The answer is **False**.
Microevolution is the change in allele frequencies within a population over time. Macroevolution is the change in the genetic makeup of a species over a long period of time. Microevolution is the foundation of macroevolution, but it is not the same thing.
Microevolution is the result of random genetic drift, natural selection, and gene flow. Random genetic drift is the change in allele frequencies due to chance. Natural selection is the process by which individuals with beneficial traits are more likely to survive and reproduce, passing on their genes to the next generation. Gene flow is the movement of genes between populations.
Macroevolution is the result of the accumulation of microevolutionary changes over a long period of time. Macroevolutionary changes can be caused by a number of factors, including changes in the environment, the introduction of new genes, and the extinction of populations.
The main difference between microevolution and macroevolution is the timescale. Microevolution occurs over a short period of time, while macroevolution occurs over a long period of time. Microevolution can be observed within a single generation, while macroevolution can only be observed over many generations.
In conclusion, microevolution is not the result of the cumulative effects of macroevolution. Microevolution is the foundation of macroevolution, but it is a separate process.
Learn more about Microevolution here
https://brainly.com/question/28628660
#SPJ11
Ten percent of the male of a large, randomly mating population are colorblind. A
repreentative group of 1000 from thi population migrate to a South Pacific iland, where there
are already 1000 inhabitant and 30 percent of the male are colorblind. Auming that HardyWeinberg equilibrium applie throughout ALL population, what fraction of male and female
can be expected to be colorblind in the generation immediately following the arrival of the
immigrant?
Percent females colorblind is 4% and percent males colorblind is 20% .
An X-linked recessive disease, colour blindness. A colour blind male has a defective gene on X chromosome i.e X'Y and a normal woman has no defective gene i.e XY. (X': faulty gene; X: healthy gene) marriage between a normal woman and a colorblind person. A male child receives one normal X chromosome from the mother and a Y chromosome from the father, or XY, if the child is male. Because there are no faulty genes on the X chromosome, the man has normal vision. A female kid inherits one normal X chromosome from the mother and an abnormal X' chromosome (XX') from the father.As a female progeny has defective gene only on one X chromosome its acts like carrier but she is not colour blind. A female must possess defective genes on both the X chromosomes to b colour blind.To know more about colour blind check the below link:
https://brainly.com/question/14645566
#SPJ4
Which RNA molecule is used with the codon chart when determining the amino acid, tRNA or mRNA?
Answer:
mRNA
Explanation:
The Chart generates a nucleotide sequence of 3, known as a codon, and the codons then identify the amino acid
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
an important role of soil microbes in biological systems is the (a) recycling of matter (b) creation of biomass (c) causing of disease (d) production of energy (e) degradation of energy
The correct answer is (a) recycling of matter. An important role of soil microbes in biological systems is the recycling of matter.
Soil microbes play a critical role in decomposing organic matter, such as dead plants and animals, into simpler compounds and nutrients. Through processes like decomposition, mineralization, and nutrient cycling, soil microbes break down complex organic molecules and release essential elements and compounds back into the soil, making them available for uptake by plants and other organisms. This recycling of matter is vital for nutrient cycling and maintaining the fertility and productivity of ecosystems.
Learn more about biological systems here:
https://brainly.com/question/550352
#SPJ11
What type of feedback loop does the decreased in localized precipitation demonstrate? Explain your reasoning.
Answer:
Answer:
safe speed for the larger radius track u= √2 v
Explanation:
The sum of the forces on either side is the same, the only difference is the radius of curvature and speed.
Also given that r_1= smaller radius
r_2= larger radius curve
r_2= 2r_1..............i
let u be the speed of larger radius curve
now, \sum F = \frac{mv^2}{r_1} =\frac{mu^2}{r_2}∑F=
r
1
mv
2
=
r
2
mu
2
................ii
form i and ii we can write
v^2= \frac{1}{2} u^2v
2
=
2
1
u
2
⇒u= √2 v
therefore, safe speed for the larger radius track u= √2 v
How are ocean ridges and trenches related? Describe their relationship in
complete sentences. Use the following terms correctly in your response: ridge,
trench, subduct, convection currents, tectonic plates, mantle, magma, diverge,
converge
Terms that are asked to be used in the response are bolded;
Ocean ridges and trenches are related in a few ways. One of the ways is being created from the movement of tectonic plates on the mantle when they diverge and converge. When tectonic plates diverge they "pull apart" and create trenches. When they converge they "push together" and create ridges, subduction happens here. The tectonic plates move on the mantle of magna from convection currents creating these different boundaries.
