this case, the degree of authoritarianism (measured on a scale from 0-60) serves as the predictor variable, and the number of instances of gender discrimination per year is the dependent variable.

The researcher aims to determine whether there is a relationship between the degree of authoritarianism and the number of instances of gender discrimination. By conducting a simple linear regression analysis, the researcher can examine the nature and strength of the relationship between these variables and determine if the degree of authoritarianism can predict the number of instances of gender discrimination.

The analysis will provide information about the direction and significance of the relationship, allowing the researcher to assess the extent to which the degree of authoritarianism influences the occurrence of gender discrimination.

Learn more about linear regression here:

https://brainly.com/question/13328200

#SPJ11

How do market economies ultimately determine what goods and services are​ produced, how the goods and services will be​ produced, and who will receive the goods and​ services?.

Answers

In market economies, the determination of what goods and services are produced, how they are produced, and who receives them is primarily driven by the forces of supply and demand in the marketplace.

What goods and services are produced: The market economy relies on the principle of consumer sovereignty, which means that consumer preferences and demands ultimately determine what goods and services are produced. Producers and businesses respond to consumer demand by producing goods and services that are in high demand and profitable. Market research, surveys, and sales data analysis are commonly used to assess consumer preferences and anticipate demand.

How goods and services are produced: Market economies typically prioritize efficiency and cost-effectiveness in the production process. Producers strive to minimize costs while maximizing output to remain competitive. They employ various strategies such as implementing advanced technology, optimizing production methods, and seeking economies of scale to enhance efficiency. The profit motive acts as an incentive for businesses to innovate and improve production processes.

Who receives goods and services: In a market economy, the distribution of goods and services is primarily determined by purchasing power. Individuals and households with higher incomes have greater purchasing power and can afford to buy more goods and services. The prices of goods and services are determined by the interaction of supply and demand in the marketplace. Consumers who can afford the prevailing prices can purchase the desired goods and services. However, it is important to note that governments often implement social welfare programs and safety nets to ensure a certain level of access to essential goods and services for those who cannot afford them.

Market economies rely on the interplay of supply and demand to determine what goods and services are produced, how they are produced, and who receives them. Consumer preferences guide producers in deciding what to produce, while efficiency and cost-effectiveness drive the production process. The distribution of goods and services is primarily determined by purchasing power, with those who can afford the prevailing prices being able to acquire them. However, governments also play a role in ensuring access to essential goods and services for all members of society through social welfare programs.

To know more about  economies ,visit;

https://brainly.com/question/28210218

#SPJ11

an employee can be dismissed if their job surplus to requirements' outline why this state ment is false

Answers

Hiring labour is different from buying other goods and services, and the contract between the employer and the employee is incomplete. It does not cover what the employer really cares about, which is how hard and well the employee works.

Which nims management characteristic refers to the number of subordinates.

Answers

Refer to the Numder of this question add with the second number hope this helps.

a small business owner has created a linear regression model to predict the number of new customers who will visit a shop based on the number of times the owner has an advertisement played on the radio. what is the explanatory variable and what is the response variable? responses explanatory: number of new customers; response: number of times the advertisement is played explanatory: number of new customers; response: number of times the advertisement is played explanatory: number of times the advertisement is played; response: number of new customers explanatory: number of times the advertisement is played; response: number of new customers explanatory: number of times the advertisement is played; response: number of purchases made by customers explanatory: number of times the advertisement is played; response: number of purchases made by customers explanatory: number of purchases made by customers; response: number of times the advertisement is played explanatory: number of purchases made by customers; response: number of times the advertisement is played explanatory: number of previous customers; response: number of new customers

Answers

Explanatory variable  is   number of times the advertisement is played and response variable is  number of new customers.

What are explanatory variables?

A response variable is what changes as a result of an explanatory variable being changed (for example, caffeine dose) (e.g., reaction times). Other phrases used in research, such as "explanatory variable" and "response variable," are sometimes interchangeable with these two meanings.

What role does the explanatory variable play?

One variable may be used to forecast or account for variations in another variable in some research projects. In those circumstances, the explanatory variable is utilized to forecast or account for variations in the response variable. The explanatory variable in an experimental study is the variable that the researcher manipulates.

Learn more about explanatory variables

brainly.com/question/19522839

#SPJ4

Lindsay is an inventory planner at a local retailer. she is currently making a decision as to how many units she should stock in the store based on projected demands of consumers. she has determined that she should keep 200 units in the store because an additional unit would not sell. this is an example of:

Answers

This is an example of: marginal analysis.

