Mycobacterium tuberculosis, can survive for days or weeks in very dry conditions such as in dust or on a carpet. Which of the following is TRUE about this situation? M. tuberculosis can survive because it has a waxy cell wall. M. tuberculosis can survive because it tums itself into an endospore. The population of M. tuberculosis js slowly increasing in the carpet or dust. QUESTION 6 Because they can make endospores, these 2 species are highly resistant to desiccation. Note: the genera are real but the species are imaginary. Mark two answers. Mycobacterium portulaca Bacillus bornensis Clostridium huriliens Hepatitis B Virus particles QUESTION 7 If you add an acid to a solution, the pH of the solution goes up. the pH of the solution reverts to 7. the pH of the solution goes down.

Answers

Answer 1

Mycobacterium tuberculosis can survive because it has a waxy cell wall. What makes Mycobacterium tuberculosis survive for days or weeks in very dry conditions such as in dust or on a carpet is because it has a waxy cell wall.

M. tuberculosis can survive because it has a waxy cell wall. The waxy cell wall of the bacteria prevents water from getting out of the cell which makes it difficult for the bacteria to dry out or die in very dry conditions. So, if a surface has the bacteria in very dry conditions, it can survive for a long time due to its waxy cell wall.

6. Because they can make endospores, these 2 species are highly resistant to desiccation that are Bacillus bornensis and Clostridium huriliens. These two genera of bacteria are known to be able to make endospores which are highly resistant to desiccation. 7. When an acid is added to a solution, it increases the concentration of hydrogen ions and lowers the pH of the solution.

To learn more about tuberculosis, click here.

brainly.com/question/14816227

#SPJ11


Related Questions

An organism that reproduces using binary fission, a type of asexual reproduction, creates an identical copy of a cell when

Answers

Answer: An organism that reproduces using binary fission, a type of asexual reproduction, creates an identical copy of a cell when the cell's DNA replicates and the cell divides, giving each cell an identical copy of DNA

Answer:

C.  

the cell's DNA replicates and the cell divides, giving each cell an identical copy of DNA.

Explanation:

What does a distance matrix tell you?

Answers

A distance matrix is a table that displays the distances between every pair of objects or points in a dataset. It can tell you the similarity or dissimilarity between the objects or points, which is useful in many applications such as clustering, phylogenetics, and multivariate statistics.

In a distance matrix, the distances are typically computed based on some measure of distance or dissimilarity, such as Euclidean distance, Manhattan distance, or Jaccard distance. The distances can be used to create a hierarchical clustering dendrogram, where similar objects are grouped together based on their distance. Alternatively, the distances can be used to create a multidimensional scaling plot, where the objects are represented in a low-dimensional space based on their distance relationships.

Overall, a distance matrix provides valuable information about the relationships between objects or points in a dataset, which can help to uncover patterns and insights.

you know more about distance matrix pls visit-

ttps://brainly.com/question/25872464

#SPJ11

what is translation ​

Answers

Answer: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins after the process of transcription of DNA to RNA in the cell's nucleus

Explanation: Hope this was helpful

When developing a business plan for a greenhouse, one of the things a grower will wish to do is calculate
crop costs and crop yield estimates using what base unit?
a. per square yard
b. per acre
c. per square foot
d. per building

*its c*

Answers

A grower will wish to do is calculate crop costs and crop yield that estimates by using a base unit known as per square foot.

What do you mean by Crop yield?

The crop yield may be defined as the total productivity of a crop at a particular season, It also deals with the weight of grains that are grown in the agricultural field.

The cost of a crop with respect to its yield is always calculated by using a base unit called per square foot.

Therefore, a grower will wish to do is calculate crop costs and crop yield that estimates by using a base unit known as per square foot.

To learn more about the Crop yield, refer to the link:

https://brainly.com/question/845584

#SPJ1

5. What are virus hoaxes? Why are the hoaxes sometimes more dangerous than an actual virus?

Answers

Answer:

An actual computer virus is a malicious software, often known as malware, that can harm a computer and its users.

Virus hoaxes are false or misleading information about viruses that circulate through various communication channels.

They can be more dangerous than actual viruses due to their ability to spread quickly, cause panic, and undermine effective public health measures.

Virus hoaxes are deceptive messages or claims that often exaggerate the severity or impact of a particular virus. They can be spread through social media, email chains, or word of mouth. These hoaxes may include misinformation about symptoms, transmission methods, or false remedies, leading people to take ineffective or even harmful actions.

