place the characteristics of the cytoskeleton under the correct type of cytoskeletal component.

Answers

Answer 1

The cytoskeleton is composed of microfilaments, intermediate filaments, and microtubules. These components provide structural support, facilitate cell movement, maintain cell shape, and contribute to cellular processes such as cell division and intracellular transport.

Microfilaments:

- Provide structural support and maintain cell shape

- Assist in cell movement and muscle contraction

Intermediate filaments:

- Provide mechanical strength and support to cells

- Help anchor organelles and maintain cell structure

Microtubules:

- Form the spindle apparatus during cell division

- Serve as tracks for intracellular transport and vesicle movement

The cytoskeleton is composed of different components, each with its own characteristics and functions. Microfilaments are responsible for maintaining cell shape and assisting in movement, while intermediate filaments provide mechanical strength and anchor organelles. Microtubules play a crucial role in cell division and act as tracks for intracellular transport.

By categorizing the characteristics of the cytoskeleton components, we can understand their specific roles within the cell. Microfilaments, intermediate filaments, and microtubules contribute to various cellular processes, highlighting the dynamic and essential nature of the cytoskeleton in maintaining cell structure and facilitating cellular functions.

To know more about cytoskeleton click here:

https://brainly.com/question/1216965

#SPJ11


Related Questions

Plate with a missing piece: located the center of mass comp of plate P in terms of R.

Answers

To locate the center of mass of a plate with a missing piece, we need to find the center of mass of the remaining part and then adjust for the missing piece.

Assuming the missing piece is a circular sector with radius R and angle α, we can find the center of mass of the remaining plate by dividing it into simpler shapes, such as rectangles or triangles, and using the formulas for their centers of mass. Let's assume that the plate has a uniform density.

Once we have the center of mass of the remaining plate, we need to adjust for the missing piece. The center of mass of the missing piece can be found using the formula for the center of mass of a circular sector, which is:

x_cm = (2R/3α) * sin(α/2)

y_cm = (2R/3α) * (1 - cos(α/2))

where x_cm and y_cm are the x and y coordinates of the center of mass of the missing piece, respectively.

To find the overall center of mass of the plate, we can use the principle of superposition, which states that the center of mass of a composite object is the weighted average of the centers of mass of its individual parts, where the weights are given by the masses of the parts. In this case, the mass of the missing piece is proportional to its area, which is \(R^2\)times half of the angle α, so we can write:

x_com = [(M1 * x1) + (M2 * x2)] / (M1 + M2)

y_com = [(M1 * y1) + (M2 * y2)] / (M1 + M2)

where x_com and y_com are the x and y coordinates of the center of mass of the plate, M1 and M2 are the masses of the remaining plate and the missing piece, respectively, and (x1, y1) and (x2, y2) are their respective centers of mass.

Putting it all together, we can express the center of mass of the plate P in terms of R as:

x_com = (M1 * x1 + M2 * x2) / (M1 + M2)

y_com = (M1 * y1 + M2 * y2) / (M1 + M2)

where M1 is the mass of the remaining part, which can be calculated by subtracting the area of the missing sector from the total area of the plate and multiplying by the density, and M2 is the mass of the missing sector, which is proportional to its area. The centers of mass (x1, y1) and (x2, y2) can be calculated using the formulas for the centers of mass of the simpler shapes that make up the plate. Finally, we substitute the expressions for x1, y1, x2, y2, M1, and M2 into the above equations to obtain the center of mass of the plate P in terms of R.

Learn more about center of mass ,

https://brainly.com/question/30259066

#SPJ4

Fill in the blank - ____________ is the use of electronic instruments to monitor and physiological changes mostly regulated by the autonomic nervous system.

Answers

Answer: Biofeedback

Explanation: it mostly helps with body functions such as blood flow, blood pressure, and heart rate.

Biofeedback is the use of electronic instruments to monitor and physiological changes mostly regulated by the autonomic nervous system.

What is autonomic nervous system?

"The autonomic nervous system is a component of the peripheral nervous system that regulates involuntary physiologic processes."

What is the main function of autonomic nervous system?

"The autonomic nervous system regulates certain body processes, such as blood pressure and the rate of breathing."

What do you mean by biofeedback?

