Sandy's flashlight with the concave mirrored reflector shines more light on the wall 5 meters away compared to Jim's flashlight without the reflector.
This is because the concave mirrored reflector in Sandy's flashlight focuses the light rays emitted by the bulb into a more concentrated beam, increasing the intensity of the light reaching the wall. In Jim's flashlight, the light emitted by the bulb spreads out in all directions. When the light rays hit the wall, they are dispersed over a larger area, resulting in a lower intensity of light at any given point. On the other hand, Sandy's flashlight uses a concave mirrored reflector. The reflector is curved inward, causing the light rays emitted by the bulb to converge towards the center of the reflector. As a result, the light rays are redirected into a more concentrated beam. When this focused beam of light reaches the wall, it covers a smaller area, leading to a higher intensity of light at each point. Consequently, Sandy's flashlight with the concave mirrored reflector shines more light on the wall 5 meters away compared to Jim's flashlight without the reflector.
To learn more about reflector refer:
https://brainly.com/question/32221121
#SPJ11
When storm clouds produce lightning and thunder,
electric potential
energy changes to
energy and
energy.
The model shows a portion of a DNA strand. Which base pair sequence below best corresponds with the nucleotides provided?
Answer:
From top to bottom the answers are: T,C,A,G
Explanation:
Due to the rule, A is always paired with T and vise versa, and G is always paired with C and vise versa
The base pair sequence that best corresponds with the nucleotides provided as AGTC is TCAG.
What is DNA?DNA is a biological molecule that stores genetic information in living cells.
DNA is a double stranded molecule that is made up of monomers called nucleotides. The four nucleotides that make up the DNA are as follows:
AdenineGuanineThymineCytosineAccording to this question, the following DNA sequence is given: AGTC, therefore, the sequence of the complementary strand is as follows: TCAG.
Learn more about DNA sequence at: https://brainly.com/question/7523494
Food does not pass through the liver. Explain why it is shown as part of the digestive system.
Explanation:
the liver is for purifying liquids like water juice and alchohol
30 POINTS!!!!!!!! REAL ANSWERS ONLY, FAKE ONES WILL BE REPORTED!!!!!!
Answer:
2) forest of genetically altered trees and other plants could sequester several billion tons of carbon dioxide from the atmosphere and convert it into long-lived forms of carbon, first in Vegetation and ultimately in soil
Where is the DNA located in a eukaryotic cell?
Answer:
It is located in the nucleus
Explanation:
Answer:
Explanation:
nucleus
The nucleus is particularly important among eukaryotic organelles because it is the location of a cell's DNA.
Explain energy flow from producer to consumer.
Answer:
Energy is passed between organisms through the food chain. Food chains start with producers. They are eaten by primary consumers which are in turn eaten by secondary consumers.
Explanation:
A sample of the mineral iron pyrite, called fool's gold, has one atom of iron for every two atoms of sulfur. If another sample of iron pyrite is found, what will be the ratio of iron atoms to sulfur atoms?
1:2 will be the ratio of iron atoms to sulfur atoms ,One of three minerals can be identified as Fool's Gold. Pyrite is the most commonly misidentified mineral as gold.
Chalcopyrite can also appear gold-like, and aged mica can also look like gold. The mineral pyrite (/parat/), popularly known as fool's gold, is an iron sulphide with the formula FeS2 (iron (II) disulfide). The most common sulphide mineral is pyrite.
By weight, pure pyrite (FeS2) comprises 46.67 percent iron and 53.33 percent sulphur. It has isometric symmetry in its crystals. See sulphide mineral for further information on its physical qualities. Pyrite is widely distributed and develops under a wide range of circumstances.
Learn more about to sulfur atoms visit here:
https://brainly.com/question/1756794
#SPJ4
Which one is NOT an example of active transport?
Responses
phagocytosis
endocytosis
osmosis
pinocytosis
exocytosis
what is a polygon with 12 angles called
Answer:
Properties. Convex, cyclic, equilateral, isogonal, isotoxal. In geometry, a dodecagon or 12-gon is any twelve-sided polygon.