Have a nice day!
Note: Please keep in mind that if you would like to use my work you must reword it or give a proper citation, thanks.
I hope this is what you are looking for, but if not - comment! I will edit and update my answer accordingly.
- Heather
what is the scraping or scooping of the tissue surface of the skin or wall of a tumor cavity
skin, cavity walls, tiny tumors, abortions, to clean out, bodily materials, or infectious materials that have been scraped from the tissue surface. a cancerous melanoma.
What does removing tissue from the body for microscopic analysis entail?A procedure known as a biopsy is carried out by medical professionals to examine a small sample of tissue under a microscope. A tissue sample can be taken from almost any part of the body, including the skin, stomach, kidneys, liver, and lungs.
What is the name of scraping therapy?If you've ever had tendinitis or strained a joint, you can relate to how frustrating it may be. Scraping therapy, also known as Instrument-Assisted Soft Tissue Mobilization, is a service provided by RPT that has a proven track record of expediting soft tissue recovery. like muscles, tendons, ligaments, and fascia.
To know more about scraping therapy visit:-
https://brainly.com/question/9531943
#SPJ4
what are two household items that can be considered a compound
Answer: Sucrose, Table salt, Water, Vanilla, Bleach, Ammonia- laundry and cleaning product
Explanation:
in its application to phylogenetics, parsimony is a method that attempts to minimize the number of synapomorphies. helps distinguish convergent evolution from evolutionary reversals. helps distinguish ingroups from outgroups. helps distinguish synapomorphies from homoplasies. attempts to maximize the number of homoplasies
In the field of phylogenetics, parsimony is a method used to infer evolutionary relationships among species based on their shared characteristics. Therefore the correct option is option A.
Meaning:
The technique assumes that the most straightforward explanation for a given collection of data is the most likely to be right. In phylogenetics, this suggests that the evolutionary tree with the fewest evolutionary changes, or synapomorphies, is more likely to be correct.
Synapomorphies can be distinguished from homoplasies, which are features that arose separately in different lineages. Parsimony aids in identifying the evolutionary relationships that are most likely to be correct by reducing the number of synapomorphies required to explain the observed data.
Furthermore, parsimony aids in distinguishing convergent evolution from evolutionary reversals. Convergent evolution occurs when separate lineages independently evolve comparable features in response to similar selective pressures.
In contrast, evolutionary reversals occur when a characteristic that was previously dominant disappears.
Conclusion:
In summary, parsimony is a method in phylogenetics that attempts to minimize the number of synapomorphies needed to explain the observed data. Therefore the correct option is option A.
For such more question on phylogenetics:
https://brainly.com/question/2189834
#SPJ11
Which is an example of when Hector's somatic sensory system is in control?
After a long run, his body is sweating.
When jogging, he sees an ice patch and decides to change directions to a different route.
His eyes dilate because he sees something scary.
He eats a large meal and his body takes multiple hours to digest it.
The statement 'when jogging, he sees an ice patch and decides to change directions to a different route' is an example of somatic sensory system control.
What is the somatic sensory system?The somatic sensory system is a group of neuronal networks aimed at controlling the senses in the body.
This system (somatic sensory system) is involved in the perception of temperature, position, and pain.
In conclusion, the statement 'when jogging, he sees an ice patch and decides to change directions to a different route' is an example of somatic sensory system control.
Learn more about the somatic sensory system here:
https://brainly.com/question/27237487
#SPJ1
Answer:
B) When jogging, he sees an ice patch and decides to change directions to a different route.
claim these 5 points.
Answer:
thx could i have brainliest
Explanation:
Wood storks thrive in wetland environments by feeding on small freshwater fish.