"Biofeedback is a technique you can use to learn to control some of your body's functions, such as the heart rate."

What is the basic principle of biofeedback?

"This technique involves using visual, physical and/or auditory feedback to guide the patient to give their optimal performance."

To know more about autonomic nervous system here https://brainly.com/question/1034520

#SPJ2

In the 1970s, the pesticide DDT was used to kill insects that damaged fruit and vegetable crops. Most insects died from being exposed to DDT, but some survived. These surviving insects contributed to an increase in their population by

Answers

Answer:

gaining modification in their Gene's which helped them to resist that particular pesticide

These surviving insects contributed to an increase in their population by passing genes for DDT resistance to the next generation.

What is a resistance gene?

In order to survive, bacteria can create mechanisms known as resistance against antibiotics and antifungals. The germ's resistance mechanisms are determined by the specific proteins that DNA instructs the germ to produce. Many different forms of resistance genes can be found in bacteria and fungi.

Once a bacteria have acquired a resistance gene and incorporated it into its DNA, the bacterium can dominate other bacteria and convey the resistance gene to all of its offspring. Bacteria reproduce quickly, which amplifies resistance.

Hence, These surviving insects contributed to an increase in their population by passing genes for DDT resistance to the next generation.

Learn more about resistance genes, here:

https://brainly.com/question/29412761

#SPJ6

A larger volume of neuronal cell bodies in areas that support attentional control is related to ________ intelligence but not to ________ intelligence.

Answers

Answer:

Fluid; crystallized.

Hope this helps!

Don't forget to mark me as Brainliest.

The female gametophyte is a _______ structure called an embryo sac, while the male gametophyte is a _______ structure called a pollen grain. When pollen attaches to the stigma of a flower, one of the sperm cells fertilizes an egg cell, producing a _______ zygote. Another sperm cell fertilizes the polar nuclei, forming a ________ endosperm. The _____ will eventually develop into the sporophyte.

Answers

The answers to the blank spaces in the question are as follows:

HaploidHaploidDiploidTriploidZygote

What is double fertilization?

Double fertilization is a specific feature of angiosperms involving two male gametes and one female gamete.

In double fertilization, both the female and male gametes are haploid structures i.e. contain one set of chromosome.

One of the haploid sperm cells fertilizes an haploid egg cell, producing a diploid (2n) zygote. However, the other sperm cell fertilizes the polar nuclei, forming a triploid endosperm.

The zygote will eventually develop into the sporophyte (vegetative plant).

Learn more about double fertilization at: https://brainly.com/question/305603

The _____ consists of a group of tissues in which small blood vessels from the mother and the offspring intertwine but do not join.

Answers

Answer:

Umbilical cord, Nervous system & Digestive system

Explanation:

These are the group of tissue in small blood vessels that can't join between mother and offspring blood vessels.

Explain how a root hair cell is specialised for its function

Explain how a root hair cell is specialised for its function

Answers

Root hair cells are adapted for taking up water and mineral ions by having a large surface area to increase the rate of absorption. They also contain lots of mitochondria , which release energy from glucose during respiration in order to provide the energy needed for active transport.
Hope this helps, have a nice day!:)

Root hair cell are adapted for absorption of water by having a tubular structure which increases its surface area.

What is root hair cell?"Root hair cells are single tubular root cells."Due to its shape it has large surface area which helps in absorption of water.How root hair cell absorb water?The root hair cell absorb water by osmosis ("movement of solvent takes place from high water concentration to low water concentration through a semipermeable membrane.")

Hence we can say that root hair cell has large surface area which specialized in absorption of water.

To know more about root hair cell here

https://brainly.com/question/23811428

#SPJ2

What are the roles of the brain and spinal cord in the central nervous
system?

Answers

Answer:

together, the brain and spinal cord form the central nervous system. This complex system is part of everything we do. It controls the things we choose to do—like walk and talk—and the things our body does automatically—like breathe and digest food

hope that helps

Answer: The central nervous system controls most functions of the body and mind. It consists of two parts: the brain and the spinal cord. The brain is the center of our thoughts, the interpreter of our external environment, and the origin of control over body movement.

Explanation: I've answered this question many times before

Two amino acids of the standard 20 contain sulfur atoms. They are: A) cysteine and serine. B) cysteine and threonine. C) methionine and cysteineD) methionine and serine E) threonine and serine.