What makes virus hoaxes particularly dangerous is their potential to create panic and misinformation at a rapid pace. The viral nature of social media and other communication platforms allows these hoaxes to reach a wide audience within a short period. As a result, people may make decisions based on false information, such as avoiding necessary medical treatment, taking unnecessary precautions, or spreading fear and misinformation to others.

Moreover, virus hoaxes can undermine public health efforts by diverting attention and resources from legitimate preventive measures. They can erode trust in healthcare authorities and disrupt the dissemination of accurate information, making it harder for individuals to make informed decisions and follow recommended guidelines.

This can have severe consequences, especially during outbreaks or pandemics, where timely and accurate information is crucial for public safety. Therefore, it is essential to verify the credibility of information and rely on trusted sources to mitigate the risks associated with virus hoaxes.

Learn more about viruses :

https://brainly.com/question/29156932

#SPJ11

6) Which mRNA codons (3 bases) always last on the mRNA molecule? ​

Answers

UAG, UAA, and UGA. These codons signal the end of the polypeptide chain during translation. These codons are also known as nonsense codons or termination codons as they do not code for an amino acid.

TRUE/FALSE. Interpret the models of three phyla of worms. Nematoda -Cuticle Mouth Anus Annelida Anus Mouth Platyhelminthes Drag "True" or "False" to the end of each statement. Reset Help True Nematoda is the only phylum of the three with a cuticle. True False Since none of these phyla have a head, none have an anterior and False Pihelminthes uses the same opening as a "mouth and an anus." False False Since none of these phyla have a head, none have an anterior end. False Platyhelminthes uses the same opening as a mouth and an anus." False These three phyla of worms are the same size. False All three models show cross sections. False Annelida is the only phylum of the three with segmentation, False 2

Answers

True because the internet molecules are false and we’re never true in the first place

NEED HELP WITH THIS QUESTION PLEASE I NEED HELP

NEED HELP WITH THIS QUESTION PLEASE I NEED HELP

Answers

A hereditary disorder, also known as a genetic disorder or genetic disease, is a condition that is caused by abnormalities or mutations in genes inherited from parents.

The down syndrome involves the presence of an additional copy of genes located on chromosome 21 rather than specific mutations in individual genes.

In Fragile X syndrome, the FMR1 gene on the X chromosome undergoes an expansion of CGG repeats, which leads to the inactivation or reduced production of the FMR1 protein. This mutation affects protein synthesis and neuronal development, resulting in the cognitive impairments and developmental delays observed in Fragile X syndrome. Please note that the specific names for Gene 2 and Gene 3 are not applicable in this context since Fragile X syndrome primarily involves the mutation in the FMR1 gene.

For more details regarding hereditary disorders, visit:

https://brainly.com/question/32500790

#SPJ1

NEED HELP WITH THIS QUESTION PLEASE I NEED HELP
NEED HELP WITH THIS QUESTION PLEASE I NEED HELP

Which of the following body systems has a component that stops functioning and leads to
diabetes?
O endocrine system
O digestive system
O circulatory system
O nervous system

Answers

Answer:

Digestive system

Explanation:

Lack of insulin production causes diabetes

Explain how the nervous system works within your body as you go throughout the day. From waking, eating, going to school, extracurricular activities, and finally bed; state how the different parts of the nervous system work together to complete these tasks.”

Answers

Answer:

when you wake up the nervous system remembers to get dressed for school as well as eating the brain remembers to pick up a fork or spoon to eat, going to school the brain will remember what time the bus will come and when to go to the bus, doing extracurricular activities the brain will tell your arm to throw a football or kick a soccer ball, when going to bed the nervous system will tell the nerves in your arms to pull the blanket on top of you and to turn the light off.

What is the pressure at 4000 km below the earth's surface?

Answers

Answer:

Pressure = 2.3 million atm

please answer these 2 questions for the first one select all the right answers and define if they’re a autotroph or a heterotroph

please answer these 2 questions for the first one select all the right answers and define if theyre a

Answers

Based on the provided data, we can determine the most likely ecological roles of the organisms regarding their mode of nutrition (autotroph or heterotroph) as follows:

Organism V: Autotroph. It is multicellular, indicating a complex structure that can support photosynthetic processes.

Organism W: Heterotroph. It is multicellular and lacks chloroplasts, suggesting it does not possess the ability to perform photosynthesis.