Explanation:
What molecular force is involved in GFP protein absorbing into the column
The molecular force involved in GFP protein absorbing into the column is typically known as chromatographic attraction or adsorption.
This occurs due to the interactions between the protein molecules and the surface of the column. In this case, the column is typically coated with a material that has a high affinity for GFP protein, such as a nickel or cobalt resin, which allows the protein to be specifically and selectively bound to the column during the purification process. In chromatography, the separation of molecules is based on their differential interactions with a stationary phase (such as a resin or column matrix) and a mobile phase (such as a buffer or solvent). One common mechanism of separation is adsorption, which involves the non-specific binding of molecules to the surface of the stationary phase.
Learn more about protein :
https://brainly.com/question/29776206
#SPJ11
What role does respiration play in the cycling of carbon?
1. it releases carbon dioxide gas that was once part of living cells into the atmosphere
2. it takes in carbon dioxide from the atmosphere and uses it to build sugars
3. it removes carbon dioxide from the atmosphere and fixes it into organic compounds
4. it releases as much carbon dioxide as it takes in so it has no overall role in the cycle
Answer:
Photosynthesis by land plants, bacteria, and algae converts carbon dioxide or bicarbonate into organic molecules. Organic molecules made by photosynthesizers are passed through food chains, and cellular respiration converts the organic carbon back into carbon dioxide gas.
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
all the alleles present in all individuals in a species are referred to as the _____ of that species.
All the alleles present in all individuals in a species are referred to as the gene pool of that species.
In the field of population genetics, the gene pool is the total set of genes and their variations that exist within a population of a particular species. The gene pool includes both dominant and recessive alleles and all of the various genotypes that can be produced from them.Gene pool can vary from one population to another, and they can change over time within a population due to various factors such as natural selection, genetic drift, gene flow, mutation, and other factors.
The size and diversity of the gene pool are crucial to the survival and evolution of a species. A larger gene pool provides a greater potential for genetic variation and adaptability to changing environmental conditions. In contrast, a smaller gene pool may reduce the ability of a population to adapt to new challenges and increase the risk of genetic diseases and other issues. So therefore gene pool is all the alleles present in all individuals in a species of that species.
Learn more about gene pool at
https://brainly.com/question/29802383
#SPJ11
If cells in the process of dividing are subjected to colchicine, a drug that interferes with the functioning of the spindle apparatus, at which stage will mitosis be arrested?
The mitosis stops when chromosomes are at the maximum condenstation, it is practically metaphase but the chromosomes are not attached to the spindles so they don't form the equatorial plate.
How old was Evelyn when she went to the Royal Academy of Music
Answer:
she was 17 years old
Explanation:
googled it
I don't know what the answer is
Answer:
d.
Explanation:
primary consumers eat primary producers (plants)
not C because kestrel is a bird that eats more than just plants
Plssss help meee I need to be done by 9pm
We may use a Punnett square to demonstrate why two people with type A blood (IAIA) cannot have a kid with type O blood (ii).
What are the two ways you may let students see the results of your Nearpod lesson assessment?You may easily start a class in student-paced mode and then provide the code to your students through email or your learning management system (LMS).
Can two persons collaborate on a single Nearpod?It's simple to share your favourite Nearpod material with a coworker. Through a series of easy steps, teachers can share lessons they've downloaded or prepared with another teacher. Teachers can improve collaboration and instructional consistency across grade levels, subjects, or smaller groups by using shared Nearpods.
To know more about Punnett square visit:-
https://brainly.com/question/27984422
#SPJ1
Which of the following uses protein channels to carry large molecules and ions across the membrane without energy?
Answer: Simple Diffusion Across the Cell (Plasma) Membrane: The structure of the lipid bilayer allows small, uncharged substances such as oxygen and carbon dioxide, and hydrophobic molecules such as lipids, to pass through the cell membrane, down their concentration gradient, by simple diffusion.