Wood storks are absent in the Everglades ecosystem because the environment is
no longer suitable to sustain abundant wading bird life. What term describes a
Wood Stork?
#1-Indicator species
#2-Keystone species
#3-Endemic species
#4-Invasive species
Answer:
Invasive Species
Explanation:
“The environment is no longer suitable to sustain abundant wading bird life”
Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as:
Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as homeostatic mechanisms.
Homeostasis is the body's ability to maintain a stable internal environment despite external changes.
In the context of the brain, homeostatic mechanisms involve various processes that regulate physiological functions and maintain optimal levels of essential substances.
These mechanisms can include feedback loops that detect imbalances and initiate corrective actions.
For example, if there is a deficiency in a particular nutrient or hormone, the brain may activate mechanisms to increase its production, decrease its consumption, or enhance its absorption from the environment.
Homeostatic mechanisms play a crucial role in ensuring the body's overall stability and functioning, helping to maintain proper levels of various substances and promoting overall well-being.
To know more about Homeostasis, refer here:
https://brainly.com/question/15647743#
#SPJ11
What was George H. W. Bush’s “new world order?
Answer:
“where the rule of law… governs the conduct of nations,” and “in which a credible United Nations can use its peacekeeping role to fulfill the promise and vision of the UN’s founders.”
Explanation:
Theres a video as well :)
Make inferences and predictions about the science methode
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
Investigating which question will help a student find out whether the
core of Mars is similar to the core of Earth?
Is the core of Mars metallic?
O What is the rate of rotation of the core of Mars?
O Is the core of Mars thicker than other layers of Mars?
Does the core of Mars have a strong gravitational field?
The pH of seawater is ___, making it alkaline. Seawater has a natural buffering mechanism. Carbon dioxide in seawater and is present in the form of __ ions, which makes the seawater alkaline.
Answer:
8.1 and h+
hope it helps you
Directions: Match Column A with its corresponding description in Column B.
Column A Column B
1. Gametes
2. Gametogenesis
3. Genetic recombination
4. Gonad
5. Haploid
6. Importance of meiosis
7. Oogonium
8. Ovulation
9. Extra fingers
10. 47, XXY syndrome
A. sex cells
B. testes and ovary
C. the release of eggs from the ovary
D. single set of unpaired chromosomes
E. The immature female reproductive cells
F. having a complete set of each pair of chromosomes
G. exchange of genetic material between different organisms
H. common physical characteristics of people with Patau syndrome
I. process by which gametes, or sex cells, are produced by an
organism
J. an illness in the sex chromosome among males which is also
identified as Klinefelter Syndrome
K. ensures that all organisms produced via sexual reproduction
contain the correct number of chromosomes by producing haploid
gametes.
1. Gametes - A. sex cells
2. Gametogenesis - I. process by which gametes, or sex cells, are produced by an organism
3. Genetic recombination - G. exchange of genetic material between different organisms
4. Gonad - B. testes and ovary
5. Haploid - D. single set of unpaired chromosomes
6. Importance of meiosis - K. ensures that all organisms produced via sexual reproduction contain the correct number of chromosomes by producing haploid gametes.
7. Oogonium - E. The immature female reproductive cells
8. Ovulation - C. the release of eggs from the ovary
9. Extra fingers - H. common physical characteristics of people with Patau syndrome
10. 47, XXY syndrome - J. an illness in the sex chromosome among males which is also identified as Klinefelter Syndrome
1. Gametes - A. sex cells: Gametes are specialized cells involved in sexual reproduction. They are either sperm cells (male gametes) or egg cells (female gametes). Gametes contain half the number of chromosomes compared to somatic cells and combine during fertilization to form a zygote with a complete set of chromosomes.
2. Gametogenesis - I. process by which gametes, or sex cells, are produced by an organism: Gametogenesis is the process through which gametes are formed. It involves the development and maturation of germ cells in the gonads (testes in males, ovaries in females) into functional gametes. In males, the process is called spermatogenesis, resulting in the production of sperm cells, while in females, it is called oogenesis, resulting in the production of egg cells.
