is a carbohydrate that is formed by combining galactose and glucose. Which term best describes this molecule?

Answers

Answer 1

Answer:

Lactose is a carbohydrate that is formed by combining galactose and glucose.

Disaccharide is the term that best describes this molecule.

Explanation:

Disaccharide is the term used to signify substances that are made up of two simple sugar molecules. These molecules are connected to each other. Single sugars are also termed as monosaccharides. Disaccharides are substances that can easily dissolve in water. Sucrose, lactose, and maltose are the three main disaccharides.


Related Questions

defination of photosynthesis​

Answers

Answer: The definition of photosynthesis is the process by which green plants and some other organisms use sunlight to synthesize nutrients from carbon dioxide and water. Photosynthesis in plants generally involves the green pigment chlorophyll

Explanation: It's because it's science.

Answer: Photosynthesis is a process by which phototrophs convert the energy in light to chemical energy, which is later used to fuel cellular activities.

Explanation: My favorite subject is science and I learned about photosynthesis last year.

Hope it helped :D

How long do you think it will take for Mt. St. Helens to reach a climax community - explain your answer.

Answers

Answer:

Somewhere from  50 and 150 years

Explanation:

It could take half a century or a full millinial. There hasnt been a climax community reached yet on St. Helens. If a place was wiped out because of extreme weather systems or a volcanic eruption then it would take a long time to reach

What do you think why phytoplankton production is indispensable in producing quality seedstocks for aquaculture?

Answers

Phytoplankton are considered in the production of seedstocks for aquaculture as they happen to greatly influence the quality of water, are the major source of dissolved oxygen and influence the pond ecology.

Ponds usually happen to contain an abundant population of phytoplankton. The phytoplankton play a very crucial role in the pond ecology and also influence the quality of water. They are also the major source of dissolved oxygen. They also provide nutrition and remove the excess nutrition.

Although phytoplankton generally are very beneficial to the aquaculture, under some conditions, they can also prove to be quite problematic in the production of fish and shrimp.

To know more about aquaculture

https://brainly.com/question/31329999

#SPJ1

HELP ASAP HURRRRRRRYYYY

HELP ASAP HURRRRRRRYYYY
HELP ASAP HURRRRRRRYYYY
HELP ASAP HURRRRRRRYYYY
HELP ASAP HURRRRRRRYYYY
HELP ASAP HURRRRRRRYYYY

Answers

Dictatorship is the 100%right answer

I have this question help me ugh​

I have this question help me ugh

Answers

Answer:

it is one of those

state the difference between a main root and a lateral root​

Answers

The primary root or radicle grows from the seed while the lateral roots come from founder cells in the pericycle or the outermost layer of the vascular cylinder. The primary root in gymnosperms and dicots become taproots that have lateral roots that branch out.

Answer:

The primary root or radicle grows from the seed while the lateral roots come from founder cells in the pericycle or the outermost layer of the vascular cylinder.

13. Which food or drink item is a homogeneous mixture?
O A. A bowl of cereal with milk
OB. A cup of black coffee
OC. A handful of trail mix
O D. A tossed salad

Answers

Answer:

I think the ans is B a cup of black coffee

Answer:

A cup of black coffee

Explanation: You have to stir the ingredients in until they dissolve

enzymes in pancreas..​

Answers

Answer:

pancreatic enzymes.....

Carbohydrates and fats both

Answers

Answer:

They are both used for energy

Unit Test
How does increasing the distance between charged objects affect the electric force between them?
O The electric force increases because the distance has an indirect relationship to the force.
The electric force increases because the distance has a direct relationship to the force.
O The electric force decreases because the distance has an indirect relationship to the force.
O The electric force decreases because the distance has a direct relationship to the force.

Answers

Answer:

C. The electric force decreases because the distance has an indirect relationship to the force.

Explanation:

The electric force decreases because the distance has an indirect relationship to the force. Therefore, the correct statement is option C.

What happens when the distance between two charged items grows?

