patella alignment should be assessed in both static and dynamic activities and in open and closed kinetic chain conditions. true/false

Answers

Answer 1

Patella alignment should be assessed in both static and dynamic activities and in open and closed kinetic chain conditions. This statement is TRUE.

Assessing patella alignment in different conditions is a crucial part of the evaluation process for a knee injury. These conditions include static and dynamic activities, as well as open and closed kinetic chain exercises. In static activities, patellar alignment is assessed with the patient sitting or standing and looking at the patella from various angles. In dynamic activities, the patella is observed during movement, such as squatting or running.

In open chain activities, the foot is not in contact with the ground, whereas in closed chain activities, the foot is in contact with the ground. Each of these conditions offers a unique perspective on patella alignment and should be taken into consideration when evaluating a patient's knee injury or condition. To sum up, patella alignment should be assessed in both static and dynamic activities and in open and closed kinetic chain conditions.

To know more about Patella visit :

https://brainly.com/question/33446905

#SPJ11


Related Questions

Describe the ways that early humans demonstrated artistic expression.

Answers

Answer:

The early humans demonstrated artistic expression by painting on cave walls, and by there religious acts of worshipping Mother Nature.

Explanation:

They worshipped the sky, grass, animals, and the bodies of water. To celebrate these things they would have religious celebrations. At the celebrations they would sing songs, tell stories, and worship at an alter. They also celebrated by painting pictures of this on cave walls, showing the great power of Mother Nature. And the triumph of a good hunt.

Hope this helps! ; )

Answer:The early humans demonstrated artistic expression by painting on cave walls, and by there religious acts of worshipping Mother Nature.

Explanation:

Why is the
Aegean Sea
important to
Greece?

Answers

Answer: The Aegean Sea continued to serve an important function in trade and in war, helping the Greek culture and civilization to flourish.

The Greek's used the sea to establish colonies and trade with people from other lands.

The sea helped the Greeks economy because they could sail to other regions and trade with them. The Greeks traded goods such as fish, olive oil,wine wool and fine pottery.

Explanation:

Aegean Sea served an important function in trade and in war,

T/F typically developing children rely more on this type of input when learning new skills and postural control

Answers

Typically developing children do rely more on visual input when learning new skills and postural control. The statement is True.

Visual input plays a crucial role in their ability to observe and imitate movements, learn spatial awareness, and coordinate their body movements effectively. By observing demonstrations, gestures, and environmental cues, children can acquire and refine motor skills, balance, and postural control. Visual feedback helps them understand the task requirements, adjust their movements, and make necessary corrections.

However, it's important to note that other sensory inputs, such as proprioception (awareness of body position) and vestibular input (related to balance and movement), also contribute to their overall development and motor learning process. The statement is True.

Learn more about gestures

https://brainly.com/question/12115354

#SPJ11

Complete Question:

True or False: Typically developing children rely more on visual input when learning new skills and postural control?

What caused the loss of Native American land?

Tribes chose to move.
Europeans introduced new diseases.
Europeans established permanent settlements.
There were cultural differences.

Answers

Answer:

B) Europeans introduced new diseases.

Explanation:

Europeans introduced new diseases which caused the loss of Native American land, because the Native Americans were not immune to small pox, and other deadly diseases the Europeans have brought.

Answer: B) Europeans introduced new diseases.

Explanation:

I did the test

What kind of trust is created after the death of the settlor in accordance with directions in his or her will

Answers

A trust created after the death of the settlor in accordance with directions in his or her will is called a testamentary trust.

Testamentary trusts are created by a provision in the settlor's will. The will typically specifies the assets that will be held in trust, the beneficiaries of the trust, and the terms of the trust. The trustees of the trust are responsible for managing the assets of the trust and distributing income and principal to the beneficiaries in accordance with the terms of the trust.

Testamentary trusts can offer a number of benefits, including:

Providing for the financial support of beneficiaries who may not be able to manage their own financial affairs

Protecting assets from creditors and lawsuits

Reducing estate taxes

Providing flexibility in how assets are managed and distributed

If you are considering creating a testamentary trust, it is important to speak with an attorney to discuss your specific needs and goals.