3. Genetic recombination - G. exchange of genetic material between different organisms: Genetic recombination refers to the exchange of genetic material between homologous chromosomes during meiosis. It leads to the creation of new combinations of genes, promoting genetic diversity. This process occurs through crossing over, where segments of chromosomes swap places, and contributes to the uniqueness of offspring.
4. Gonad - B. testes and ovary: The gonads are reproductive organs responsible for producing gametes. In males, the gonads are the testes, which produce sperm cells. In females, the gonads are the ovaries, which produce egg cells. The gonads also secrete hormones involved in sexual development and reproduction.
5. Haploid - D. single set of unpaired chromosomes: Haploid refers to a cell or organism having a single set of unpaired chromosomes. Gametes are haploid cells, containing half the number of chromosomes found in somatic cells. During fertilization, haploid gametes combine to restore the diploid chromosome number in the resulting zygote.
6. Importance of meiosis - K. ensures that all organisms produced via sexual reproduction contain the correct number of chromosomes by producing haploid gametes: Meiosis is vital for sexual reproduction as it ensures the correct number of chromosomes in offspring. By undergoing two rounds of division, meiosis produces haploid gametes with a single set of chromosomes. When fertilization occurs, the fusion of two haploid gametes forms a diploid zygote with the right chromosome number for the species. Meiosis also promotes genetic diversity through genetic recombination, contributing to evolutionary adaptation.
7. Oogonium - E. The immature female reproductive cells: Oogonium refers to the immature female reproductive cells found in the ovaries. These cells undergo mitotic divisions to produce primary oocytes, which later undergo oogenesis to form mature egg cells (ova).
8. Ovulation - C. the release of eggs from the ovary: Ovulation is the process in which a mature egg cell (ovum) is released from the ovary. In females, ovulation typically occurs once per menstrual cycle, and it is an essential step in fertility and reproduction.
9. Extra fingers - H. common physical characteristics of people with Patau syndrome: Extra fingers, or polydactyly, refers to the presence of more than the usual number of fingers or toes. However, in the given options, there is no direct correspondence to this term.
10. 47, XXY syndrome - J. an illness in the sex chromosome among males which is also identified as Klinefelter Syndrome: 47, XXY syndrome, also known as Klinefelter Syndrome, is a chromosomal disorder that affects males. It occurs when a male is born with an additional X chromosome (XXY) instead of the usual XY configuration. This syndrome may lead to various
Know more about Klinefelter Syndrome here:
https://brainly.com/question/1561346
#SPJ8
Rutherford used aluminum metal in his atomic model experiment.
True
False
Rutherford did not use aluminum metal in his atomic model experiment.
What is atomic model?Atomic model is an explanation of the structure of an atom. It consists of a nucleus, which is made of protons and neutrons, and electrons orbiting the nucleus. The electrons are held in place by electrostatic forces between the nucleus and the electrons. The current accepted atomic model is the quantum mechanical model, which includes the wave-particle duality of matter. The quantum mechanical model provides an accurate description of the behavior of electrons and other subatomic particles.
Instead, he used gold foil in his famous gold foil experiment. This experiment was conducted to study the structure of atoms. He fired alpha particles at the gold foil and observed the scattering of the particles. This experiment allowed him to discover the nucleus of the atom, which was the central part of his atomic model. He also discovered that the atom was mostly empty space. His model was a major breakthrough in the field of atomic physics. It helped scientists to better understand the structure and behavior of atoms.
To know more about atomic model click-
https://brainly.com/question/7765243
#SPJ1
The _____ is the bacterial structure that acts as a selective barrier, allowing nutrients to enter the cell and wastes to leave the cell.
The plasma membrane is the bacterial structure that acts as a selective barrier, allowing nutrients to enter the cell and wastes to leave the cell.
The cell membrane or plasma membrane can be described as a selectively permeable membrane that allows the selective entry of materials into and out of a cell. All the organelles of a cell are enclosed in the plasma membrane and hence it separates the interior of a cell from the exterior.
For single-celled organisms, such as bacteria, nutrients are received by the cell through the plasma membrane and excretion of waste also occurs through the plasma membrane. The bacterial cell membrane is made up of phospholipids and usually, it encloses a food particle in it for absorption of food.
