Please I need help with this question

Please I Need Help With This Question

Answers

Answer 1
This is a function because each input has exactly one output ❤️

Related Questions

the exaggeration of the eye size on sumerian votive sculptures likely symbolizes their ____.

Answers

The exaggeration of the eye size on Sumerian votive sculptures likely symbolizes their importance in the spiritual world. In Sumerian culture, eyes were believed to be the windows to the soul and were associated with divinity.

By emphasizing the size of the eyes on their votive sculptures, the Sumerians were likely indicating the spiritual power and significance of the figures represented.
Additionally, the Sumerians believed that the gods were ever-watchful and all-seeing, and the large eyes on their votive sculptures may also represent this idea. By creating figures with oversized eyes, the Sumerians may have been depicting the deities as constantly vigilant and aware of the actions of their followers.
Another interpretation of the large eyes on Sumerian votive sculptures is that they symbolize the ability to see beyond the physical world and into the realm of the divine. The Sumerians believed in the existence of a spiritual realm and may have used the large eyes on their sculptures to represent the ability to perceive and connect with this realm.
Overall, the exaggeration of the eye size on Sumerian votive sculptures likely symbolizes the importance of spiritual connection, the watchful nature of the gods, and the ability to see beyond the physical realm.

to learn more about Sumerian votive sculptures, refer:-

https://brainly.com/question/31595853

#SPJ11

What is the value of x when the expression 12x + 7 equals
the expression - 8 + 13x?

Answers

Answer:

x = 15

Step-by-step explanation:

12x + 7 = -8 + 13x

15 = x

What is the value of a ? (Round your answer to the nearest degree .)

What is the value of a ? (Round your answer to the nearest degree .)

Answers

Answer:

a = 32.28°

Step-by-step explanation:

In the given right triangle,

Opposite side = 12

Adjacent side = 19

By applying tangent rule in the given triangle,

tan(a°) = \(\frac{\text{Opposite side}}{\text{Adjacent side}}\)

tan(a°) = \(\frac{12}{19}\)

a = \(\text{tan}^{-1}(\frac{12}{19})\)

a = 32.28°

What number is halfway between 4 and 20?

Answers

Answer:

4....20. 12 is halfway

Step-by-step explanation:

5 19

6 18

7 17

8 16

9 15

10 14

11 13

12

to find the halfway of given numbers all you gotta do is add them and then divide by 2. i.e. (4+20)/2= 24/2 = 12

5) A warehouse outside of a factory currently has an inventory of 1245 boxes. After an 8-
hour work day, the warehouse has 2000 boxes. Assume the warehouse was being filled at a
constant (linear) rate.

a) How many boxes per hour is the factory able to provide to the warehouse?

b) What would be the inventory at the end of a 40-hour work week?

c) How long will it take to fill the warehouse to its 50,000 box capacity?

6) In the year 2007, a FOREVER stamp cost cost $0.41. In 2023, the cost of a FOREVER
stamp was $0.63. Assume that the cost of stamps increased at a constant (linear) rate.

a) If price increases continue at the current rate, how much will a FOREVER stamp
cost in 2035?

b) In what year would you expect a FOREVER stamp to cost one dollar?

7) In January of 2021, there were 980,000 games available on the Apple App Store. By July
of 2021, there were 984,200 games available. If we assume that the number of available
games is steadily increasing at a constant (linear) rate,

a) How many games does this pattern predict will be available in January 2022?

b) At this rate, when will there be 1,000,000 games available for purchase in the Apple
App Store?

Answers

Thee factory is able to provide 94.38 boxes per hour to the warehouse.

How to calculate the value

Rate = (2000 - 1245) / 8 = 94.38 boxes per hour

Therefore, the factory is able to provide 94.38 boxes per hour to the warehouse.

Boxes added in 40 hours = rate * time = 94.38 * 40 = 3,775.2

Therefore, the inventory at the end of a 40-hour work week would be:

1245 + 3775.2 = 5020.2 boxes

rate = (50000 - 1245) / time

Simplifying this equation, we get:

time = (50000 - 1245) / rate = 511.64 hours (rounded to two decimal places).