Marginal analysis is the study of the incremental benefits of an activity versus the incremental costs incurred by the same activity. Businesses use marginal analysis to help them make decisions to maximize their potential profits. Compare the value added of an activity to the additional costs incurred by the same activity

Marginal analysis also addresses the conditions under which, in the face of expected or actual change, a firm can continue at the same cost as producing a single unit or service. The dominant principle here is adaptation to change. The idea is that the firm will continue to invest until the marginal return from each additional unit equals the marginal cost of production, making a profit.

For more information on Marginal analysis , visit :

https://brainly.com/question/30111064

#SPJ4

Stacey Yung wants to open a Pizza Hut restaurant in Beijing and has an agreement with the restaurant chain in which she can use the trademark and must also follow a strict set of guidelines detailing how the business should operate. The Pizza Hut Corporation will receive a percentage of Stacey's revenues from her restaurant. What type of entry mode does this represent?
a. franchising
b. licensing
c. turnkey operation
d. wholly owned subsidiary
e. acquisition

Answers

Option (a), franchising. Stacey Yung has an agreement with Pizza Hut to use their trademark and follow their guidelines in exchange for a percentage of her revenues. This is a common characteristic of a franchise agreement.

Franchising is a popular entry mode for businesses looking to expand globally because it allows them to enter new markets with relatively low risk and capital requirements. In a franchise agreement, the franchisor (in this case, Pizza Hut) provides the franchisee (Stacey Yung) with the rights to use their brand and business model, as well as ongoing support and training. In exchange, the franchisor receives a portion of the franchisee's revenues.

Franchising is attractive to both parties because it allows the franchisor to expand quickly without the need for large investments in capital or personnel, while the franchisee benefits from the established brand recognition and support provided by the franchisor. However, franchise agreements can also be complex and require careful negotiation and management to ensure the success of both parties.

Learn more about Franchising: https://brainly.com/question/29376853

#SPJ11

Write a paragraph (minimum five sentences) explaining how career and educational planning are related to financial planning. Give an example from your own life about how you are making career and education choices that will impact your finances.

Answers

complementing both your financial needs and career goals. balancing the educational requirements with your career goals. choosing well for oneself. finding out how to combine your schedule with your financial and educational obligations.

Why is career planning so important in terms of financial planning?

The quantity of money you really require to achieve your goals, which is defined by your job's compensation, will place restrictions on your financial plan.

Your choice of work has an impact on your financial planning, especially when you consider the educational requirements, expected salary, and characteristics of the chosen profession. Each profession has a different set of working hours, compensation, benefits, risks, and long-term growth patterns.

The role's entry-level position is held by an FP&A analyst. Analysts aspire to managerial positions or directorships in the future. It may take two to five years for a position to advance. Unlike employment in investment banking or other sections of the capital markets, you may stay at a specific level for the duration of your career.

The benefits of becoming a financial advisor include the potential for infinite income, a flexible work schedule, and the chance to start one's own company. The drawbacks include a lot of stress, the work needed to build a clientele, and the constant need to meet regulatory requirements.

Your choice of job has an influence on your financial planning, taking into account the educational requirements, predicted remuneration, and characteristics of the chosen career. Each career has an own set of work hours, pay, benefits, risks, and long-term growth trends.

Learn more about financial plan: https://brainly.com/question/29763313

#SPJ1

a perpetuity is a constant stream of cash flows without end. why doesn’t it have an infinite value? under what cases can we easily calculate its value?

Answers

A perpetuity is a financial instrument that promises to pay a fixed amount of cash flow at regular intervals indefinitely. While the cash flows from a perpetuity are constant and never-ending, its value is not infinite due to the time value of money.

The time value of money is the concept that money available in the present is worth more than the same amount of money in the future due to its potential earning capacity. As time goes by, the value of money decreases due to factors such as inflation and opportunity cost.

For example, let's say you have the option to receive $100 every year for an indefinite period. While this may seem like a valuable asset, its value is not infinite because the future payments are worth less than the present payment due to the time value of money. To calculate the value of a perpetuity, we need to discount each future cash flow to its present value using an appropriate discount rate that takes into account the time value of money.

We can easily calculate the value of a perpetuity when the cash flow and the discount rate are fixed and the same for all future periods. In this case, the present value of the perpetuity can be calculated by dividing the cash flow by the discount rate. The formula for the present value of a perpetuity is:

Present value of perpetuity = Cash flow / Discount rate

For example, if the cash flow from a perpetuity is $1,000 per year and the discount rate is 5%, the present value of the perpetuity would be $20,000 ($1,000 / 0.05 = $20,000).