To learn more about plasma membrane, click here:
brainly.com/question/734740
#SPJ4
When does homologous recombination most likely occur in order to flawlessly repair double-stranded DNA breaks
Homologous recombination is most likely to occur during the S and G2 phases of the cell cycle, specifically during the late S and early G2 phases. This is because, during these phases, the sister chromatids are available as templates for repair.
Homologous recombination is a DNA repair mechanism that utilizes a homologous DNA sequence as a template to repair DNA damage, such as double-stranded breaks (DSBs). The process involves the exchange of genetic material between the damaged DNA strand and an undamaged homologous DNA strand.
During the S phase of the cell cycle, DNA replication occurs, resulting in the formation of two identical sister chromatids connected at the centromere. The newly replicated DNA strands serve as templates for homologous recombination repair. If a DSB occurs during the S phase, the sister chromatid can be used as a template for flawless repair.
As the cell progresses into the G2 phase, the replicated DNA is fully condensed and prepared for cell division. At this stage, the sister chromatids are still available and closely associated, making them suitable for homologous recombination repair.
Therefore, homologous recombination is most likely to occur during the S and G2 phases of the cell cycle when sister chromatids are present and available as templates for the flawless repair of double-stranded DNA breaks.
To learn more about cell cycle click here
https://brainly.com/question/29526840
#SPJ11
Compared to the standard model of consolidation, which of the following is thought to play a larger role in the multiple trace model of consolidation?a. multivoxels b. hippocampus c. amygdala d. synapses
According to the Multiple Trace Model of consolidation, hippocampus plays a larger role as compared to the standard model of consolidation. The correct option is b. hippocampus.
What is the Multiple Trace Model of consolidation?Multiple Trace Model of consolidation is a theory of memory consolidation proposed by Nadel and Moscovitch in 1997. According to this theory, memories are temporarily stored in the hippocampus, and then they are moved to neocortical sites over time. This theory proposed that memories are never consolidated and are always dependent on the hippocampus, unlike the standard model of consolidation that states that memories gradually become independent of the hippocampus. According to the Multiple Trace Model of consolidation, new episodic learning creates new episodic memory traces, and each time the episodic memory is retrieved, a new trace is formed. As a result, multiple memory traces are formed over time.
What plays a larger role in the Multiple Trace Model of consolidation?In the Multiple Trace Model of consolidation, hippocampus plays a larger role as compared to the standard model of consolidation. The standard model proposes that memories gradually become independent of the hippocampus over time. In contrast, the Multiple Trace Model proposes that each time the episodic memory is retrieved, a new trace is formed. As a result, multiple memory traces are formed over time that are always dependent on the hippocampus. Therefore, hippocampus plays a larger role in the Multiple Trace Model of consolidation as compared to the standard model.
Here you can learn more about model of consolidation
https://brainly.com/question/15599604#
#SPJ11
true or false?: chemicals that block the assembly of microtubules or microfilaments would cause little effect on the cell?
Answer:False
Explanation:
false, Chemicals that prevent microtubules or microfilaments from forming would have little impact on a cell.
Microfilaments, also known as actin filaments, are protein filaments that make up the cytoskeleton in the cytoplasm of eukaryotic cells. They are primarily made of actin polymers, but many other proteins in the cell also modify and interact with them. Two strands of actin make up microfilaments, which are typically 7 nm in diameter. Cell motility, shape alterations, endocytosis and exocytosis, cell contractility, mechanical stability, and cytokinesis are some of the functions of microfilaments. Microfilaments may withstand compressive stresses of up to a few piconewtons without buckling or tensile forces of a few nano-newtons without breaking. Actin filaments, most likely driven by myosin II molecular motors, lengthen at one end while contracting at the other to cause cell movement.