Therefore, it will take approximately 511.64 hours to fill the warehouse to its 50,000 box capacity,

Learn more about word problem on

https://brainly.com/question/21405634

#SPJ1

Can someone please check my answer

Can someone please check my answer

Answers

Answer: That looks right to me

Step-by-step explanation:

how long will it take for the battery to run down one sixth of its capacity of 3600 Milli Ampere hours​

Answers

Answer:

6 hours

Step-by-step explanation:

\(\frac{1}{6}\) of Total battery life = \(\frac{1}{6} * 3600 = 600\)milliamps

Assuming the battery takes 100 Milliamps per hour,

Time = Battery Capacity / Current hours

Time = 600 / 100 Mah = 6H

Mrs. Loar has to grade 75 papers. Mrs. Holt is helping her grade. Mrs. Loar graded 60 papers and Mrs. Holt graded the rest. What percent of the papers did Mrs. Holt grade? Use a double number line to solve the problem.

Answers

Answer:

25%

Step-by-step explanation:

Mrs. Loar has to grade 75 papers. Mrs. Holt is helping her grade. Mrs. Loar graded 60 papers and Mrs. Holt graded the rest.

Hence, the amount of papers Mrs Holy graded is = 75 - 60

= 15 papers

What percent of the papers did Mrs. Holt grade?

This is calculated as:

15/60 × 100 = 25%

Hence, Mrs Holy graded 25% of the papers

how can algorithms lead to market failures? can you please give me incidents where market failures occurreddue to algorithms.

Answers

Algorithms can lead to market failures when they are designed or implemented with biases, lack transparency, or exhibit unintended consequences. These can result in unfair pricing, manipulation of markets, or discriminatory outcomes.

Algorithms are mathematical models that make automated decisions based on predefined rules and data inputs. While they can bring efficiency and objectivity to market processes, they are not immune to flaws or unintended consequences. Here are a couple of incidents where market failures occurred due to algorithms:

1. Flash Crash of 2010: On May 6, 2010, the U.S. stock market experienced a significant crash, now known as the "Flash Crash." This event was triggered by algorithmic trading strategies that amplified market volatility. High-frequency trading algorithms, which executed trades at incredibly fast speeds, worsened the situation by reacting to market conditions in an unstable manner. The crash caused a temporary loss of nearly $1 trillion in market value before recovering. It highlighted the risks associated with complex algorithmic trading systems and the potential for unintended consequences.

2. Discrimination in Online Advertising: Algorithms used in online advertising platforms have faced criticism for perpetuating discriminatory practices. These algorithms can inadvertently lead to biased outcomes by targeting or excluding specific groups based on race, gender, or other protected characteristics. For example, if an algorithm learns from historical data that certain groups have been less likely to engage with certain ads, it may perpetuate this bias by disproportionately showing or withholding those ads from those groups. This can result in discriminatory market outcomes, limiting opportunities and exacerbating inequalities.

Market failures can occur due to algorithms when they are not properly designed, implemented, or regulated. Unintended consequences, biases in data, lack of transparency, and high-speed automated trading can all contribute to these failures. It is essential to recognize the potential risks associated with algorithmic decision-making and take measures to ensure fairness, accountability, and transparency in their use to mitigate the occurrence of market failures.

To know more about Algorithms follow the link:

https://brainly.com/question/24953880

#SPJ11

Look at the image for the problem, also round to the nearest hundredth if necessary.

Look at the image for the problem, also round to the nearest hundredth if necessary.

Answers

ANSWER

\(V=3052.08ft^3\)

EXPLANATION

We want to find the volume of the sphere.

The volume of a sphere is given as:

\(V=\frac{4}{3}\cdot\pi\cdot r^3\)

where r = radius of the sphere.

Therefore, we have that the volume of the sphere is:

\(\begin{gathered} V=\frac{4}{3}\cdot3.14\cdot9^3 \\ V=3052.08ft^3 \end{gathered}\)

That is the volume of the sphere.

In the House of Commons, citizens elect their members. Of the 800 members, 530 are from England, 120 are from Wales, 100 are from Scotland and 50 are from Northern Ireland. What is the percentage of members from Wales?

Answers

Answer:

15%

I like your demon slayer profile picture

Answer:

The answer is 15%.