Answers

The two amino acids of the standard 20 that contain sulfur atoms are cysteine and methionine. Cysteine contains a thiol (-SH) group, which contains a sulfur atom, while methionine contains a sulfur atom in its side chain. Threonine and serine do not contain sulfur atoms in their side chains.

~~~Harsha~~~

How greenhouse gases can lead to the formation of damaging acid rain

Answers

Explanation:

those gases dissolve with water vapor in the air to form H2SO4 and HNO3

When it rains, these acids dissolve into rainwater and makes the pH of the rainwwater decreases

What happens to the oxygen released during photosynthesis ?

Answers

Answer:

oxygen is released as a byproduct.

Explanation:

it breaks down glucose, releasing chemical energy and heat in the process of photosynthesis.

Which of the following refers to the place where a species lives?
A
niche
B
habitat
С
ecosystem
D
biome

Answers

Answer:

habitat

Explanation:

Habitat refers to the natural environment or the natural place where an organism lives. Habitat also refers to the physical place where a species or a population lives. Hence, habitat of grizzly bear refers to the physical place where it lives.

Answer: B Habitat

A habitat meets all the environmental conditions an organism(any living thing) needs to survive

Lithified detritus (breakdown products of preexisting rocks) forms which kind of sedimentary rock? A. biochemical B. chemical C. clastic D. organic

Answers

Clastic is the sedimentary rock which is formed by lithified detritus

What do you mean by Clastic?

Rocks that are mostly made of the broken fragments or clasts of older weathered and worn rocks are known as clastic sedimentary rocks. Grain size, the nature of the clast and cementing material (matrix), and texture are used to categorise clastic deposits or sedimentary rocks. Determining the environment of deposition for a sample can frequently be accomplished using the categorization factors. A river system that transports a wide variety of grains made up of fragments eroded from solid rock upstream is one example of a clastic environment.

In shales and claystones, the grain size ranges from clay to silt to sand to gravel, cobble, and boulder-sized fragments in conglomerates and breccias. These terms are quantitatively arranged in a logarithmic size scale using the Krumbein phi () scale.

Therefore, Clastic is the sedimentary rock which is formed by lithified detritus

To learn more about clastic from the given link:

https://brainly.com/question/2416010

#SPJ1

BRAINLIEST!!!!! What is one way that urbanization can impact the environment?
(I know this is environmental science but they didnt have that option)

Answers

Explanation:

Urban development can magnify the risk of environmental hazards such as flash flooding. Pollution and physical barriers to root growth promote loss of urban tree cover. Animal populations are inhibited by toxic substances, vehicles, and the loss of habitat and food sources.

How did cyanobacteria aid the evolution of complex life on land? Do you think cyanobacteria are as significant to this process today as

they were during Precambrian time?

NEED ASAPPPP ITS TIMED

Answers

Cyanobacteria are one of the most ancient groups of photosynthetic organisms. They played a critical role in the evolution of complex life on land by producing oxygen. They are also known as blue-green algae. They have existed on Earth for more than 3.5 billion years and played an essential role in creating Earth's oxygen-rich atmosphere. The emergence of cyanobacteria marks a significant point in Earth's evolution.

The presence of oxygen allowed for the development of complex organisms, including plants and animals. Cyanobacteria aided the evolution of complex life on land by their ability to photosynthesize. They were the first organisms to evolve a complex process that enabled them to use sunlight to convert carbon dioxide and water into oxygen and glucose.

This process is known as photosynthesis, and it is responsible for the oxygen-rich atmosphere of our planet. Cyanobacteria were the first photosynthetic organisms to produce oxygen. During Precambrian time, cyanobacteria produced more oxygen than any other organism. They were responsible for oxygenating Earth's atmosphere and allowing for the evolution of aerobic organisms.

To know more about Cyanobacteria visit:

https://brainly.com/question/2516577

#SPJ11

State Two ways in which angiosperms are better adapted to terrestrial lofe than bryophytes

Answers

Angiosperms (flowering plants) are better adapted to terrestrial life than bryophytes (non-vascular plants) in several ways such as vascular system and flowers and fruits.

Here are two examples:

Vascular System: Angiosperms have a well-developed vascular system consisting of xylem and phloem tissues. The xylem is responsible for water and mineral transport from roots to the rest of the plant, while the phloem transports photosynthetic products from leaves to other parts of the plant. This vascular system allows angiosperms to grow taller and stronger than bryophytes, which lack a proper system for water and nutrient transport.