To learn more about testamentary trust here brainly.com/question/30191435

#SPJ11

Alcohol prohibition in the United States
had which unfortunate side effect:
Increased profits for breweries.
Increased people's respect for all laws.
The number of people drinking decreased.
Organized crime and increased violence.

Answers

Organized crime and increased violence

“In 100 words or less, tell me what happens of note on January 6th and January 20th that has to do with the electoral college?” ILL GIVE BRANLIEST

Answers

On January 6th 2021 protesters stormed the capitol where the discussion about Biden posibally rigging the votes and an IED was found on the premises.

On January 20th Joe Biden will be sworn in as America's new president.

The Florida Boater Education Temporary Certificate is valid for 90 days from the date of the exam and must be carried on board the vessel along with your:

Answers

Based on the information given regarding the temporary certificate, it should be carried along with a photo ID.

It should be noted that the Florida Boater Education Temporary Certificate can be inspected by a livery in order to ensure that the prospective renter met the safety requirements.

The Temporary Certificate should be available for 90 days for inspection by a law enforcement officer when an individual is operating a vessel in Florida.

Learn more about safety on:

https://brainly.com/question/8430576

where was the shield that ares wanted percy annabeth and grover to fetch

Answers

This questions comes from Percy Jackson! The shield that Ares wanted Percy, Annabeth, and Grover to fetch was in a place called Waterland. Waterland was a deserted water park located in Denver, Colorado.

list six things that the South African government could do to effectively deal with poverty

Answers

How to Stop Poverty

1. Create Awareness. Social media has become an integral part of daily life, and now is the time to use it as a voice of social good.

2. Take Action on Your Own.

3. Donate.

4. Eliminate Gender Inequality.

5. Create Jobs Worldwide.

6. Increase Access to Proper Sanitation and Clean Water.

7. Educate Everyone.

individual opinions sometimes may be badly informed and unstable, but in the aggregate, public opinion is both stable and coherent. true or false

Answers

Yes, the above statement is true. While individual opinions may be influenced by biases and misinformation, the collective public opinion tends to be more stable and coherent as it is formed by a larger and diverse group of individuals who share common values and beliefs.

Public opinion is the general consensus on a subject or candidate that is important to society. The opinions of the populace on issues that concern them. Though writers have long recognised the value of the public's opinion, the phrase didn't initially emerge until the 17th century in France. Small groups of individuals known as publics pay considerable attention to one or more specific issues. They have a strong opinion on the issue(s) and are well-informed about it(s).

Over time, public opinion may change due to new information and experiences, but it generally follows a more consistent trend.

To learn more about Public Opinion, click here:

https://brainly.com/question/11043546

#SPJ11

Yes, the above statement is true. While individual opinions may be influenced by biases and misinformation, the collective public opinion tends to be more stable and coherent as it is formed by a larger and diverse group of individuals who share common values and beliefs.

Public opinion is the general consensus on a subject or candidate that is important to society. The opinions of the populace on issues that concern them. Though writers have long recognised the value of the public's opinion, the phrase didn't initially emerge until the 17th century in France. Small groups of individuals known as publics pay considerable attention to one or more specific issues. They have a strong opinion on the issue(s) and are well-informed about it(s).

Over time, public opinion may change due to new information and experiences, but it generally follows a more consistent trend.

To learn more about Public Opinion, click here:

brainly.com/question/11043546

#SPJ11

There are cousins in your home but you have assignments to finish

Answers

Answer:

LOL

Explanation:

Very funny

How did the idea of self-governance begin in Protestant congregations?

People wanted their leaders to have the power to make all of the rules.
People wanted to elect religious leaders who would interpret the Bible for them.
Protestant ideals encouraged equality and individualism, which led to self-rule.
Protestant ideals encouraged people to vote on interpretations of the Bible.

I already know it's not D

Answers

The idea of self-governance began in Protestant congregations through option C. Protestant ideals encouraged equality and individualism, which led to self-rule.

How did it all started?

The idea of self-governance in Protestant congregations emerged from the Protestant Reformation in the 16th century. One of the key tenets of the Reformation was the belief in the priesthood of all believers, which emphasized the idea that all Christians have direct access to God and do not need intermediaries such as priests or the Catholic Church hierarchy to communicate with God.