Learn more about microfilaments here:
https://brainly.com/question/11354197
#SPJ4
explore: read the descriptions of the large organs, as well as those of the small organs on the next tab. fill in the names of the organs that serve the functions listed below:Large intestineThis organ absorbs water and vitamin K from digested food.PancreasThis organ produces enzymes that break down nutrients.CapillariesThese tiny blood vessels transport absorbed nutrients.Parietal cellsThese cells produce hydrochloric acid (HCl).Chief cellsThese cells produce pepsin, which breaks down proteins
Mouth, throat, pharynx, esophagus, stomach, large intestine, rectum, and anus are all parts of the digestive system. The salivary glands, liver, gallbladder, and pancreas are all a part of in digesting food.
These organs provide the digestive fluids and enzymes that the body needs to break down food and liquids. Each component of your digestive system works to either break down food and drink into smaller pieces, move food and liquid through your GI tract, or do both. Once food has been broken down into small enough pieces, your body to absorb and transport minerals from it. Because your large intestine absorbs water, the waste materials of digestion become stool. Nerves and hormones control the digestive process. The digestive tract and other organs that aid in the body's digestion and absorption of food make up the digestive system. It is a protracted, twisted tube that originates at the mouth and travels via the stomach, small and large intestines, the anus, and the oesophagus. Food is broken down by the digestive system into nutrients like proteins, lipids, and carbs.
Learn more about digestive system
https://brainly.com/question/29575362
#SPJ4
why do you think some flora and funna get extinct from the earth
Hey, there!!!!
The main reasons for the extinction of flora and fauna are:
The climate change is one main reason for extinction of various flora and fauna.Unwanted urbanization has also destroyed many flora and fauna.Hunting of fauna cause loss of various type of species of fauna and overgrazing or afforestation has caused destruction of plants species.Hope it helps...
What is meant by industrialization ?Write in brief
Important vocabulary continued: label and illustrate an autotroph and a heterotroph organism. Underline the one that produces its own food. If you can answer 3 also that would be nice
In generation 1 one parent is affected by the gene mutation and one parent isn't. In generation 2 all three children are affected by the Gene mutation what can conclude about this gene mutation
Answer:
An autosomal dominant mutation
Explanation:
A situation where only one parent is affected by the gene mutation and the offspring also gets affected means the offspring only need to inherit one copy of the mutation in a dominant form to become affected unlike the autosomal recessive form where 2 copies (1 each from both parents are needed to become affected)
Thus, the gene mutation is said to be dominant. It is also autosomal because it affects both male and female offspring. Thus, the gene mysterious is said to be autosomal dominant.
Another characteristic is that it does not skip generations. Once a generation is skipped, that is the end.
Develop a model to decribe the cycling of matter and flow of energy among living and nonliving part of an ecoytem. You hould ue multiple part of thr carbon cycle to demontrate thi cycle
The Cycling of Matter and Flow of Energy Model:
The Carbon Cycle:
1. Photosynthesis: Plants absorb carbon dioxide (CO2) from the atmosphere and use sunlight to convert it into energy and oxygen. This process is known as photosynthesis.
2. Respiration: Plants and animals respire, releasing CO2 back into the atmosphere.
3. Decomposition: When plants and animals die, bacteria and fungi break down their remains, releasing CO2 back into the atmosphere.
4. Fossil Fuels: Fossil fuels such as coal, oil, and natural gas are formed from the remains of plants and animals from millions of years ago. When these fuels are burned, they release CO2 back into the atmosphere.
5. Ocean: CO2 is also absorbed by the ocean, where it reacts with water to form carbonic acid. This process helps to regulate the amount of CO2 in the atmosphere.
6. Land: Plants absorb CO2 from the atmosphere, and their remains are incorporated into the soil, where it can be stored for long periods of time.
Flow of Energy:
Sun: Energy from the sun is absorbed by plants during photosynthesis.
Plants use sunlight energy to convert CO2 into organic carbon compounds during photosynthesis.
Consumers obtain energy from the organic carbon compounds they consume as food.
Decomposers obtain energy from breaking down organic materials from living organisms.
What is the Ecosystem?
The ecosystem is the collective network of living and non-living components that interact with each other in a given environment. It includes both biotic and abiotic factors, such as organisms, climate, soil, water, and other physical features. All of these components work together to create a system that sustains life.
To know more about the Ecosystem,
LINK- https://brainly.com/question/842527
CODE- #SPJ4