However, if the cash flow or the discount rate changes over time, the value of the perpetuity becomes more complicated to calculate and may require the use of more advanced financial formulas.

To know more about  perpetuity refer here

https://brainly.com/question/28205403#

#SPJ11

A perpetuity is a constant stream of cash flows often involve more complex factors such as changing cash flows or varying discount rates, so it have an infinite value, we can calculate its value when the cash flows are received at regular intervals and remain constant over time

While it may seem logical for a stream of cash flows without end to have an infinite value, in reality, the value of a perpetuity is not infinite due to the concept of present value and time value of money.

The value of a perpetuity is determined by discounting its future cash flows to their present value. Since money has a time value, meaning that a dollar received in the future is worth less than a dollar received today, the future cash flows of a perpetuity are discounted at an appropriate interest or discount rate.

This discounting process accounts for the fact that the farther into the future the cash flows occur, the less valuable they are in today's terms. Under certain cases, the value of a perpetuity can be easily calculated. One such case is when the cash flows are received at regular intervals and remain constant over time.

In this scenario, the value of the perpetuity can be calculated using a simple formula: Value = Cash Flow / Discount Rate. This formula assumes that the cash flows continue indefinitely at a constant rate and the discount rate remains constant.

However, in real-world situations, perpetuities often involve more complex factors such as changing cash flows or varying discount rates. In these cases, the calculation of perpetuity value requires more advanced financial modeling techniques, such as the use of present value formulas, annuity calculations, or other mathematical methods.

To learn more about perpetuity , refer below:

https://brainly.com/question/28205403

#SPJ11

1. __________ is a disadvantage of open-source software
A) Training Time
B) Reliability
C) Flexibility
D) Quality
2. ___________ is a disadvantage of open-source software
A) Reliability
B) Compatibility
C) Ease of use
D) Training time
3. __________ is a disadvantage of open-source software
A) Quality
B) Cost
C) Ease of use
D) Reliability

Answers

Disadvantages of open-source software include concerns about quality, ease of use, and reliability.

Quality: Open-source software may have varying levels of quality control since it is developed and maintained by a community of volunteers. There is no single entity responsible for ensuring the software's quality, which can lead to inconsistencies and potential bugs.

Ease of use: Open-source software may not always prioritize user-friendliness and intuitive interfaces. The development focus is often on functionality and customization, which can result in a steeper learning curve and less streamlined user experiences.

Reliability: Since open-source software relies on a community of contributors, there may be concerns about the long-term maintenance and support. If key contributors leave or the community loses interest, updates, bug fixes, and security patches may become less frequent, affecting the software's reliability.

It's important to note that these disadvantages do not apply to all open-source software projects. Many open-source projects have robust quality control measures, user-friendly interfaces, and dedicated communities for support. Additionally, some commercial companies provide professional support and services for open-source software, addressing concerns about reliability and ease of use. Ultimately, the advantages and disadvantages of open-source software should be evaluated on a case-by-case basis.

Learn more about open-source from the given link:

https://brainly.com/question/31844015

#SPJ11

Do you agree with McDonald's minimizing their restaurant menu? What made it more
efficient? What has changed since this movie with menu items at McDonalds?

Answers

Yes, i am agree with McDonald's minimizing their restaurant menu.

By March 2017, McDonald's originally intended to fulfill their commitment on antibiotic-free chicken. The business was able to bring this transformation to its customers almost a year earlier than expected because to extensive cooperative work with its farmers and suppliers. All of McDonald's chicken products, including the brand-new Poultry McNuggets , are now manufactured with chicken that has not been given antibiotics crucial to human health.    

According to Dr. H Morgan Scott, a professor of epidemiology in the Department of Veterinary Pathobiology at Texas A&M University, that "I commend initiatives like those made by McDonald's to significantly limit the use of medically critical antibiotics in its animal agricultural food supply chain in close cooperation with its suppliers and poultry farm".        

McDonald's and its suppliers have attempted to find suitable substitutes for maintaining the welfare of the animals without compromising broiler flock health. Industry leaders' sourcing choices, like those of McDonald's, have a tremendous deal of ability to promote proper antibiotic management throughout the global food animal industries.

What made it more efficient?