As the distance between two charged items grows, the electric force between them diminishes. Because of the inverse square law, which states that the force of attraction or repulsion between two charged objects diminishes as the square of the distance between them rises, this is the case.

The force exerted by two charged objects will be decreased to one-fourth of its initial strength if the distance between them doubles. Similar to this, if the distance is quadrupled, the force loses 90 percent of its initial power. As a result, the electric force between charged objects lessens with increasing distance.

The farther the distance between charged objects, the weaker the electric force between them becomes due to the decrease in the strength of the electric field. This relationship follows an inverse square law.

Therefore, electric force decreases because the distance has an indirect relationship to the force.

Learn more about electric force here:

https://brainly.com/question/20935307

#SPJ5

12. Phenotypes, such as eye color, are controlled by multiple genes. If eye color was controlled by the number of genes indicated below, how many possible genotypes would there be?

Answers

Answer:

Following are the answer to this question:

Explanation:

In the given question some data is missing so, the answer to this question can be defined as follows:  

In the question first, we explain Phenotypes and genotypes then we defined the above choices solution:  

The Phenotype relates to the physical attributes of the organism that are observable and include nature, development, and behavior of the organism. The genotype is the organism's genetic structure, which decides a person's hereditary potentials and limitations from such an embryo to adult life.  

The choices description can be defined as follows:

In choice 1, The 5 genes are equal to 32 genotypes. In choice 2, The 10 genes are equal to 1024 genotypes. In choice 3, The 20 genes are equal to 1048576 genotypes.

The given question is incomplete, the complete question is:

1. Phenotypes, such as eye color, are controlled by multiple genes. If eye color was controlled by the number of genes indicated below, how many possible genotypes would there be?

5 Genes:

10 Genes:

20 Genes:

In the given question, the possible genotypes will be 32, 1024 and 1048576.

The calculations of the number of genotypes:

The color of the eye is controlled by many genes. The individuals observable traits like height and color of the eye is known as a phenotype. The genetic contribution to the phenotype is known as the genotype.

The number of genotypes can be determined by using the formula,

2ⁿ.

In case when n is 5, then the number of possible genotypes will be,

2⁵ = 32

In case when n is 10, then the number of possible genotypes will be,

2¹⁰ = 1024

In case when n is 20, then the number of possible genotypes will be,

2²⁰ = 1048576

Thus, the number of possible genotypes is 32, 1024 and 1048576.

Find out more information about the calculations of the number of possible genotype here:

https://brainly.com/question/15412993

In your bacterial translation experiment, you notice that you keep producing proteins with incorrect amino acids, based on the sequence of the mRNA. What is one possible reason you are seeing this?
a. There are not enough tRNA molecules in your reaction.
b. The mRNA is mutating before it is translated by the ribosome.
c. The ribosome you are using is defective in its proofreading function.
d. The original DNA sequence has mutations in it.

Answers

Not enough tRNA molecules. The mRNA is mutated before it is translated by the ribosome, the ribosome you are using is defective in its proofreading function and there are mutations in the original DNA sequence. Here all options are correct.

There are not enough tRNA molecules in your reaction is a valid possibility, as tRNA plays a crucial role in the translation process by bringing the correct amino acid to the ribosome for incorporation into the growing polypeptide chain. If there are not enough tRNA molecules present, the ribosome might accidentally pick up the wrong amino acid, leading to an incorrect protein.

The mRNA is mutating before it is translated by the ribosome" - is another possibility, as mRNA is known to be relatively unstable and can undergo mutations that alter the encoded amino acid sequence.

The ribosome you are using is defective in its proofreading function" - is a third possibility, as ribosomes typically have built-in proofreading mechanisms to help ensure that the correct amino acid is incorporated into the protein. If the ribosome you are using is defective, it might not be able to detect and correct errors in the amino acid sequence.