This belief in the priesthood of all believers also led to the idea of congregationalism, which means that each individual congregation has the authority to govern itself. In this model, each congregation elects its own leaders and makes its own decisions, rather than having a centralized authority making decisions for all churches.

Additionally, Protestant ideals such as equality and individualism contributed to the development of self-rule in congregations. Since all believers were considered equal before God, it was natural to extend this idea to congregational governance, where everyone had an equal voice in decision-making.

Therefore, the idea of self-governance in Protestant congregations was a result of the combination of the belief in the priesthood of all believers, the practice of congregationalism, and the emphasis on equality and individualism.

learn more about Protestant congregations: https://brainly.com/question/369126

#SPJ1

what is the main role of the judicial branch of government?

Answers

Answer: Evaluates laws

Explanation:

Radiation from a nearby supernova could be lethal to complex life. Which two regions would have fewer supernovae, and thus a relatively low chance of lethal radiation

Answers

The two regions would have fewer supernovae, and thus a relatively low chance of lethal radiation, the two regions that typically experience fewer supernovae are the Galactic Halo and the Outer Spiral Arms of a galaxy.

The Galactic Halo is a region composed mostly of old stars, globular clusters, and dark matter that surrounds the main disk of a galaxy. Due to the age of these stars and their low metallicity, the rate of star formation, and subsequently, the occurrence of supernovae, is significantly lower in this region compared to other areas within the galaxy.

The Outer Spiral Arms, on the other hand, are the regions located towards the periphery of a spiral galaxy. These areas have less star formation activity and lower stellar density compared to the inner regions of the galaxy. Consequently, the likelihood of witnessing a supernova and its lethal radiation effects is reduced in these outer regions.

In summary, complex life in the Galactic Halo and Outer Spiral Arms of a galaxy is less likely to encounter lethal radiation from supernovae due to the lower rate of star formation and the reduced stellar density in these regions.

To know more about Galactic Halo visit-

brainly.com/question/16299903

#SPJ11

when asked to respond to a moral dilemma, people living in the u.s. were more likely to choose a _____ solution whereas people living in india often chose a _____ solution.

Answers

When asked to respond to a moral dilemma, people living in the U.S. were more likely to choose an individualistic solution, whereas people living in India often chose a collectivist solution.

This difference can be attributed to the cultural values and social norms predominant in each country. In the U.S., the culture places a strong emphasis on individualism, personal freedom, and autonomy. People are encouraged to make decisions based on their own interests and priorities, which often leads to solutions that prioritize the individual's rights and personal gains. This approach can be seen as practical and efficient in achieving personal goals and success.

On the other hand, India has a more collectivist culture that emphasizes group harmony, social cohesion, and interdependence among family and community members. In this context, people are more likely to make decisions based on the needs and well-being of the group as a whole, rather than solely focusing on their own interests. This approach fosters a sense of unity and shared responsibility, promoting cooperation and support among individuals.

When facing a moral dilemma, these cultural differences result in contrasting decision-making processes. While U.S. citizens may opt for solutions that protect their individual rights and freedoms, Indian citizens are more inclined to choose solutions that maintain harmony and balance within their community or family. This demonstrates how cultural values can significantly impact the way people approach and resolve ethical challenges.

For more about individualistic:

https://brainly.com/question/6961288

#SPJ11

In one or two sentences, explain your answer: Should you put money aside in savings if you have used all of your income to pay for fixed, variable, and discretionary expenses?
(PLEASE HURRY)

Answers

If you have payed for all of your expenses a certain percentage should be put into savings while the other can be used for personal use. You should keep some in savings for the future but also have a little for personal use. For example if you have 300 dollars left over, you might want to use 200 for savings and the rest for personal use.  

Answer:

In my opinion I would put it off for savings. Why? Because times are hard right now for everyone. You dont want to be that one person that doesnt have enough money to support themselves. Saving also has an other term we should all practice on called ¨Self discipline¨. Without Self Discipline how can you save up money or even save in general?  When you dont have self discipline you often find yourself wasting money or wasting certain things that you can use to better or value your life. Hope this  helps bro!

Explanation:

__________ influences every facet of our existence, so it is essential that culturally responsive practice be central in all that we do.

Answers

Culture influences every facet of our existence, so it is essential that culturally responsive practice be central in all that we do.

What is culture?