As the business develops, McDonald's USA  announced a number of changes to its menu. This comprises:

Several products, including its renowned Chicken McNuggets , that don't contain artificial colors or flavors are being rid of artificial preservatives. The scrambled eggs on its breakfast platters and the pork sausage patties and omelet-style eggs offered on McGriddles, Bagel and Biscuit breakfast sandwiches are now also free of artificial preservatives.

This month, new buns that don't contain high fructose corn syrup will be introduced, including those that go on Filet-O-Fish, Big Mac, Quarter Pounder, hamburger, and cheeseburger sandwiches. High fructose corn syrup was never present in the Artisan roll that was first released in 2015.

Roughly a year ahead of schedule, a significant pledge to only offer chicken that has not been given an antibiotic treatment was fulfilled.

The modifications affect the ingredients in roughly half of the items on the McDonald's menu.

More than ever, consumers are concerned about their food's origins, ingredients, and preparation methods, according to Mike Andres, president of McDonald's USA ".We're making adjustments to make sure the food we're proud of is also food that customers enjoy and feel good about eating, and we're still committed to McDonald's ongoing food journey"

What has changed since this movie with menu items at McDonalds?

announcing an industry-leading pledge to acquire 100% cage-free eggs in the US and Canada by 2025 in September 2015. The Humane Society of the United States reports that more than 100 businesses have since made similar announcements, demonstrating the positive impact on the sector as a whole.In June 2015, fresh romaine, baby spinach, and baby kale replaced the iceberg lettuce in McDonald's premium salad blend. In June 2016, Tuscan red leaf lettuce and ribbon-cut carrot curls were added as further improvements. At least 2.5 cups of veggies are included in the freshly made Premium Salads.By switching from margarine to 100% real butter* and keeping a freshly cracked Grade A egg at the core of the dish, McDonald's is reviving its iconic Egg McMuffin.Go-GURT low fat yogurt and milk for its low-fat milk jugs come from cows not given the synthetic growth hormone rbST*.In August 2015, unveiled Buttermilk Crispy Chicken, a dish created with real buttermilk, only chicken breast filet, and a blend of spices including black pepper, garlic powder, and onion powder. Following the launch of artisan grilled chicken in March 2015, this happened.  

To know more about McDonald's menu, visit:https://brainly.com/question/28570070

#SPJ9

Suppose an investor is appraising an investment under the following conditions: Forecast 1 2 3 4 NPV 30,000 20,000 15,000 10,000 Р. 0.15 0.15 0.50 0.20 (i) Find the investment's expected value, standard deviation, and the coefficient of variation (ii) Would the risk-averse investor prefer this investment to a risk-free investment with a NPV of $10,000? Explain. (iii) Would the risk-averse investor prefer this investment with an expected NPV of $12,000 and a standard deviation of $12,000? Explain

Answers

i. The investment's expected value, standard deviation, and the coefficient of variation are  16,750; 33,718,750 and 34.68% respectively.

ii. even if the predicted return of the riskier investment is greater than the return on the risk-free investment, the risk-averse investo would choose the safer option.

iii. Even if this investment's projected NPV is greater than that of the risk-free investment, the risk-averse investor would not favor it over the latter.

(i) To find the investment's expected value, we multiply each forecasted NPV by its corresponding probability and sum the products:

Expected NPV = (0.15 x 30,000) + (0.15 x 20,000) + (0.50 x 15,000) + (0.20 x 10,000) = 16,750

To find the standard deviation, we need to calculate the variance first. The variance of the NPV is given by:

Var(NPV) = (0.15 x (30,000 - 16,750)^2) + (0.15 x (20,000 - 16,750)^2) + (0.50 x (15,000 - 16,750)^2) + (0.20 x (10,000 - 16,750)^2) = 33,718,750

So the standard deviation is the square root of the variance:

SD(NPV) = sqrt(33,718,750) = 5,805.87

The coefficient of variation (CV) is the ratio of the standard deviation to the expected value:

CV = (SD(NPV) / Expected NPV) x 100% = (5,805.87 / 16,750) x 100% = 34.68%

(ii) Whether the risk-averse investor prefers this investment to a risk-free investment with a NPV of $10,000 depends on the investor's risk tolerance. If the investor is risk-averse, they would prefer a risk-free investment over a risky investment, even if the expected return of the risky investment is higher than that of the risk-free investment.

In this case, the investor would not prefer this investment, since its expected NPV of $16,750 is higher than the NPV of the risk-free investment, but its risk (as measured by the standard deviation or CV) is also higher.