To learn more about tRNA molecules

https://brainly.com/question/15379401

#SPJ4

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

What is an example of an unsaturated fat?
A. vegtable oil
B. amino acids
C. butter
D. steak

Answers

Answer:

A

Explanation:

Oils, including vegetable oils, are made of mostly unsaturated fats, and therefore are unsaturated.

The correct answer is A. Typically plant sourced and loosely packed.

Which is not part of the recipe for a thunderstorm to form?
O A. Unstable air
OB. A lifting force
O C. Moisture in the low atmosphere
O D. A cold front advancing

Answers


I think it’s D but I’m not sure

A cold front advancing is not part of the recipe for a thunderstorm to form.

How thunderstorms are formed ?

The same factors are required for each thunderstorm: lift, unstable air, and moisture. Oceans usually provide moisture. When warm, moist air is close to the ground and cold, dry air is above, unstable air forms. Lift comes from contrasts in air thickness. It raises unstable air, resulting in the formation of a large thunderstorm cloud.Commonplace wellspring of dampness for tempests are the seas. However, the amount of moisture that is added to the atmosphere is heavily influenced by the temperature of the water. Air is considered unstable if it continues to rise or sink when given a push. Warm, moist air near the surface and cold, dry air above indicate an unstable air mass.A piece of air or a bubble will continue to rise on its own in these circumstances if it is pushed upward. This parcel will cool as it rises, and some of the water vapor will condense, forming the typical thunderstorm's tall cumulonimbus cloud.Most of the time, in order for a thunderstorm to form, there needs to be something that pushes the air upward and starts the upward motion. Air density is the direct cause of this push upward.Different air densities result from the transfer of some of the sun's surface heating energy into the atmosphere. As the density decreases, the tendency for air to rise increases. The primary source of lift is this difference in air density, which can be achieved in a variety of ways.

To know more about thunderstorms check this:

brainly.com/question/20407860

#SPJ2

what is autotroph class 7
answer in 5 sentences

pls I need answer ASAP

Whoever answers will be marked brainliest ​

Answers

In biology, autotrophs are organisms that can produce their own food using inorganic substances, such as sunlight and carbon dioxide.

How do we explain?

Autotrophs  are also known as primary producers because they form the base of the food chain by converting energy from the environment into organic compounds.

The topic of autotrophs is typically covered in the study of plant biology in the context of a class 7 curriculum.

The most prevalent kind of autotrophs are plants. They do this through a process known as photosynthesis, which turns carbon dioxide, water, and sunlight into glucose (a sugar) and oxygen.

Chloroplasts, specialized organelles found in plant cells, are where this process occurs.

Learn more about photosynthesis, at:

https://brainly.com/question/19160081

#SPJ1

I need help please!!

I need help please!!

Answers

Answer:

Prokaryotes and Eukaryotes are two types of cells with similarities and differences. Eukaryotes are plant cells and animal cells. They are mostly found in multi-cellular organisms. Prokaryotes are usually single-celled organisms and have a tail. Those are the examples that I remember, but there are way more similarities and differences. I hope this helped!!

review the relationship between genotypes and phenotypes by clicking and dragging the labels to the correct location to correctly complete each statement.

Answers

Genotype alludes to the alleles you have for a specific quality or set of qualities. phenotype is the actual quality itself, which might be affected by genotype and natural variables.

The term "phenotype" alludes to the detectable actual properties of a life form; these incorporate the organic entity's appearance, improvement, and conduct. An organic entity's not entirely set in stone by its genotype, which is the arrangement of qualities the living being conveys, as well as by natural impacts upon these qualities.

A singular's genotype is the blend of alleles that they have for a particular quality. A singular's aggregate is the mix of perceptible attributes or qualities. While a living being's genotype is straightforwardly acquired from its folks, the phenotype is just impacted by the genotype.

To learn more about genotypes and phenotypes here

https://brainly.com/question/20730322

#SPJ4

Construct a food chain using the following wildlife scenario.

In the north woods where the Gray wolf is the apex predator species, clover plants are the preferred forage of Cottontail rabbits. Rabbits are a critical prey species for wolves, especially young, adolescent wolves.