Explanation: Large molecules like glucose or carbohydrates use proteins to help move across cell membranes. Some of the membrane proteins have carbohydrate Chains attached to help cells in recognize each other and certain molecules
did this help
two animals have an identical seqence of amino acids in one of the protein found in their cells . what does this indicate ? a. they have been eating the same types of foods b. they have not been exposed to substances that cause mutation c. they must be members of the same genus d. they share an ancestor
The correct answer is d. they share an ancestor. When two animals have an identical sequence of amino acids in a protein, it suggests they share a common ancestor with a conserved genetic information.
When two animals have an identical sequence of amino acids in one of the proteins found in their cells, it indicates that they share a common ancestor. Proteins are encoded by genes, and the sequence of amino acids in a protein is determined by the DNA sequence of the corresponding gene. The DNA sequence is passed down from generation to generation through inheritance.
If two animals have the same sequence of amino acids in a specific protein, it suggests that the DNA sequence coding for that protein has been conserved over time, likely due to a shared ancestry. This conservation of the protein sequence indicates that the genetic information for producing that protein has been passed down from a common ancestor to both species.
On the other hand, options a, b, and c are not necessarily true based solely on the fact that two animals have an identical sequence of amino acids in a protein. The animals could have different dietary habits (option a), may have been exposed to different mutagenic substances (option b), and do not necessarily belong to the same genus (option c). Only the shared ancestry (option d) is directly indicated by the identical protein sequence.
To learn more about amino acids, refer to the link:
https://brainly.com/question/14351754
1. Write the part of the brain that performs each of the functions shown below. (2 points) Regulates sleep Connects brain and eyes Pleasure center Controls balance Controls thinking Controls breathing and heart rate
Answer:
hypothalamus=Regulates sleep Connects brain
cerebellum-Controls balance Controls thinking Controls breathing and heart rate
Dopamine=Eyes pleasure center
The part of brain that performs each of the functions given below,
Regulates sleep - hypothalamus.Connects brain and eyes - occipital lobe.Pleasure center : nucleus accumbens.controls balance : the cerebellumcontrols thinking : cerebrumcontrols breathing and heart rate : medulla oblongataWhat are the main 7 parts of brain?The brain is divided into main functional sections, which are called lobes.
These brain lobes are called frontal lobe, temporal lobe, parietal lobe, occipital lobe, the cerebellum and the brain stem.
Each of these parts are involved in specific functions.
To learn more about brain :
https://brainly.com/question/1247675
#SPJ2
Anyone know? Lol.... please and thank you :))))))))
Answer:
I belive it is g/cm2 not certian but it is the most i culd osee i have no background info so that is my best guess
Water pollution review …
1. When neighborhood resident noticed a large number of dead fish in a local creek they traced the problem to a nearby gas station. It turned out that a gasoline tank has developed a leak this is an example of
A. Point-source, B. nonpoint -source pollution, C. thermal pollution, D. groundwater pollution.
2. Which of the following is a point-source? A. An abandoned mine, B. Runoff city streets, C. Precipitation containing air pollution, D. Runoff from farms.
3. What would the drawbacks be to a wastewater plant connected to a water treatments facility?
A. Increased energy usage, B. Decks matter in the water, C. There are no real drawbacks, D. An overabundance of wastewater would get pumped directly into our water resources .
What is the term given to sand, clay, and decaying organic matter?
molecules present on the surface of cells of our skin can be studied by light microscope,TEM,SEM
Answer:
TEM
Explanation:
Of the following choices, which can be a product of a catabolic reaction? a. a nucleic acid like RNA b. a lipid like cholesterol c. an amino acid like
An amino acid such as tryptophan, which can be a product of a catabolic reaction.
What is catabolic reaction?A metabolic event known as a catabolic process occurs when larger molecules are broken down into smaller ones. A catabolic process releases ATP as energy, which may be used to fuel future metabolic reactions.
Examples of catabolic processes include the breakdown of proteins into amino acids, the breakdown of carbohydrates into simple sugars, and the breakdown of lipids into fatty acids. Each of these reactions results in the release of energy as ATP, and ATP may be used to fuel more metabolic activities.