Organism X: Autotroph. It lacks multicellularity but has chloroplasts, which are responsible for photosynthesis in autotrophs.

Organism Y: Heterotroph. It is multicellular, lacks chloroplasts, and does not possess cilia, suggesting it relies on external food sources.

Organism Z: Heterotroph. It lacks multicellularity, does not have chloroplasts, and has a cell wall. These characteristics indicate a heterotrophic nature.

Model F is the best model for prokaryotic cell

Description of the best model of a prokaryotic cell: Cell Membrane, Cytoplasm, DNA, Nucleoid, Ribosomes, Cell Wall, Flagella, Fimbriae.

Know more about prokaryotic cells:

https://brainly.com/question/29771587

#SPJ1

What are the characteristics of Echinoderms that belong to the Echinoidea class?
covered in spikes and have several tube feet
covered in spikes, but have no tube feet or arms
covered in spikes and tube feet and lack arms
covered in tube feet and have five arms

Answers

The Echinoidea class has a globose and discoidal body, with no arms. They have a skeleton composed of plates with spikes. Ambulacral feet are in charge of motion, feeding, and respiration. A) Covered in spikes and have several tube feet.

What are Echinoidea?

Echonoidea, commonly known as Sea ​​urchins, belong to the Echinoderm group.

They have a globose or discoidal shape. They lack arms, and have an external skeleton covered by the epidermis. This skeleton is composed of several plates with articulated mobile spikes.

In the body interior there is a duct system that communicates with the exterior through the madreporite. Ambulacral feet derivate from these ducts and have motion, feeding, and respiratory functions.

On the dorsal region, there are 5 plates, one of them the madreporite and the remaining ones are reproductive plates.

According to this information, option A is correct. Echinoidea class is covered in spikes and have several tube feet.

You can learn more about Echinoderms at

https://brainly.com/question/6472932

https://brainly.com/question/28318824

#SPJ1

Answer:

it's C

Explanation:

I took the exam

How could the student modify the experiment to find a
more accurate value for the minimum concentration that
affected seed germination?

Answers

Inhibiting seed germination or reducing germination percentage and delaying germination time in crops are both caused by salinity, a severe stressor.

What is the germination process?

The five transformations or processes that compose the seed secondary fermentation include ingestion, respiration, the effect of light on germination, the mobilization of reserves throughout germination, the role of organic amendments, and thus the specialization of something like the developmental pole into a plant.

What does plant germination mean?

The early design of a seed's transformation into a seedling is called germination. The ideal combination of temperatures, oxygen, and hydration is needed for seeds to germinate. Seeds wait to emerge until the conditions are right for their growth and survival. a process known termed dormancy.

To know more about germination visit:

https://brainly.com/question/15976369

#SPJ1

1. The evidence used by the speaker in this video helps support the position
that birds at the top of the food chain have been harmed the most by DDT.
The speaker does this by:
a. Sharing a story about DDT and how it affected animals, particularly birds
b. Stating claims about birds and their environment and using evidence to
support the claims
c. Explaining the build-up of DDT in the environment

Answers

The evidence used by the speaker in the video that helps support the position that birds at the top of the food chain have been harmed the most by DDT is by stating claims about birds and their environment and using evidence to support the claims.

William Engdahl, an analyst and researcher, in his speech "The DDT Story - How US
Agency for International Development Used Third World Citizens as Guinea Pigs for
Human-Testing of a Known Carcinogen," shows how the pesticide DDT (dichloro-diphenyl-trichloroethane) had a catastrophic impact on birds, wildlife, and humans.

Engdahl uses evidence to support his statements, demonstrating how DDT became a global concern and how it triggered public action to counter the impacts. Based on the question, the speaker supports the position that birds at the top of the food chain have been harmed the most by DDT by stating claims about birds and their environment and using evidence to support the claims.

For more such questions on birds

https://brainly.com/question/30163707

#SPJ8

deglutition is coordinated by the swallowing center in the ________.

Answers

Deglutition (swallowing) is coordinated by the swallowing center in the medulla oblongata of the brainstem.

The medulla oblongata is a vital part of the brainstem responsible for controlling many essential functions, including respiration, heart rate, and swallowing. Within the medulla oblongata, the swallowing center consists of a group of neurons that orchestrate the complex sequence of muscle movements involved in swallowing.