Answers

Answer:

Gray wolf->Rabbit->Clover plant

Explanation:

The wolf eats the rabbit and the rabbit eats the clover plants

Explain how genetic information, along with an understanding of the process of descent with modification, enables scientists to reconstruct phylogenies that extend hundreds of millions of years back in time.

Answers

By comparing the DNA sequences of different species, scientists can identify shared ancestry and determine how closely related different species are. This enables them to make predictions about the evolutionary relationships between different species and to reconstruct phylogenies that extend back in time, providing insights into the evolutionary history of life on Earth. Molecular techniques, such as DNA sequencing, are particularly useful for this purpose because DNA is a stable, heritable molecule that is passed from one generation to the next.

Which of these is a mechanical wave?
A. light
C. sound
B. radio
D. electromagnetic

Answers

Answer:

Sound

Explanation:

A mechanical wave can not transmit its energy vacuum.

the scottish fold is a breed of cat with a mutation in a gene involved in cartilage development. the result is that each ear of the cat has a crease, so the ears fall forward and lie against the head instead of standing up like the ears of most small cats. the mutation is a dominant allele.

a cat that is heterozygous for the fold allele mates with a cat that is homozygous for the fold allele.

what are the expected percents of offspring that will have each characteristic?

Answers

In complete dominance, the presence of at least one dominant allele in the genotype is enougth to express the dominant phenotype. 100% of the offspring will have mutated creased ear, while 0% of the will have normal standing ear.

What is complete dominance?

Complete dominance is the inheritance pattern in which the dominant allele completely masks the recessive allele.

This interaction between alleles is observed in individuals who are heterozygous for a particular gene. They carry both alleles but only express the dominant trait. The dominant allele is hiding the expression of the recessive allele.

In the exposed example,

E is the dominant allele and codes for the mutated creased ear,e is the recessive allele and codes for the normal standing ear.

Cross: a cat that is heterozygous with a cat that is homozygous for the fold allele.

Parentals) Ee   x   EE

Gametes) E   e     E   E

Punnett square)   E    e

                     E    EE    Ee

                     E    EE    Ee

F1) 50% of the progeny is expected to be heterozygous

     50% of the progeny is expected to be homozygous dominant

     100% of the progeny is expected to have ears with a crease.

The expected percents of offspring that will have each characteristic are,

100% of the animals will have mutated creased ear,0% of the animals will have normal standing ear.

You can learn more about complete dominance at

https://brainly.com/question/30640875

#SPJ1

Which phase of mitosis begins when the sister chromatids are cleaved, allowing the two sister chromatids of each pair to separate?

Answers

Answer:

Anaphase

Anaphase

Anaphase

Which of the following is a better mining alternative to Open-cast mining?
A. Treating ores with sulfuric acid and then using electrolysis to extract them.
B. Using plants as a carbon sink to capture and store carbon.
C. Using explosives to blast the ore out of the surrounding rock.
D. Accumulate the metal ores in water through eutrophication.

Answers

From the following options the best mining alternative to open pit mining Treat the ores with sulfuric acid and then use electrolysis to extract them.

A. Treat the ores with sulfuric acid and then use electrolysis to extract them.

What is open pit mining?

As the name suggests, open pit mining takes place from surface operations, where there is no need to expand underground. For open pit operation, deposits do not necessarily need to be exposed on the surface.

What are the stages of open pit mining?

The processes that involve mining are:

researchexplorationextractiontransportprocessingbeneficiation and commercialization of the ore.

All these steps are phases of the mining process, according to the National Mining Agency

With this information, we can conclude that Open-pit mining, also known as open-cast or open-cut mining and in larger contexts mega-mining, is a surface mining technique of extracting rock or minerals.