This is  a word that is used to refer to the way of life of a group of people. It is how they do things that are peculiar to them.

The cultures in the world vary from geographical region to geographical region. What is acceptable to one place may not be acceptable to another region.

Read more on culture here:https://brainly.com/question/25010777

3) Discuss immigration and border security issues regarding employment in the United States.

Answers

Here are some key points to consider when discussing immigration and border security in relation to employment:

1) Labor Market Demand:

One feature of the immigration and employment debate revolves around the demand for labor in the United States. Advocates argue that immigrants, both documented and undocumented, often fill labor market gaps in sectors such as agriculture, construction, hospitality, and healthcare. They argue that immigrants contribute to economic growth by performing jobs that might otherwise go unfilled, supporting industries, and generating tax revenue.

2) Economic Contributions: Immigrants, both documented and undocumented, have historically made significant contributions to the U.S. economy through their participation in the labor force. They fill gaps in the labor market, particularly in sectors that face labor shortages or require low-skilled workers. Immigrant workers contribute to economic growth, entrepreneurship, innovation, and tax revenue.

3) Job Competition: Concerns are often raised about the potential impact of immigration on job competition, particularly for native-born workers in certain industries or occupations. Some argue that immigrants, particularly those who are undocumented, may compete with native-born workers for jobs, potentially leading to wage suppression and job displacement in certain sectors.

4) Workforce Skills and Education:

Another point of discussion is the impact of immigration on the skill composition of the workforce. Supporters of more restrictive immigration policies argue that prioritizing highly skilled immigrants would benefit the economy by filling gaps in sectors requiring specialized skills. They contend that this approach would ensure that the United States remains competitive in a globalized economy and provide better employment opportunities for native-born workers.

5) Border Security and Unauthorized Employment:

Concerns regarding border security often arise in the context of unauthorized employment. Critics argue that porous borders and inadequate enforcement mechanisms allow unauthorized workers to enter and find employment in the United States. They advocate for stricter border control measures and increased penalties for employers who knowingly hire unauthorized workers.

6) Immigration Reform and Policy:

The United States has seen ongoing debates about comprehensive immigration reform. These discussions encompass various aspects, including border security, pathways to legal status for undocumented immigrants, guest worker programs, and employment-based visa programs. Balancing national security, economic considerations, and humanitarian concerns is a complex task that policymakers face when formulating immigration policies.

It is important to note that opinions on immigration and border security issues regarding employment vary widely among individuals and organizations. The complexities involved require careful consideration of economic, social, and political factors to develop comprehensive and effective solutions.

know more about immigration here,

https://brainly.com/question/29998020

#SPJ11

What type of emotion do stand-up comedians appeal to?
Group of answer choices
low-valence
high-valence
central
peripheral

Answers

Stand-up comedians typically appeal to high-valence emotions.

Valence refers to the emotional value or intensity of a particular emotion. High-valence emotions are those that are perceived as positive or pleasurable, such as happiness, excitement, or joy. In contrast, low-valence emotions are those that are perceived as negative or unpleasant, such as sadness, fear, or anger.

Stand-up comedy is often associated with positive emotions, such as humor, laughter, and enjoyment. Comedians use a variety of techniques, such as jokes, stories, and observational humor, to engage the audience and elicit positive emotions. They may also use self-deprecating humor or satire to comment on social issues or to challenge the audience's assumptions, which can also elicit positive emotions.

Therefore, stand-up comedians typically appeal to high-valence emotions, as they aim to entertain, amuse, and engage the audience in a positive way.

Learn more about emotion here:

https://brainly.com/question/28739846

#SPJ11

Can someone give me a short 3 sentence summary of Confucianism
PLS HELP

Answers

 A philosophy based on mutual respect and kindness toward others. It was developed to bring peace and stability in society. It was founded before the birth of Confucius, developed through his later life and was made popular soon after, during the Han Dynasty.

Explanation:

What is the dense, hot object that the big bang came from?

Question 1 options:

a nebula


a small star


an atom


a singularity

Answers

Answer:

According to the big bang theory, all the matter in the universe erupted from a singularity. so. D is the correct answer

Explanation:

Big bang came from small star that is hot and dense.

What is Big bang theory?