(iii) Whether the risk-averse investor prefers this investment with an expected NPV of $12,000 and a standard deviation of $12,000 depends on the investor's risk tolerance and their attitude towards risk and return tradeoff.

If the investor is willing to take on more risk for higher potential returns, they might prefer this investment over a risk-free investment with a lower NPV of $10,000.

However, the risk-averse investor would still consider the risk of this investment too high, as the CV is still quite high (44.78%). Therefore, the risk-averse investor would not prefer this investment over a risk-free investment, even though its expected NPV is higher than that of the risk-free investment.

Learn more about invesment at https://brainly.com/question/21051878

#SPJ11

other things equal, when the supply of workers is low, one would predict that market wages would be

Answers

other things equal, when the supply of workers is low, one would predict that market wages would be the supply of labor is low.

The amount of work sought will decrease, and the demand curve will shift upward. If salaries and wages decline, employers are more likely to expand their workforce. The demand curve will slope downward as the quantity of labor needed increases.

The supply of labor curve's key relationship is the barter between work and leisure. More people opt to work as a result of higher earnings, which increases the possible losses of leisure. The substitutability effect of rising wages causes labor supply to rise while the income effect of rising wages causes it to fall.

Most economics textbooks taught that salaries were influenced by demand and supply just like any other price. Due to the fact that employees provide it and companies.

Learn more about labor here:

https://brainly.com/question/12481537

#SPJ4

True or False, suppose that $600 is deposited at the end of every year into an account paying interest of 7% per year. at the end of twelve years the account will be worth approximately $8,944

Answers

True, if $600 is deposited at the end of every year into an account paying interest of 7% per year, at the end of twelve years the account will be worth approximately $8,944.

What is Future Value?

Future value is the value of an item computed on a given value at a given specific interest rate after a specific number of years. It is constantly rising, and when it is falling, it is referred to as a depreciating value.

We can calculate the value of the account after twelve years by using the formula for the future value of an annuity:

FV = PMT × [(1 + r)n – 1]/r. Therefore, FV = $600 × [(1 + 7%)12 – 1]/7%. FV = $8,944 (rounded to the nearest dollar). Therefore, if $600 is deposited at the end of every year into an account paying interest of 7% per year, at the end of twelve years the account will be worth approximately $8,944.

learn more about Future Value here:

https://brainly.com/question/2472793

#SPJ11

a client with raynaud's phenomenon is prescribed diltiazem. an expected outcome is:

Answers

One expected outcome of prescribing diltiazem to a client with Raynaud's phenomenon is the improvement of symptoms, specifically in reducing the frequency and severity of vasospastic episodes.

Raynaud's phenomenon is a condition characterized by the narrowing of blood vessels, leading to reduced blood flow to the extremities, such as fingers and toes. This can result in color changes, numbness, tingling, and pain in the affected areas. Diltiazem is a medication classified as a calcium channel blocker, and it is commonly used in the management of Raynaud's phenomenon.

Diltiazem works by relaxing and dilating the blood vessels, which helps improve blood flow to the extremities. By reducing the constriction of blood vessels, diltiazem can alleviate the symptoms of Raynaud's phenomenon. It can help prevent or decrease the frequency and severity of vasospastic episodes, reducing the discomfort and pain experienced by the client.

It is important to note that the specific response to diltiazem may vary among individuals. The effectiveness of the medication and the degree of symptom improvement can depend on various factors, including the severity of Raynaud's phenomenon, the dosage prescribed, and the individual's overall health. Regular monitoring and communication with a healthcare professional are essential to ensure optimal outcomes and adjust the treatment plan if needed.

Learn more about vasospastic episodes here:

https://brainly.com/question/29430762

#SPJ11

Identify and explain 2 reasons why a business such as AEC could not be successful without other firms providing natural resources

Answers

Answer:

AEC needs rubber to make its seals too. Oil is needed to produce rubber and, like coal and iron ore, oil is a natural resource. Without oil, AEC would have no rubber for seals. Natural resources are declining over time + coal reserves, especially, are running out.

Answer:

Identify and explain 2 reasons why a business such as AEC could not be successful without other firms providing natural resources

Explanation:

AEC needs rubber to make its seals too. Oil is needed to produce rubber and, like coal and iron ore, oil is a natural resource. Without oil, AEC would have no rubber for seals. Natural resources are declining over time + coal reserves, especially, are running out.

State two ways by which hotels may promote sales during the off season​

Answers

Answer:

Use off-season imagery on your website. ...

Create content dedicated to the off-season. ...