When food or liquid is ingested, sensory receptors in the oral cavity and pharynx send signals to the swallowing center, triggering the coordinated series of events that allow for safe and efficient swallowing. The swallowing center coordinates the contraction and relaxation of muscles involved in the movement of the tongue, soft palate, pharynx, and esophagus to propel the bolus of food or liquid from the mouth to the stomach.

To know more about medulla oblongata

brainly.com/question/33439603

#SPJ11

A desert is very hot during the day and receives very little rain. Which
plants have an adaptation that would help them survive?*

Answers

Answer: Well cacti for one

Explanation:

They can store water for a really long time because of the little rain.

Succulent plants have an adaptation that would help them survive in the desert.

Succulent plants

Cactus is an example of succulent plants that are adapted to survive in the hot and humid conditions of the desert. To survive in the desert, cactus has the following adaptations:

A modified flat green stem - helps in preparing food by photosynthesis and conserves water.The stem is covered with a thick waxy layer - helps to retain water.Leaves are present in the form of spines -  prevent water loss through transpiration.Long roots -very deep into the soil for absorbing water.

Learn more about succulent plants:

https://brainly.com/question/26630906

People who study the effects of human activities on Earth’s land, air, water, and living things are a. astronomers. b. environmental scientists. c. meteorologists. d. oceanographers. Please select the best answer from the choices provided A B C D

Answers

Answer:

Environmental Scientists

Explanation:

Astronomers observe stars, space, and other objects in space. Meteorologists study weather patterns, oceanographers study sea life, and environmental scientists study Earth and the interactions between living and nonliving organisms, air, and water.

Hope this helps!

Answer:

B. Environmental scientists

Explanation:

Let's examine each answer choice.

Keep in mind, we want to find the answer that matches: People who study the effects of human activities on Earth’s land, air, water, and living things.

A. Astronomers

They study stars, moons, galaxies, and planets, so this is not correct.

B. Environmental scientists

They study the environment and how to protect nature. They also examine how humans impact the Earth. This must be the right choice, but let's check the others to ensure we are correct.

C. Meteorologists

They study the atmosphere and weather. This is also not correct.

D. Oceanographers

They study the ocean and its features, therefore this is not correct.

The best answer choice is B. environmental scientists

Suppose that this population of mice has stabilized so that both white and brown appear. White mice survive better in the winter and brown mice survive better in the warmer months. If a group of these mice migrated to an area that didn't get snowy in the winter, what do you think would be the long term effect on the color of these mice? Explain why.

Answers

Answer:

The population of the white mice would significantly decrease, and most of the mouse population would be with brown fur.

Explanation:

As stated in the question, the brown mice survive better in warmer times. This is due to the fact that with winter and snowy times it makes it harder for prey to spot the WHITE mice v.s. the BROWN mice who would very easily be spotted by the prey in snowy regions.

Some form of early Homo is estimated to have evolved into Homo erectus around: O 5-7.5 million years ago
O 1.7-2 million years ago O 10,000-40,000 years ago O 50,000-70,000 years ago t

Answers

Some form of early Homo is estimated to have evolved into Homo erectus around 1.7-2 million years ago, option B is correct.

Homo erectus is believed to have evolved around 1.7-2 million years ago based on fossil evidence and dating methods. Fossil discoveries, such as the famous Nariokotome Boy skeleton found in Kenya, provide crucial insights into the anatomy and characteristics of Homo erectus. These fossils, along with other archaeological and genetic evidence, suggest that Homo erectus was the first hominin species to exhibit significant anatomical and behavioral differences from earlier hominins.

The emergence of Homo erectus marked a significant milestone in human evolution, as this species had a larger brain size, more advanced tool-making abilities, and potentially even the ability to control fire. These developments laid the foundation for the subsequent evolution of Homo sapiens, option B is correct.

To learn more about Homo follow the link:

https://brainly.com/question/28386402

#SPJ4

The complete question is:

Some form of early Homo is estimated to have evolved into Homo erectus around:

A) 5-7.5 million years ago

B) 1.7-2 million years ago

C) 10,000-40,000 years ago

D) 50,000-70,000 years ago

the thrifty gene theory suggests that question 3 options: our weight is influenced by the inheritance of random genetic mutations. adult body weight is determined by the weight of our parents. our bodies are designed to maintain weight within a narrow range. some people possess a gene that causes them to expend less energy than other people.

Answers

The thrifty gene theory suggests that our bodies are designed to maintain weight within a narrow range, and that some individuals may possess genes that are more efficient at storing energy during times of abundance, leading to increased risk of obesity and related health issues in modern environments where food is plentiful.