Big bang theory was created from the observation that other galaxies or stars are moving away at great speed in all directions, as if an external explosive force is propelling them.

Big bang erupted from matter, space,particles and time. They are created from stars that are hot and dense.

Therefore, Big bang came from small star that is hot and dense.

Learn more about Big bang theory from the link below.

https://brainly.com/question/474443

Click this link to view o*net’s education section for human resources managers. according to o*net, what is the most common level of education among human resources managers? master’s degree bachelor’s degree some college, no degree associate degree

Answers

Bachelor's degree  is the most common level of education among human resources managers.

When pursuing a bachelor's degree, two factors are typically considered:

have completed higher education studies in the past.have completed a significant portion of their higher education.

Four year certification studies-These are the studies that a person who wants to get a master's degree or a doctorate does. To get those degrees, the person must have a strong interest in learning, as shown by finishing all of their subjects in their professional career and getting a high average overall.

More information about Bachelor Degrees:

https://brainly.com/question/22320498

#SPJ4

What is constitution? Mention the characteristics of good constitution.​

Answers

Answer:

a body of fundamental principles or established precedents according to which a state or other organization is acknowledged to be governed is known as a constitution.

Characteristics of a good constitution -

1) Adaptability

2) Responsibility and accountability

3) Separation of powers of the government

4) Representation of the people in the government

5) Comprehensiveness

6) Protection of the fundamental human rights of the citizens

7) Clarity

8) Independence of the judiciary

9) Guarantee of equity, freedom. justice

hope this answer helps you.....

Answer:

Three main characteristics of a constitution are treated: (1) a constitution is a supreme law of the land, (2) a constitution is a framework for government; (3) a constitution is a legitimate way to grant and limit pow- ers of government officials. Constitutional law is dis- tinguished from statutory law.

Explanation:

How did Socrates challenge the values of the people of Athens

Answers

He made people think about important values and believes.
How did Socrates challenge the values of the people of Athens? made people think about important values and beliefs, His method was to use questions that often showed that people didn't know what they were talking about. ... It was also a time that democracy was strengthened in Athens.

In the Soviet Union, people who disagreed with Communism were sent to labor camps called:
Concentration camps
Gulags
Mosques

Siberian exile

Answers

Answer: The Gulag or GULAG (Russian: ГУЛАГ, an acronym for Glavnoye Upravleniye Lagerey, Главное Управление Лагерей) was the government agency in charge of the Soviet network of forced labor camps set up by order of Vladimir Lenin, reaching its peak during Joseph Stalin's rule from the 1930s to the early 1950s.

Explanation:

Jaleel believes that if he studies hard for the next test, he will earn a high score. In terms of motivation theory, this is an example of ______.

Answers

Answer:

Brainliest pls

Explanation:

expectanct

what personal longing do you want to be satisfied?

Answers

The personal longing that I want to be satisfied is to find love and companionship

How to explain the information

Also, I want to be able to use my knowledge and abilities to make a positive impact on the world. I also want to be able to connect with people and to understand their experiences. I believe that by learning and connecting, we can all make the world a better place.

I want to understand the significance of love and companionship in human life and connect with the desire for such meaningful connection.

Learn more about love on

https://brainly.com/question/931164

#SPJ1

vygotsky's theory emphasizes that affect(s) mental strategies. a. development of cognitive schemes b. cultural differences in social experiences c. repetition and training d. cultural differences in formal schooling

Answers

Vygotsky's theory emphasizes that affects b. cultural differences in social experiences and mental strategies.

Vygotsky's principle, which emphasizes tradition, language, and internalization, arguably represents the maximum whole, authentic, and coherent view to be had. In Vygotsky's machine, children's cognitive development is tormented by the subculture in methods.

Vygotsky's Cognitive development idea argues that cognitive skills are socially guided and built. As such, subculture serves as a mediator for the formation and improvement of particular abilties, consisting of mastering, reminiscence, attention, and problem-fixing.

Learn more about mental strategies here https://brainly.com/question/1879872

#SPJ4

accident and health policies provide coverages for all, except

Answers

Accident and health policies provide coverage for all, except for intentional injuries and self-inflicted harm.