Build content around weddings, meetings, sporting events. ...

Update your ad copy with off-season friendly verbiage. ...

Create campaigns that market off-season amenities...

Explanation:

Hope it helps u

FOLLOW MY ACCOUNT PLS PLS

A company has $85,000 in outstanding accounts receivable, and it uses the allowance method (balance sheet method) to account for uncollectible accounts. Experience suggests that 5% of outstanding receivables are uncollectible. The current balance (before adjustments) in the allowance for doubtful accounts is an $1,800 credit. The journal entry to record the adjustment to the allowance account includes a debit to Bad Debts Expense for:

Answers

The journal entry to record the adjustment to the allowance account includes a debit to Bad Debts Expense for $4,250.

To determine the amount to debit to the Bad Debts Expense account, we need to calculate the necessary adjustment to the allowance for doubtful accounts.

Given:
Outstanding accounts receivable = $85,000
Percentage of uncollectible accounts = 5%
Current balance in allowance for doubtful accounts = $1,800 credit

Step 1: Calculate the necessary adjustment for the allowance account.
The adjustment is calculated by multiplying the outstanding accounts receivable by the percentage of uncollectible accounts:
$85,000 x 5% = $4,250

Step 2: Determine the direction of the adjustment.
Since the current balance in the allowance for doubtful accounts is a credit, and we need to increase it by $4,250, we will debit the allowance for doubtful accounts.

Step 3: Record the journal entry.
The journal entry to record the adjustment would be as follows:
Debit: Allowance for Doubtful Accounts $4,250
Credit: Bad Debts Expense $4,250

So, the journal entry to record the adjustment to the allowance account includes a debit to Bad Debts Expense for $4,250.

Learn more about journal entry

https://brainly.com/question/33438461

#SPJ11

The amount loaned and borrowed is ________.

a. principal plus interest

b. principal less interest

c. interest

d. principal

Answers

The amount loaned and borrowed is the "principal."

The principal refers to the original sum of money that is borrowed or loaned, without including any interest or additional charges. It represents the initial amount of money that is involved in a loan transaction or investment.

The principal amount serves as the basis for calculating interest payments and determining the total amount to be repaid. Interest is calculated based on the principal and the applicable interest rate. Therefore, the principal amount remains the same throughout the loan term or investment period, while interest may accrue and be added to the principal over time.

In summary, the principal represents the actual amount of money that is loaned or borrowed, excluding any interest or additional charges associated with the transaction.

learn more about interest principal from this link:

https://brainly.com/question/21273548

#SPJ11

Prime cost is directly related to production. So, per unit prime cost can be calculated easily. While on the other hand, overhead does not have direct relationship with production. So, to calculate per unit cost, overhead is classified according to functions.” Explain this statement and also summarize all the overheads according to their functional classification.

Answers

Basically, a firm's prime cost equals the total direct costs of production which includes the cost of raw materials and labor.

The prime cost equation is {Cost of raw materials + Direct labor}

The overhead cost refers to those cost incurred while running a firm but can not be linked to creation of a product or service.

Overhead expenses is the cost remaining after deduction of direct labor, direct materials and direct expenses.

In conclusion, the prime cost and overhead cost are both significant in production of finished goods.

Read more about overhead cost

brainly.com/question/4473400

Look at the equation framework.

3 empty boxes show the parts of an equation. The first box = the second box minus the third box.
Which of the following lists the proper placement of terms, from left to right, to complete the equation?

revenue, profit, opportunity cost
profit, revenue, production cost
production cost, profit, revenue
opportunity cost, revenue, profit

Answers

Answer:

profit, revenue, production cost

Explanation:

Profit is the rewards or gains realized for engaging in business activities. A business is profitable when revenue is more than the expenses.

Revenue is the income generated from the normal business activities of selling goods and services.

Production costs are the expenses incurred in making goods meant for sale.

Answer:

B

or

profit, revenue, production cost

Explanation:

There are seven commonly used organizational buying criteria. One of them is __________.
price
loyalty
flexibility
adaptability
consumer demand

Answers

There are seven commonly used organizational buying criteria. One of them is Price.

What are the seven most frequently used buying criteria for organizations?

Price, ability to meet the item's quality requirements, ability to meet the needed delivery schedule, technical capability, warranties, and claim procedures, past performance on prior contracts, production facilities, and capacity are some of the often utilized criteria.