According to the thrifty gene theory, the genes responsible for this efficient energy storage were advantageous for our ancestors who faced periods of famine or food scarcity, allowing them to survive and reproduce during times of food shortage. However, in modern environments where food is abundant, these same genes can contribute to obesity and related health issues such as type 2 diabetes.

The thrifty gene hypothesis has been the subject of much debate and criticism over the years, with some researchers suggesting that other factors such as physical activity, diet, and lifestyle also play a significant role in obesity and related health issues. Nonetheless, the theory remains an important area of research in the field of genetics and human health.

To know more about thrifty gene theory, click here.

https://brainly.com/question/4432306

#SPJ4

Which of these is an example of calcium carbonate

Answers

An example of Calcium carbonate is shells of snail. Shells of snails is made up of hardened calcium carbonate. Thus, the correct option is D.

What is Calcium carbonate?

Calcium carbonate is a chemical compound which have the chemical formula CaCO₃. It is a common substance which is commonly found in the rocks as the minerals calcite and aragonite and is also the main component of eggshells, gastropod shells, shellfish skeletons and the pearls.

The shells of snails and other animals are made up of calcium carbonate compounds to protect the eggs or the embryo which is present inside the egg or the soft body of the organism. The main purpose of calcium carbonate is to protect the body inside the shell from the harsh environment which can damage the organism.

Therefore, the correct option is D.

Learn more about Calcium carbonate here:

https://brainly.com/question/29102944

#SPJ1

Your question is incomplete, most probably the complete question is:

Which of these is an example of calcium carbonate?

A. diamond

B. graphite

C. water

D. shells of snail

3. How can hemolytic and non-hemolytic bacteria be distinguished on blood agar plates? a. Answer 4. Why do alpha-hemolytic bacteria produce a greenish color? 5. Blood agar is used in clinical settings to identify a variety of organisms. List two illnesses for which hemolytic characterization is important. Identify the hemolytic capacity of the pathogen a

Answers

Hemolytic and non-hemolytic bacteria can be distinguished on blood agar plates by observing the type of hemolysis that occurs. Hemolysis is the destruction of red blood cells, and it can be seen as a clear zone around bacterial colonies on the blood agar plate.

Alpha-hemolytic bacteria produce a greenish color because they only partially destroy red blood cells, leaving behind a green pigment called biliverdin.

Hemolytic characterization is important in identifying certain illnesses. For example, Streptococcus pyogenes, the pathogen that causes strep throat, is beta-hemolytic. Another example is Staphylococcus aureus, which can cause skin infections and is also beta-hemolytic. Identifying the hemolytic capacity of the pathogen can aid in diagnosis and treatment decisions.

Here you can learn more about Hemolysis

https://brainly.com/question/29855185#

#SPJ11  

Dephosphorylation of the pump in response to dopamine would most likely result in

Answers

Dopamine is a neurotransmitter that interacts with a variety of brain receptors, including those connected to intracellular signaling pathways. The activation of protein kinase A is connected to one of these pathways

What would happen if the levels of both intracellular sodium ions rose?

Because it must recreate the gradients of concentration at rest in the membrane, the Na-K pump would speed up. K+ permeates a cell membrane more readily than Na+.

What occurred when sodium and potassium ions were pumped into the cell?

The carrier protein then transforms after receiving energy from ATP. The three sodium ions are pumped out of the cell as a result. Two potassium ions from outside the cell attach to the protein pump at that location. The process is then repeated while the potassium ions are being delivered inside the cell.

to know more about Dephosphorylation here;

brainly.com/question/15125465

#SPJ4

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Use the information below to answer the question that follows:

A horizontal bar chart depicting World War II military and civilian casualties for both Allied and Axis countries is shown. On the lower right, a pie graph shows the deaths of Allied civilians, Allied military, Axis civilians, and Axis military as a percentage of total WWII-related deaths. The Allied countries listed include the Soviet Union, China, Poland, Indonesia, India, Yugoslavia, French Indochina, France, United Kingdom, United States, Lithuania, Czechoslovakia, Greece, Burma, and Latvia. The Axis countries listed include Germany, Japan, Romania, Hungary, Italy, and other. Countries with at least two million military casualties include the Soviet Union (11 million), China (3.8 million), Germany (5.7 million), and Japan (2 million). Countries with less than one million military casualties include India (.1 million), Yugoslavia (.4 million), France (.2 million), the United Kingdom (.4 million), the United States (.4 million), Romania (.4 million), Hungary (.4 million), Italy (.4 million), and other (.4 million). Countries with more than one million civilian casualties include the Soviet Union (12.5 million), China (15.2 million), Poland (4.8 million), Indonesia (4 million), India (1.5 million), French Indochina (1 million), Germany (2 million), and other (1.2 million). Countries with less than one million civilian deaths include Yugoslavia (.6 million), France (.4 million), Lithuania (.3 million), Czechoslovakia (.3 million), Greece (.3 million), Burma (.2 million), Latvia (.1 million), Japan (.6 million), Romania (.4 million), Hungary (.2 million), and Italy (.1 million). The pie chart shows that Allied Civilian deaths were 58 percent of the all WWII deaths, Allied Military deaths were 25 percent, Axis Military deaths were 13 percent, and Axis civilian deaths were 4 percent.

Which of the following statements is supported by the information above?

Answers

D.) The Japanese suffered the greatest loss of life among the Axis powers. This is supported by the information that Japan had 2 million military casualties and .6 million civilian casualties, which is the highest among the Axis nations listed.

What is power?

Power is the ability to exercise control or authority over someone or something. It is the capacity to influence the behavior of others and the outcomes of events. Power can be expressed in many forms, such as authority, influence, persuasion, or force. It can manifest in the form of physical, mental, or social energy, and is the foundation for the development of leadership. Power can be used for either positive or negative purposes, depending on the user's intentions. Power is often seen as an advantage, but it can also be a source of tension, conflict, and competition. Ultimately, power is necessary for social, economic, and political stability.

To learn more about power
https://brainly.com/question/29753572
#SPJ1

Complete Question:
Use the information below to answer the question that follows:

A horizontal bar chart depicting World War II military and civilian casualties for both Allied and Axis countries is shown. On the lower right, a pie graph shows the deaths of Allied civilians, Allied military, Axis civilians, and Axis military as a percentage of total WWII-related deaths. The Allied countries listed include the Soviet Union, China, Poland, Indonesia, India, Yugoslavia, French Indochina, France, United Kingdom, United States, Lithuania, Czechoslovakia, Greece, Burma, and Latvia. The Axis countries listed include Germany, Japan, Romania, Hungary, Italy, and other. Countries with at least two million military casualties include the Soviet Union (11 million), China (3.8 million), Germany (5.7 million), and Japan (2 million). Countries with less than one million military casualties include India (.1 million), Yugoslavia (.4 million), France (.2 million), the United Kingdom (.4 million), the United States (.4 million), Romania (.4 million), Hungary (.4 million), Italy (.4 million), and other (.4 million). Countries with more than one million civilian casualties include the Soviet Union (12.5 million), China (15.2 million), Poland (4.8 million), Indonesia (4 million), India (1.5 million), French Indochina (1 million), Germany (2 million), and other (1.2 million). Countries with less than one million civilian deaths include Yugoslavia (.6 million), France (.4 million), Lithuania (.3 million), Czechoslovakia (.3 million), Greece (.3 million), Burma (.2 million), Latvia (.1 million), Japan (.6 million), Romania (.4 million), Hungary (.2 million), and Italy (.1 million). The pie chart shows that Allied Civilian deaths were 58 percent of the all WWII deaths, Allied Military deaths were 25 percent, Axis Military deaths were 13 percent, and Axis civilian deaths were 4 percent.

Which of the following statements is supported by the information above?

A.) There were more military deaths globally than civilian deaths.

B.) The Axis nations lost more people overall than the Allied nations.

C.) Poland lost the highest percentage of their country's population in the war.

D.) The Japanese suffered the greatest loss of life among the Axis powers.

Which protects the DNA of a virus?

Answers

Answer:

The capsid

Explanation:

It functions as a shell for the virus and its genome.

The DNA of a virus is protected by a protein coat called a capsid. The capsid is made up of many individual protein subunits, which come together to form a protective shell around the viral genome. The capsid not only protects the viral DNA from damage, but also plays a critical role in the virus's ability to infect host cells.

In some viruses, the capsid may also be surrounded by an outer envelope, which is derived from the host cell's membrane and contains viral proteins that are involved in the infection process. The envelope can further protect the virus from environmental stresses, such as changes in temperature or pH.

Based on this phylogeny, the archosaurs are a ______. Multiple choice question. monophyletic group polyphyletic group paraphyletic group

Answers

Based upon what we know of phylogeny, we can confirm that archosaurs are considered to be a monophyletic grouping.