Learn more about open pit mining in brainly.com/question/10401629

#SPJ1

SOMEONE PLEASE HELP ME!!!!
A mechanoreceptor is a sensory receptor that responds to changes in pressure or movement. An example of a mechanoreceptor specialized for detecting muscle movement is shown in the diagram below. Which of the following best describes the nervous system change during muscle contraction?​

SOMEONE PLEASE HELP ME!!!!A mechanoreceptor is a sensory receptor that responds to changes in pressure

Answers

An electrical signal begins at the spindle and is carried to the sensory neuron cell body, where it connects with interneurons that continue the signal to the brain best describes the nervous system change during muscle contraction.

What is a mechanoreceptor?

A mechanoreceptor is a specialized sensory receptor that responds to mechanical stimuli such as pressure, touch, and movement. These receptors are found throughout the body, including in the skin, muscles, joints, and organs, and play a critical role in detecting and relaying information about the external and internal environment to the nervous system. Examples of mechanoreceptors include Pacinian corpuscles, which respond to pressure, and hair cells in the inner ear, which detect sound and balance.

The mechanoreceptor shown in the diagram is a muscle spindle, which is a type of mechanoreceptor that detects changes in muscle length and triggers a reflex response to maintain muscle tone and balance. When the muscle is stretched or contracted, the muscle spindle sends a sensory signal to the spinal cord, where it connects with interneurons that relay the signal to the brain for processing and interpretation. Therefore, option (A) is correct option.

Learn more about mechanoreceptor, here:

https://brainly.com/question/17947146

#SPJ1

A protein is made of smaller building blocks called what
O mini-p's
O amino acids
O enzymes
proteinoses

Answers

The answer - Amino acids

Focus on how the biotic and abiotic factors of the ecosystem *in the picture* work together to create the ecosystem.

Focus on how the biotic and abiotic factors of the ecosystem *in the picture* work together to create

Answers

Both biotic and abiotic factors form an ecosistem. The biotic factors are the living part of it, while abiotic factors are the non-living part (such as sunlight, soil and temperature).

Some of the interactions between these factors that occure and creat the ecosystem are:

Silver maple (biotic) and the sunlight (abiotic): The tree is considered a producer because it uses the sunlight to do photosynthesis converting it into food.

This exact interaction happens between the american beauty berry and the sun, and between the bermuda grass and the sunlight (therefore they are also called producers.

In this case the sun is a source of energy.

The army worm on the other hand is called a consumer (in this case is a primary consumer) because it eats plants from which it obtains nutrients. It is called a primary consumer because it eats producers of energy (plants).

In the picture there is also a secondary consumer (the cardinal) that eats primary consumers, and tertiary consumers (owl, snake and hawk) that obtain energy by eating secondary consumers.

The mushrooms are called decomposers because they break down organic matter from both animals and plants and transform it into nutrients (inorganic compounds) that are later consummed by plants. therefore mushrooms transform the composition of soil (which is an abiotic factor).

When plants (biotic factors) do photosynthesis they consume carbon dioxide to produce oxigen changing the composition of air (abiotic factor). The oxigen in the air is then used by animals to breath.

What were the options given by Francis Collins to reconcile evolution and faith?

Answers

The options given by Francis Collins to reconcile evolution and faith was in his argument that advances in science present “an opportunity for worship,” rather than a catalyst for doubt.

who is Francis Collins?

Francis Collins is known as an American physician-geneticist who discovered the genes associated with a number of diseases and led the Human Genome Project.

Francis Collins believed in seeing God as the creator of the universe – in all of its amazing complexity, diversity and awesome beauty – then science, which is, of course, a means of exploring nature, also becomes a means of exploring God’s creative abilities.

Francis Collins wanted to reconcile faith and evolution, and has been lauded for showing how a religious believer can rise to the highest levels of the scientific establishment while keeping his faith intact and while integrating his faith with his science.

Learn more about evolution at: https://brainly.com/question/27748371

#SPJ1

If we start with 250mL of snow, how many mL of water will we have once it has
completely changed state?