The majority of people will respond with "safety" when asked what is most important when selecting an airline. Because safety is assumed, if you ask the same person what criteria they use to purchase a ticket, their response will not be "safety." Safety is a must-have. Buying criteria can include anything from: price, delivery speed, service availability, manufacturing location, etc. You should also be aware of how much weight each criterion has in relation to the market. Although the speed of delivery is more important than the low price, it could be a criterion.

There are seven commonly used organizational buying criteria. One of them is Price.

To know more about Price check out:

brainly.com/question/27815322

#SPJ4

Nevan’s gross pay was $45,150 last year. The federal income tax withholding from his pay was 16% of his gross pay. Nevan determined the federal income tax he owes is $6,150. Which of the following is true?
Nevan owes an additional $984 in federal tax.
Nevan owes an additional $1,074 in federal tax.
Nevan will receive a refund of $984.
Nevan will receive a refund of $1,074.

Answers

Answer:

B.) Nevan owes an additional $1,074 in federal tax.

Explanation:

To find your answer, first you need to find what 16% of 45,150 is. In this case, that's 7,224. At this point you know that Nevan is incorrect. To find out *how* incorrect, subtract 6,150 from 7,224. That gives you $1,074, which is how much more he owed than his estimate.

Answer:

d

Explanation:

got it right on test

Which of the following careers is most likely to require business skills?

Answers

Answer:

1, Communication skill,Leadership skill,Analytical skill

A researcher is estimating the mean income of residents in a large city. The income variable is usually skewed to the right. She collects a random sample of 10 points25 people. The resulting 95% confidence interval is ($26700, $35400).Select one answer.Which one of the following conclusions is valid? A. We are 95% confident that the mean income for all residents of this city is between$26700 and $35400.B. O 95% of the residents of this city have an income between $26700 and $35400.C. • No conclusion can be drawn.

Answers

The correct conclusion is (A) "We are 95% confident that the mean income for all residents of this city is between $26700 and $35400."

A confidence interval provides a range of values within which the true population mean is likely to fall, based on the sample data and the chosen level of confidence. The 95% confidence interval calculated for the researcher's sample means that if the study were repeated many times, 95% of the resulting intervals would contain the true population mean. It does not mean that 95% of the residents have an income between $26700 and $35400, as individual incomes may vary widely and the confidence interval only applies to the mean income of the entire population.

Learn more about confidence interval

https://brainly.com/question/24131141

#SPJ4

Write any four differemces between administrative manpower and technical manpower​

Answers

Manpower planning is likewise called human assets making plans, and it's miles the manner that control uses to determine the way wherein an organization needs to circulate from factor A to point B, in terms of manpower. This happens through planning and development and allows management to have the proper sorts of employees in the right quantity in the right place at the right time. together, having the proper manpower will assist the company to reap its dreams, and also will gain character personnel in the first-class manner possible. This form of planning allows HR departments to forecast which human sources are required to carry out which jobs. The HR branch will also investigate which skills are required of employees for each task. It is reasonably complicated and, if finished effectively, this may useful resource for HR in estimating its destiny function in phrases of call for and supply. essentially, this gives the HR department a snapshot of its destiny and enables the department to plan ahead for what is to come.

Manpower groups act as human aid managers for one-of-a-kind corporations by using imparting them with placement offerings. but, the primary goal of these corporations is to assist people who are in search of employment to get placed in the correct corporations with suitable job profiles.

Manpower is a staffing company. frequently known as a “temp provider," the employer's number one business is supplying a bridge between certified people and the businesses that require its services.

Manpower Recruitment or deliver agency” means any man or woman engaged in imparting any. service, directly or circuitously, in any way for recruitment or supply of manpower, briefly or. otherwise, [to any other person];] [Section 65(68) of Finance Act, 1994 as amended]Jul 7, 1997.

Learn more about Manpower  here https://brainly.com/question/24189690

#SPJ9

Bill smith economic influences

Answers

I don't really know of Bill Smith but I know Adam

Smith's best - known ideas formed the basis of economic theory , including the invisible hand theory ( the idea that free - markets coordinate themselves ) , the division of labor ( the idea that people should specialize in specific tasks ) , and the measurement of economic activity ( Gross Domestic Product ) .

Please follow me and Mark as brainlest.

Thanks :-)

A management strategy of giving separate organization units the responsibility to design and administer their own compensation systems is _____.

Answers

It should be noted that management strategy of giving separate organization units the responsibility to design and administer their own compensation systems is decentralized responsibility.

In a decentralized responsibility, there is a room for every team of the organization to carried out specific task.