An example of an amino acid produced via a catabolic process is the amino acid tryptophan. Tryptophan, an essential amino acid, is produced as proteins are broken down during a catabolic process.
Catabolic reactions also produce simple sugars such as glucose, fatty acids like oleic acid, and nucleotides like adenine.
Thus, an amino acid such as tryptophan, which can be a product of a catabolic reaction.
To know more about catabolic reaction refer to:
https://brainly.com/question/21850602
#SPJ1
The complete question is as follows:
Of the following choices, which can be a product of a catabolic reaction?
a. a nucleic acid like RNA
b. a lipid like cholesterol
c. an amino acid like tryptophan
d. a complex carbohydrate like cellulose
e. a motor protein like myosin
Which of these digestive chemicals
does the stomach use to break down
food?
A. Hydrochloric acid
B. Escherichia coli
C. Staphylococcus aureus
D. Streptococcus pyogenes
Explanation:
digestive chemicals the stomach use to break down food is -
A. Hydrochloric acid
Slugs evolved from ancestors that had a shell, which can help avoid predation. Given this, why is it that modern slugs do not have shells
The evolution of slugs losing their shells is attributed to a combination of factors, including changes in their ecological niche and selective pressures related to survival and reproduction. Over time, certain traits that conferred advantages in specific environments or lifestyles may have been favored, leading to the loss of the shell in some lineages.
Here are some possible reasons why modern slugs do not have shells:
1. Adaptation to new ecological niches: Slugs occupy different habitats compared to their shelled ancestors. The loss of a shell may have provided them with advantages in terms of mobility, access to food, or protection against desiccation in moist environments, where shells could become a hindrance.
2. Predation pressure: Shells can provide protection against predators. However, the absence of a shell in slugs may be associated with other defensive adaptations, such as producing mucus or toxins, camouflage, or behavioral strategies, which allow them to deter or evade predators without the need for a shell.
3. Energy conservation: Maintaining and growing a shell requires significant energy resources. In environments where resources are limited, losing the shell may have provided a selective advantage by redirecting energy towards other functions, such as reproduction or mobility.
4. Reproductive benefits: The loss of a shell could have facilitated mating and reproductive success in slugs. Without a bulky shell, slugs may have greater flexibility and mobility for finding mates and engaging in reproductive behaviors.
It is important to note that evolution is a complex process driven by multiple factors, and the loss of a shell in slugs is likely the result of a combination of genetic, ecological, and selective pressures acting over long periods of time.
To know more about ecological niche
https://brainly.com/question/13554226
#SPJ11
Write an argument for describing the human body as a system.
Answer:
Our bodies consist of a number of biological systems that carry out specific functions necessary for everyday living. The job of the circulatory system is to move blood, nutrients, oxygen, carbon dioxide, and hormones, around the body. It consists of the heart, blood, blood vessels,arteries and veins.
Explanation:
Lesson 02. 01 Properties of Water
Identify that water is a compound common to living things
Recognize the importance of hydrogen bonding to the properties of water
Explain why many compounds dissolve in water
Lesson 02. 02 Microscopes
Explain how modern technology affects the study of biology
Compare the structure and function of various types of microscopes
Lesson 02. 03 Early Cells
Describe the developments that led to the cell theory
Differentiate between eukaryotic and prokaryotic cells
Describe the structure of the cell membrane
Distinguish between active and passive transport
Lesson 02. 03A Early Cells (Honors)
Describe the theory of the origin of eukaryotic cells (endosymbiosis)
Explain the evidence that supports the theory of endosymbiosis
Lesson 02. 04 Cell Structure and Function
Describe the internal structures of eukaryotic cells
Summarize the functions of the organelles found in plant and animal cells
Lesson 02. 05 Cellular Energy
Recognize the importance of ATP as an energy-carrying molecule
Identify energy sources used by organisms
Lesson 02. 06 Cellular Respiration
Describe the process of cellular respiration
Compare aerobic respiration to anaerobic respiration
Lesson 02. 07 Photosynthesis
Describe the process of photosynthesis
Compare cellular respiration to photosynthesis
Answer:
Lesson 02.01: Properties of Water
Water is a compound common to living things because it is essential for life. It is a major component of cells and plays a crucial role in many biological processes.