Answers

Answer:

250ml

Explanation:

the mass of an object does not change even if the state of matter changes. but obivously if gas changes to a solid or liquid it would be heavier.

True or False: Ecological succession happens very quickly, usually just a few years. True False

Answers

Answer:

I think is false

Explanation:

please mark me as brainliest

Answer: FALSE IS THE ANSWER

Explanation: BE ME FRIEND SND GIVE ME BRAINLYEST

Other Questions
The points {(-3, 2), (0, 1), (4,5)} are on the graph of function f. What are the coordinates of these threepoints after a horizontal stretch by a factor of 3, followed by a reflection across the x-axis? {-1.-2.6.-.(3-4 The teacher insists that the student (presents/present) on time. What happens to the acceleration due to gravity as you move farther away from the center of the earth? What is the value of 4 in 27.43? A scientist is studying a newly created substance. She performs a test in which she keeps adding heat to the substance until it catches on fire. What type of property is she measuring? One card is selected from a standard deck of playing cards. Find the probability it is an ace or a 9. Complete the sentences with a wordfrom the box.lost achieve disappointmentdefeated burst stay talentattitude1It's very important to fit andhealthy.2She was very upset so she......into tears.3 The other team.............. us by threegoals.4 To succeed in sport you need to haveand ambition.5 Losing the championship was a big*********************6 Real champions always have apositive .................7 We... the match by four goals.Never give up trying to............... yourdreams.8 apakah bukti malaysia mengamalkan sistem demokrasi? Restrict the domain of f(x)=x^2 to produce an inverse function? Military radar and missile detection systems are designed to warn a country of an enemy attack. A reliability question is whether a detection system will be able 34. to identify an attack and issue a warning. Assume that a particular detection system has a 0.84 probability of detecting a missile attack. Use the binomial probability distribution to answer the following questions. 35. 36. a. What is the probability that a single detection system will detect an attack? 37. O (to 2 decimals) b. If two detection systems are installed in the same area and operate independently, what is the probability that at least one of the systems will detect the 38 attack? 39. (to 4 decimals) 40, c. If three systems are installed, what is the probability that at least one of the systems will detect the attack? (to 4 decimals) d. Would you recommend that multiple detection systems be used? -Select your answer Which numbers are possible solutions to the inequality... (SELECT ALL THAT APPLY)-5x + 10 < 30 Which are difference of two squares? Select two options. a x2 9 b x2 100 c x2 4x + 4 d x2 + 10x + 25 e x2 + 15x + 36 Classify each aqueous solution as acidic, basic, Or neutral at 25 *C. Acidic Basic Neutral pH = 4.82 pH = 10.72 pH = 7.00 [H+] = L0x 10- [H+] =29x 10-H1 [Ht] = 10x 10-7 [OH-] = 35x10-3 [OH-] = 45x10-10 scarlett company has a direct materials standard of 3 gallons of input at a cost of $8 per gallon. during july, scarlett company purchased and used 7,560 gallons. the direct materials quantity variance was $240 unfavorable and the direct materials price variance was $3,780 favorable. what price per gallon was paid for the purchases? The Assyrian empire could best be described as...Peace lovingLong lasting Militaristic Impoverished Question 3. Find f'(x) (a) f(x) = In (sin e^-2x)(b) f(x) = 7^2x Solution. According to the information provided in this video, any business that has an online presence is at risk ofA. loss of customer datadenial-of-service attackB. D.C. exposure to hacker activityunauthorized data disclosure *****E. ALL OF THE ABOVE**** Which New Deal agency was created to specifically serve this population? * 5 pointsBeneficiaries as of October 2015Type of BeneficiaryAged 65 or olderDisabled, under age 65OtherO Securities and Exchange CommissionO Federal Housing AdministrationFederal Deposit Insurance CorporationSocial Security AdministrationTotal (thousands)43,94714,2286,817 Suppose that e and f are events in a sample space and p(e)=23, p(f)=34, and p(fe)=58. find p(ef) This is for my final grade before spring break please help me asap nowwww