In this strategy there is allocation of responsibility which is designed to be carried out by each part.

Therefore, dcentralized responsibility is a management strategy of giving separate organization units different responsibility.

Learn more about decentralized responsibility at:

https://brainly.com/question/13453381

Jim owns a gift shop in a commercial building. He pays rent for occupancy, plus maintenance and operating expenses. What kind of lease does Jim have

Answers

There are different kinds of Lease. The kind of lease that Jim have is Net lease.

Net lease is simply known as a contractual agreement that entails a lessee to pays a part or all of the taxes, insurance fees, and maintenance costs for a specific property plus rent.

This kind of lease is known to be the opposite of a gross lease which is where the tenant pays only for a flat rental fee while the landlord is known to pay for the other costs. Jim therefore uses net lease.

See full question below.

Jim owns a gift shop in a commercial building. He pays rent for occupancy, plus maintenance and operating expenses. What kind of lease does Jim have?

Net lease

Percentage lease

Gross lease

Graduated lease

Learn more about Net lease from

https://brainly.com/question/26052885

6. Outline 4 circumstances under which some human wants canbe fully satisfied​

Answers

Generally, the human wants can never be fully satisfied because its requires more resources whereas the resources are limited.

What is a human wants?

This refers to the desires, aspirations and motives of humans that can be satisfied with goods and services.

For instance, the yearning for food, shelter, clothing are example of an economic human wants.

It is also accepted that the human wants are never truly satisfied because they are endless, even though these wants can be temporarily satisfy, they will always reoccur.

Therefore, the human wants can never be fully satisfied.​

Read more about human wants

brainly.com/question/20876118

#SPJ1

Other Questions
he specialty chips are designed to improve specific computing operationsT/F A race car accelerates uniformly from a speed of 40m/s to a speed of 60m/s in 5s while traveling counterclockwise around a circular track of radius 400m. When the car reaches a speed of 50m/s, calculate the magnitude of the cars centripetal acceleration, the angular speed, the magnitude of the tangential acceleration, and the magnitude of the total acceleration.a. Find the magnitude of the car's centripetal acceleration b. The angular speed c. The magnitude of the tangential acceleration d. The magnitude of the total acceleration You need to multiply n by a power of 10 to help you find the fraction? What is the purpose of lobbying in the lawmaking process? what is answer 8 pls help The function f(x) = x2 4x + 5 is shown on the graph.On a coordinate plane, a parabola opens down. It goes through (negative 5, 0), has a vertex at (negative 2, 9), and goes through (1, 0).Which statement about the function is true?The domain of the function is all real numbers less than or equal to 2.The domain of the function is all real numbers less than or equal to 9.The range of the function is all real numbers less than or equal to 2.The range of the function is all real numbers less than or equal to 9. which statement accurately describes the pharmacokinetic parameters for levonorgestrel used as emergency contraception? A boat travels 452 km in 17 hours (with a constant speed). How far can it travel in 9 hours (with the same speed)? 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Which types of food and drinks with the nurse provide to the patient is recovering from a full thickness burn ? tanning beds have a higher proportion of ___________ radiation than does natural sunlight. heterotrophs are all of the following except: consumers herbivores carnivores scavengers producers 1. Gilbert wants to know the dimensions of his (3x2 12x + 9) square unitsrectangular lot. What is the length and width of his lot? Max and Ualan are musicians on a 101010-city tour together. Before each concert, a market researcher asks 333 people which musician they are more excited to see. The data is shown in the table below. "U" represents a fan that prefers Ualan, and "M" represents a fan that prefers Max. Assess the effectiveness of the increased bombing of Germany that Roosevelt and Churchill agreed to at the Casablanca Conference. In ancient mythology and modern media, there is a humorous character archetype, the comic relief, that can also bring great change. This archetype is:The Shape-ShifterThe JokerThe TricksterThe Clown During its first year of operations, Silverman Company paid $10,740 for direct materials and $11,300 for production workers' wages. Lease payments and utilities on the production facilities amounted to $10,300 while general, selling, and administrative expenses totaled $3,200. The company produced 7,700 units and sold 4,800 units at a price of $6.70 a unit. What is Silverman's cost of goods sold for the year if 10.0 ml of 0.10 m naoh is added to 35.0 ml of 0.10 m hcl, what will be the ph of the resulting solution? What is the main persuasive appeal used in this ad? Earthzy paper plates now carry sierra club seal of approval.A. None of the AboveB. LogosC. EthosD. Pathos please please please help