Hydrogen bonding is important to the properties of water. Water molecules are polar, meaning they have a slight positive charge on one end and a slight negative charge on the other. This polarity allows water molecules to form hydrogen bonds with each other. Hydrogen bonding gives water its high boiling point, high specific heat capacity, cohesion, and adhesion properties.
Many compounds dissolve in water due to its polarity. Water's polar nature allows it to form interactions with other polar molecules, such as salts and sugars, as well as with charged ions. The positive and negative ends of water molecules surround and separate the ions or polar molecules, effectively dissolving them in the water.
Lesson 02.02: Microscopes
Modern technology has greatly impacted the study of biology. Advanced microscopes, such as electron microscopes, have allowed scientists to observe structures at a much higher resolution and magnification than was previously possible. Techniques like fluorescence microscopy and confocal microscopy enable the visualization of specific molecules and cellular processes in living organisms.
There are various types of microscopes with different structures and functions:
Light microscopes: Use visible light to illuminate the specimen and produce an image. They are commonly used in educational and research settings and can magnify up to 1000x.
Electron microscopes: Use a beam of electrons instead of light to visualize specimens. They offer much higher magnification and resolution than light microscopes. There are two types: transmission electron microscopes (TEM) and scanning electron microscopes (SEM).
Scanning probe microscopes: Use a physical probe to scan the surface of a specimen. They can provide atomic-level resolution and are used in nanotechnology and materials science.
Lesson 02.03: Early Cells
The developments that led to the cell theory include:
Robert Hooke's discovery of cells in cork in 1665.
Anton van Leeuwenhoek's observations of microscopic organisms in pond water in the late 17th century.
Matthias Schleiden's and Theodor Schwann's formulation of the cell theory in the 19th century, stating that all living organisms are composed of cells, and cells are the basic units of life.
Eukaryotic cells have a nucleus and membrane-bound organelles, while prokaryotic cells lack a nucleus and membrane-bound organelles. Eukaryotic cells are generally larger and more complex than prokaryotic cells.
The cell membrane, also known as the plasma membrane, is a selectively permeable barrier that surrounds the cell. It consists of a phospholipid bilayer with embedded proteins. The cell membrane regulates the movement of substances in and out of the cell and plays a vital role in maintaining cell homeostasis.
Active transport requires energy to move substances against their concentration gradient, from an area of lower concentration to an area of higher concentration. Passive transport, on the other hand, does not require energy and involves the movement of substances along their concentration gradient, from an area of higher concentration to an area of lower concentration.
Lesson 02.03A: Early Cells (Honors)
The theory of the origin of eukaryotic cells is called endosymbiosis. It proposes that eukaryotic cells evolved from the symbiotic relationship between different types of prokaryotic cells.
The evidence supporting the theory of endosymbiosis includes:
Mitochondria and chloroplasts have their own DNA and ribosomes, similar to prok
Send a message.
compared to an unmutated version of the gene, will the gene with this silent mutation have a different dna sequence? compared to an unmutated version of the gene, will the gene with this silent mutation have a different dna sequence? yes no
No. A silent mutation in a gene will not result in a different DNA sequence compared to an unmutated version of the gene.
Silent mutations are a type of point mutation that occur in the DNA sequence of a gene but do not alter the resulting amino acid sequence of the encoded protein. These mutations typically involve changes in the third nucleotide position of a codon, where multiple codons can encode the same amino acid. Due to the redundancy of the genetic code, a change in the third position of the codon may not affect the final protein product.
As a result, the DNA sequence of the gene with a silent mutation will be the same as the unmutated version, with no observable change in the protein sequence. Therefore, the correct answer is: No.
learn more about DNA here
https://brainly.com/question/32072734
#SPJ11