Placing a species into the monophyletic grouping indicates that the species in question is among a group of species that all derive from a common ancestor. Therefore, a monophyletic group contains a common ancestor and all of its direct descendants. Studies have shown this to be the case for the archosaurs.

To learn more visit:

https://brainly.com/question/6834801?referrer=searchResults

The major body system responsible for protecting the body from germs such as bacteria and viruses is called the:___.a. digestive system b. immune system c. reproductive system d. nervous system

Answers

The major body system responsible for protecting the body from germs such as bacteria and viruses is called the: b. immune system.

The immune system is a complex network of cells and proteins that defend the body against infections and diseases caused by bacteria, viruses, and other microorganisms. It is composed of several different organs, tissues, and cells, including white blood cells, lymph nodes, the spleen, bone marrow, and the thymus gland.

The immune system works by identifying and neutralizing foreign substances, such as bacteria and viruses, and protecting the body against their harmful effects. This is done through a complex series of interactions between different cells and proteins, which work together to destroy these invaders and prevent them from causing damage to the body.

Some of the key components of the immune system include white blood cells, which are responsible for identifying and neutralizing foreign substances; lymph nodes, which help to filter out harmful substances and alert the immune system to potential threats; and the spleen, which helps to produce and store white blood cells and antibodies, which are critical for fighting infections and diseases.

In summary, the immune system is responsible for protecting the body from germs such as bacteria and viruses.

For more question on immune system. click on

https://brainly.com/question/6612564

#SPJ11

These plants have free-living gametophytes and free-living sporophytes. The sporophyte generation is dominant and larger than the gametophyte generation. There is one type of spore, and the gametophyte generation grows outside of the spore wall. Which plant or plants am I describing? (SELECT ALL THAT APPLY) 000000000 Ferns Cycads Selaginella Lycopodium Conifers Ginkgo Hornworts Mosses Angiosperms 3 pts Liverworts

Answers

The correct answers are: Ferns, Hornworts, Mosses, and Liverworts.

The plants that fit the given description are:

Ferns: Ferns have free-living gametophytes and free-living sporophytes. The sporophyte generation is dominant and larger than the gametophyte generation. Ferns produce one type of spore, and the gametophyte generation grows outside of the spore wall.

Horworts: Hornworts also have free-living gametophytes and free-living sporophytes. The sporophyte generation is dominant and larger than the gametophyte generation. Hornworts produce one type of spore, and the gametophyte generation grows outside of the spore wall.

Mosses: Mosses have free-living gametophytes and free-living sporophytes. The sporophyte generation is dominant and larger than the gametophyte generation. Mosses produce one type of spore, and the gametophyte generation grows outside of the spore wall.

Liverworts: Liverworts also have free-living gametophytes and free-living sporophytes. The sporophyte generation is dominant and larger than the gametophyte generation. Liverworts produce one type of spore, and the gametophyte generation grows outside of the spore wall.

Therefore, the correct answers are: Ferns, Hornworts, Mosses, and Liverworts.