Flowers and Fruits: Angiosperms have evolved unique structures such as flowers and fruits, which are absent in bryophytes. Flowers are specialized reproductive structures that attract pollinators and facilitate fertilization, leading to the production of seeds. Fruits are the mature ovary of a flower that protect and disperse the seeds. These adaptations give angiosperms a greater chance of successful reproduction and survival, as well as increasing their ability to colonize new habitats.

learn more about vascular system here:

https://brainly.com/question/30273257

#SPJ4

explain hybrid vigour.​

Answers

Answer:

another term for heterosis.

Explanation:

Answer:

Explanation:

it is another term for heteroris or the is the increased functionof any biology quality in a hrbird offspring

An animal with no natural enemy is a ____________.

Answers

Answer:

predator or a.pex predator

An animal with no natural enemy is an apex predator. Apex predators are also known as top predators or alpha predators.

They are species that reside at the highest level of the food chain within their ecosystems. They have no natural predators and primarily feed on other animals. Apex predators play a critical role in maintaining the balance and functioning of their respective ecosystems.

These predators are often characterized by their exceptional hunting skills, agility, strength, and ability to control the populations of their prey. They exert top-down control on the food chain by keeping the populations of lower-level consumers and herbivores in check, which in turn has cascading effects on the entire ecosystem. Thus, apex predators have no natural enemies.

Learn more about apex predators, here:

https://brainly.com/question/14810553

#SPJ6

What is the plant source of vitamin A called?

Answers

Your body can produce vitamin A from carotenoids found in plants. These carotenoids include beta-carotene and alpha-carotene, which are collectively known as provitamin A.

- BRAINLIEST answerer ❤️

Plant sources of vitamin A include: mangos, papaya, many of the squashes, carrots, sweet potatoes and maize (but not the white varieties). Other good sources of vitamin A are red palm oil and biruti palm oil.

Hope my answer helped u :)

Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as:

Answers

Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as homeostatic mechanisms.

Homeostasis is the body's ability to maintain a stable internal environment despite external changes.

In the context of the brain, homeostatic mechanisms involve various processes that regulate physiological functions and maintain optimal levels of essential substances.

These mechanisms can include feedback loops that detect imbalances and initiate corrective actions.

For example, if there is a deficiency in a particular nutrient or hormone, the brain may activate mechanisms to increase its production, decrease its consumption, or enhance its absorption from the environment.

Homeostatic mechanisms play a crucial role in ensuring the body's overall stability and functioning, helping to maintain proper levels of various substances and promoting overall well-being.

To know more about Homeostasis, refer here:

https://brainly.com/question/15647743#

#SPJ11

can anyone help me plz


Below is a photo of algae, microorganisms that live in water.
What is the role of these organisms in their environment?
A. They produce food that other organisms eat.
B. They return nitrogen gas to the atmosphere.
C. They break down the wastes of other organisms.
D. They cause diseases in many kinds of animals,

can anyone help me plzBelow is a photo of algae, microorganisms that live in water.What is the role of

Answers

It’s either A or B.
They produce the food web for all aquatic organisms. So, I would go with A, but I am bot sure.
Good luck!

Shortly after a meal containing complex carbohydrates is eaten, concentration of glucose in
the blood increases. Explain how this occurs.

Answers

Answer:

true

Explanation:

a mutation causes an increase in the production of the enzyme dna demethylase. this will most likely lead to methylation and a(n) in overall gene expression.

Answers

A mutation causes an increase in the production of the enzyme dna demethylase. this will most likely lead to methylation and decrease in overall gene expression.

A mutation in the gene that encodes the enzyme DNA demethylase can lead to an increase in the production of this enzyme. This in turn can lead to increased methylation of DNA, and ultimately to a change in gene expression. The precise effect of this mutation will depend on the specific gene involved and the extent of the increase in DNA demethylase activity.