Accident and health policies are insurance plans that provide protection to the policyholder for medical expenses arising from accidents or illnesses. However, there are certain exclusions to these policies. The two major exceptions to these policies are intentional injuries and self-inflicted harm. Intentional injuries refer to those caused deliberately, either by the policyholder or someone else. Insurance policies do not cover these types of injuries as they go against the basic principle of insurance, which is to protect the policyholder against accidental and unforeseeable losses.

Similarly, self-inflicted harm is not covered by these policies as they are seen as a deliberate action taken by the policyholder. Hence, accident and health policies provide coverage for most injuries and illnesses, but they exclude intentional injuries and self-inflicted harm.

To know more about Health insurance visit:

https://brainly.com/question/12137315

#SPJ11

Other Questions
Please help complete con la forma correcta del Vernon reflexive en el presents You need a 35-year, fixed-rate mortgage to buy a new home for $340,000. Your mortgage bank will lend you the money at an APR of 6.35 percent for this 420-month loan. However, you can afford monthly payments of only $1,800, so you offer to pay off any remaining loan balance at the end of the loan in the form of a single balloon payment. How large will this balloon payment have to be for you to keep your monthly payments at $1,800? (Do not round intermediate calculations and round your answer to 2 decimal places, e.g., 32.16.) Balloon payment $ A structural model of adrenaline is shown below. How many hydrogen atomsare in adrenaline? A. 16B. 3 . 13D. 4pre Based on what you know about suffixes, which of the following words is a verb?A) DerisionB) GreatestC) SynthesizeD) Luscious mc qu. 75 camila manages a used car dealership... camila manages a used car dealership that allows customers to buy cars for no money down and pay in installments throughout the year. her company builds in a bad-debts adjustment that is deducted from the accounts receivable balance to present a more realistic view of the payments likely to be received in the future for these cars. the payments the company expects to receive are called What was a major pull factor that brought immigrants to the United States between 1830 and 1850? famine and starvation economic hardship religious persecution jobs in manufacturing and trade Fill in the complementary DNA strand (template strand). Then transcribe \& translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are the non-template strands. 5'TCAATGGAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATTGACACT 3 ' 5GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTtAACCCCGGA 3 Find the surface area of this triangular prism. Be sure to include the correct unit in your answer. PLEASE HELP MULITPLE CHOOSERead This living hand, now warm and capable by John Keats. Based on what you have learned about literary movements, which movement does this poems form and elements fit best?This living hand, now warm and capableOf earnest grasping, would, if it were coldAnd in the icy silence of the tomb,So haunt thy days and chill thy dreaming nightsThat thou would wish thine own heart dry of bloodSo in my veins red life might stream again,And thou be conscience-calmdsee here it isI hold it towards you.NaturalismRomanticismClassicism Which line represents the linear equation3y = 15 4x?The equation 3y = 15 4x rewritten in slope-intercept form is y = (4/3)x 5.The y-intercept is 5 and the slope of the line is 4/3.Line B is the graph of the line 3y = 15 4x. If the Founders had made the American government similar to Britain's, which of the following outcomes might have been likely each square in the grid below has area 1. find the area of the irregular quadrilateral below. [asy] size( 200 ) ; int xmax Square ABCD has a diagonal AC with vertices A(-2, 1) and C(2, 4). Find the coordinates of the remaining vertices. Express your answers as decimals, if necessary.The coordinates are and D. What are the negative impacts of westernization in India? The representative democracy of the united states encourages citizens to _________ the politicians they wish to represent them in governmentA. Vote forB. Cheer onC. Vote againstD. Ignore Which of these is an explanation of how mood stabilizers work in treating bipolar disorder? They decrease the production of brain-derived neurotrophic factor. They affect a neuron's second messengers. They decrease the communications between key structures in the brain. They block the process of reuptake of serotonin in the brain. Which of the following can lead to a distracted teen driver who engages in reckless driving?O driving with parents and siblings in the cardriving during the daytime to and from schoolO one or more friends in the car with the teen driverO driving on the freeways to and from work as part of their third-year defence against the dark arts exam, what creature did harrys class have to navigate when crossing a series of potholes? a woman in labor suddenly reports sharp fundal pain accompanied by slight dark red vaginal bleeding. the nurse should prepare to assist with which situation? How can I write a number in expanded notation with python?example: 2389=(2*1000)(3*100) (8*10) (9*1)