Learn more about Gametophytes at

brainly.com/question/26464709

#SPJ4

Other Questions
2 select the correct answer. the surface area of a cone ls 250 square centimeters. the height of the cone is double the length of its radius. what is the helght of the cone to the nearest centimeter? oa 15 centimeters ob. 5 centimeters oc. 20 centimeters od.10 centimeters help me pass my class . Describe how paralanguage and silence play a role in our communication with others. (site 1) According to Brutus, what motivated his decision-making?Broken friendship.A sense of good luck.Fear of Caesars past behaviors. What is the correct definite article in Espanol? Lpiz, Cuaderno, Biblioteca, Jefes, Chicas SPANISH SPEAKER NEED YOUR HELP ASAPYou are working over the summer in Spain for a real estate agency, and you need to write a short description for a house in the country that you are selling. Write two (2) complete sentences in Spanish, describing the house. Remember to use the vocabulary words from this lesson/course only. Use the following suggestions as a guide for your answer: You may copy and paste the accented and special characters from this list if needed: , , , , , , , , , , , , , , .*Note: The sample sentences in parentheses are just a guide to help you form your sentences. You must come up with your own original answers keeping academic integrity intact.Include the following details in your description:In one sentence, use the yo form of the verb vender to express what you sell, a house with how many bedrooms and bathrooms. Be sure to include an adjective for the house to help sell it. (e.g., I sell a new house with four bedrooms and two bathrooms.)In one sentence, state the price of the house using numbers over 10,000 and the correct form of the verb costar, as well as at least three other rooms/areas the house has, using the correct form of the verb tener. (e.g., The house costs 300,000 euros and has a garage, a yard, and two living rooms.) How is Jo MOST influenced by seeing anartist sketching on her lawn and having areporter ring her doorbell?It increases her skill at finding ways toescape."But a few moments will be all I ask," saidthe man, edging his way farther in."You can't see her, for she is out," repliedTeddy, as a backward glance showedhim that his unhappy parent hadvanished-through the window, hesupposed, as she sometimes did....."Very sorry. I'll call again. Is this her study?Charming room!" And the intruder fellback on the parlour, bound to seesomething and bag a fact...."It is not," said Teddy, gently but firmlybacking him down the hall, hoping thatIt strengthens her relationship with her son.It strengthens her desire to protect herprivacyIt increases her determination to quit writing.1 235In Question 4-Why did more than 30.000 men take up Pope Urban's call to arms?1. Younger sons fought because they would get land and a position in society2. For peasants it was a chance to possibly get some land if they lived-3. for peasants it was a chance to skip purgatory and go right to Heaven if they died.4. all of the above Charlie makes pizza at a restaurant. The customers always compliment how great the pizza tastes. But Charlie takes a long time to make each pizza; this makes the customers wait longer, and orders get backed up. Give Charlie some constructive feedback on his performance using the sandwich technique. Jim places $10,000 in a bank account that pays 7.8% compounded continuously. After 2 years, will he have enough money to buy a car that costs 511,6937 If another bank will pay Jim 8% compounded semiannually, is this a better deal? After 2 years, Jim will have $ (Round to the nearest cent as needed) Jim will have enough money to buy the $11.693 car after 2 years After 2 years, the other bank will yield $ (Round to the nearest cent as needed) Is the other bank's offer a better deal? No. Jim's bank (7.8% compounded continuously) is better Yes. The other bank (8% compounded semiannually) is better A rectangular prism kiddie pool is 7 feet wide, 6 feet long, and 10 feet tall. When the day started the pool was completely full of water. After 3 hours, the water level had decreased by 1.5 feet. What would be the volume of water in the kiddie pool after 3 hours. Which dimension would relate to water level? Is -5 a whole number, integer or a rational number ? A national publication showed the following distribution of favorite class subjects for high school students.Class Subject Math English Social Studies Physical Education Music OtherPercentage 5% 14% 28% 26% 20% 7%Pasquale, a student from a high school of 1,200 students, wants to see whether the distribution at his school matches that of the publication. He stands at the school entrance in the morning and asks the first 40 students he sees what their favorite class is. Pasquale records the following table of observed values.Class Subject Math English Social Studies Physical Education Music OtherObserved 7 8 7 6 6 6He decides to conduct a chi-square goodness-of-fit test to see whether his high school's distribution differs significantly from that of the publication. Pasquales statistics teacher tells him that his information does not meet the conditions necessary for a goodness-of-fit test. Which condition has not been met? In a blood testing procedure, blood samples from 5 people are combined into one mixture. The mixture will only test negative if all the individual samples are negative. If the probability that an individual sample tests positive is 0.12, what is the probability that the mixture will test positive Which of the following statements about the Fourteenth Amendment is true? 1) It reversed the strides emancipated slaves had made after the passage of the Thirteenth Amendment.2) It reinterpreted the Declaration of Independence's decree that "all men are created equal" to suppress the civil liberties of minorities.3) Its promise of equal protection was largely unfulfilled as Southern governments took measures to limit the progress of emancipated slaves.4) Its vow to ensure equal protection for all citizens was upheld religiously as emancipated slaves took government positions in the South. Given that f(x) = 5x + 4 and g(x)=x, find (fog)(-5). what is the answer to 4x + 27 Under the Sixth Amendment, people have a right tocontinue to bear arms until convicted of a crime.be tried by a judge.protest unreasonable search and seizure.be represented by a lawyer in court. Jennifer is going to line the perimeter of her swimming pool with tile. What is the distance around her pool that needs to be tiled? a 36.56 b 44.56 c 38.28 d 30.28 The gross income, in dollars, that a company makes from selling x items can be modeled by the expression 3x2 + 2x +4. It costs the company 2-3x + x2 dollars to make x items. Which expression represents the companys profit if it makes and sells x items