In general, however, this mutation is likely to have a negative impact on gene expression and may lead to disease.The increased expression of genes may have beneficial or harmful effects, depending on the particular gene involved. For example, an increase in the expression of a gene involved in cell growth could lead to cancer.

A mutation that causes an increase in the production of the enzyme DNA demethylase will most likely lead to methylation and a decrease in overall gene expression. Methylation is a process by which a methyl group is added to a DNA molecule, usually by the addition of a methyl group to one of the DNA bases. This process can cause changes in the structure of the DNA molecule and can lead to gene silencing.

Learn more about Methylation at : https://brainly.com/question/13036206

#SPJ4

What's the meaning of fiber ?

Answers

Fiber, also known as dietary fiber, refers to a type of carbohydrate that is found in plant-based foods such as fruits, vegetables, whole grains, and legumes.

Unlike other types of carbohydrates, such as sugars and starches, fiber is not broken down or absorbed by the body. Instead, it passes through the digestive system largely intact.

There are two main types of fiber: soluble fiber and insoluble fiber. Soluble fiber dissolves in water and forms a gel-like substance in the digestive tract, which can help to slow digestion and regulate blood sugar and cholesterol levels. Insoluble fiber, on the other hand, does not dissolve in water and adds bulk to stool, which can help to prevent constipation and promote regularity.

Fiber is an important component of a healthy diet, and has been linked to a variety of health benefits such as lower risk of heart disease, diabetes, and certain types of cancer.

To learn more about fiber refer to:

brainly.com/question/30561600

#SPJ4

Help me pleaseyyyyyy

Help me pleaseyyyyyy

Answers

Answer:

Cells spend the most time in interphase. The evidence that support my answer is that the graph shows that the cell spends 79 hours in interphase, which is more than the sum of all the times in each phase of mitosis

What is the immune system response to malaria?



Outline the 3 lines of defence of the immune system.

Answers

Answer:

Although the evidence for a protective role of B cells and antibodies has been noted, the direct contribution of CD4+ T cells in protection against blood stages beyond a helper function for CD4+ T cells has mainly derived from rodent models of malaria.

Explain what caused the existence of the dark-colored peppered MOTHS:)

Answers

Answer:

The moths adapted to the environment they were in which was heavily polluted and the spots helped it blend into the environment. It was in the UK somewhere I don't remember where though.

Explanation:

The peppered moth's evolution is an example of how air pollution during the Industrial Revolution caused directional color changes in the moth population.

What are the adaptation of dark-colored peppered moths?

The genetic basis for color was eventually discovered. Moths inherited their color from their ancestors. Eggs from light moths became light moths, whereas eggs from dark moths became dark adults.

At that time, a manifestation of industrial melanism was the rise in the number of dark-colored moths.

The moths blended in with the severely contaminated environment they were in thanks to their markings, which helped them adapt to it. Although I can't recall where, it was in the UK.

Therefore, A mutation in one moth's DNA resulted in the dark color, and the mutant gene was passed on to all the moth's progeny.

Learn more about peppered moths here:

https://brainly.com/question/3384078

#SPJ6

The organism used in bread making is?
(a) Yeast
(b) Aspergillus
(c) Mushroom
(d) Rhizobium​

Answers

Answer:

Yeast is used in bread making

The answer is yeast !

16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe

Answers

The phenotype is affected by mutations 1 and 2 because in the first, the complete protein is altered, and in the second, the new amino acid may cause the protein to have altered or no function.

What is Mutation?

Mutations can happen naturally or as a result of UV rays, congenital conditions, ionic radiations, or specific free radicals.

Even with the point mutation, there is no alteration to the amino acid sequence, hence the protein will not be affected.

In mutation 1, a new nucleotide is added at codon 9, changing the whole sequence of amino acids and codons in the process,  mutation frameshift.

Because a new codon was created as a result of the substitution of one nucleotide by another in mutation 2, produced a new amino acid, so Point mutation.

Therefore, in mutation 3, one nucleotide is swapped out for another, and the resulting codon codes the same amino acid as the one before it, so point mutation.

Learn more about mutation, here:

https://brainly.com/question/17130462

#SPJ4

HELPPP ME PLEASE ILL MARK YOU AS BRAINLIEST
Why might you want to do a random sampling instead of a line transect sampling?

Answers

Answer:

Depending on the situation you would want random sampling

Explanation:

For example, all units will have an equal chance of being selected

Other Questions
A pollster would like to predict the mayoralty winner of a certain town. However, his budget for a quick survey is good only for 30 out of the 110 barangays of that town. Which statistics is more appropriate to use descriptive or inferential? Justify your answer. ___ is(are) concerned with how much more expensive all goods and services will become this year.Please choose the correct answer from the following choices,Answer choicesMicroeconomicsNeither macroeconomics nor microeconomicsBoth microeconomics and macroeconomicsMacroeconomics Identify elements of article ii of the code of conduct Scientific studies conducted on a popular energy drink, "Ragin Rhino" (RR), concluded that there was no beneficial physiological effect from drinking RR, but that there were several potentially harmful side-effects. The makers of RR produced a letter from a testing laboratory certifying the beneficial effects of RR with no statistically significant incidence of harmful side effects. RR sent the letter to retail stores that had previously stocked RR, to major retail chains that had yet to offer RR for sale, and to pro athletes in 24 different sports. When the Federal Trade Commission (FTC) instituted enforcement action against RR for false and misleading statements, RR admitted that the statements in the letter were false. But RR argued that since the letters were not advertising, they were protected free speech that could not result in penalties from the government. Was is the likelihood of success of RRs defense? discrimination 1. Who experience this discrimination? 2. What kind of discrimination was it? What happened? What was their reaction? 3. How was it resolved? 4. If you were in their shoes, what would you have done differently? please help me on this bukas na due date nito please help me please sagot your family or friend who experience discrimination In terms of culture, assertiveness focuses on the level of appropriate Multiple choice question. Directness. Comfort. Generosity. Wariness Need help ASAP.What is the month interest payment for an account with a balance of $500.00 and an A.P.R. of 18%?A. $41.67B. $7.50C. $27.78D. $90.00 Why do we use logos and what do they mean? What is the due process clause of the 14th Amendment?. Carboxylic acids are weak acids and dissociate in aqueous solution to the carboxylate anion. RCOOH(aq) Rcoo-(aq) + H'(aq) The extent of dissociation is given by the equilibrium dissociation constant, Ka, which is often expressed in its logarithmic form as pKa. (The cation is written simply as Ht and is understood to be solvated with one or more water molecules in solution.) If an acetic acid/acetate buffer is 0.020 M in acetic acid and has a pH of 4.87, what is the molar concentration of the acetate ion? The pKa of acetic acid is 4.75. CH3COO- = ? Explain why sex-linked disorders affect one sex more than the other. A can of corn is modeled below. The diameter of the cylinder is 6 cm and the height is 10 cm.The Volume of a Cylinder can be find by using the formula V=BhVhich expression can be used to show the B (the area of the base) of the can of corn? What are the work experience Secretary of Energy? Which of the following often result of the use of drugs? Dominant groups tend to use negative stereotypes of minorities when the minorities appear to be? For a sample size of 36 and a population Standard Deviation of 3, the sample variance for distribution of the means is: Lydia buys 5 pounds of apples and 3 pounds of bananas for a total of $8.50. Ari buys 3 pounds of apples and 2 pounds of bananas for a total of $5.25. Determine a system of equations that represents the given the situation. Let x be cost per pound of apples and let y be the cost per pound of bananas. Which equation represents the amount of money Lydia spent of apples and bananas? Which equation represents the amount of money Ari spent on apples and bananas? Exit6-3: PRACTICE Part 2 Logarithms in Equations Algebra 2Michael invests $1,000 in an account that earns a 4.75% annual percentage rate compounded continuously. Peter invests $1,200 in an account that earns a 4.25% annualpercentage rate compounded continuously. Which person's account will grow to $1,800 first?Michael's account will grow to $1,800 after about year(s). Peter's account will grow to $1,800 after about year(s). So,(Round to the nearest whole number as needed.)Video Textbook Get more help.Review ProgressViMoreQuestion8Clear allof 9Due 04/13/23account will grow to $1,800 first.Check answer< BackNext Solve the system using the elimination method. - Which one should I do first3x-4y+z=-56x-4y+z=1x+y+z=6 Help please explanation as detailed as you can make it but easy to understand