Step-by-step explanation:

If 100 is 10% it only makes since that 15% is the right answer.

Hope This Helps!

Please help!!

For each system of equations, use substitution or elimination to find the solution. Next, analyze your solution to determine if it makes sense in the context.


For each system of inequalities, find the solution region by graphing. Only graph viable solutions. Next, give two examples of solutions that would work in the situation.


Q.1. The total cost for 14 tickets to a concert is $462. Lawn tickets cost $26 each, and pavilion seats are $54 each. How many of each type of ticket were sold?

Answers

10.5 lawn tickets and 3.5 pavilion seats were sold, which equals the total cost of $462.

We can utilise substitution to solve this set of equations. Let x represent the number of lawn tickets and y represent the number of pavilion seats. We can create two equations to represent the total cost of the tickets.

26x + 54y = 462

x + y = 14

To find the value of y, we can change the value of x from the second equation into the first equation.

26(14 - y) + 54y = 462

364 - 26y + 54y = 462

-26y + 54y = 462 - 364

28y = 98

y = 3.5

The second equation can then be solved for x by reintroducing the value of y.

x + 3.5 = 14

x = 10.5

This means that 10.5 lawn tickets were sold, and 3.5 pavilion seats were sold. To check if this solution makes sense, we can substitute our answer into the first equation to calculate the total cost.

26(10.5) + 54(3.5) = 462

This equation does equal 462, so our solution is correct. This makes sense in the context because it is a valid combination of tickets that adds up to the total cost of $462.

To learn more abut substitution visit;

https://brainly.com/question/26094713

#SPJ4

Is this correct please check the answer quickly

Is this correct please check the answer quickly

Answers

Answer:

Step-by-step explanation:

No, this is not correct.

Step 1: Find the directional distance from every vertex on the blue image to  the center, Point C.

Point A is 1 unit left and 4 units upwards to Point C.

Point B is 4 units right and 5 units upwards to Point C.

Point C is the center of the dilation, so that point will not change.

Step 2: Apply the scale factor to the directional distances to know the distances of the new images.

The scale factor is 2 so

Point A' should be 2 units left and 8 units upwards to Point C.

Point B' should 8 units right and 10 units upwards to Point C.

Step 3:  Move the point in respect to Point C.

The new image should have the these points.

One point that is 2 units left and 8 units upwards to Point C.

Another point that is Point B' should 8 units right and 10 units upwards to Point C.

One point that coincides  with  Point C.

Someone Please Solve For x

Someone Please Solve For x

Answers

The numerical value of x is 23.

What is the numerical valie of x?

Vertical angles are simply angles that are opposite of each other when two straight lines crosses.

They are congruent, hence, they have the same angle measure.

From the diagram:

Angle A = ( 6x - 100 )°Angle B = ( x + 15 )°

Since the angles that are opposite of each other, they are vertical angles, meaning they are congruent.

Hence:

Angle A = Angle B

( 6x - 100 ) = ( x + 15 )

Solve for x

6x - x = 15 + 100

5x = 115

x = 115/5

x = 23

Therefore, x has a value of 23.

Learn more about vertical angle here: https://brainly.com/question/24460838

#SPJ1

Which points are located on this graph?

Which points are located on this graph?

Answers

Answer:

(-3, 0)

(0, 3)

(1, 4)

Step-by-step explanation:

It’s easier if you make an equation like this!

Start by finding the slope using two points

m = slope

m = y2 - y1/x2 - x1

For right now, I’m going to have to use two points from the graph.

Points: (-5, -2) and (0, 3)

m = 3 - -2/0 - -5

m = 5/5

m = 1

Now find the y-intercept (located where x coordinate is 0)

y-intercept = 3

Now make the equation of a line that has a slope of 1 and a y-intercept of 3

y = x + 3

Now use any point to see if it is a point on the graph.

y = x + 3

Point: (2, 5)

5 = 2 + 3

5 = 5

Therefore it is a point

y = x + 3

Point: (-3, 0)

0 = -3 + 3

0 = 0

y = x + 3

Point: (2, 4)

4 = 2 + 3

4 = 5

C,
D,
F is the correct choices

11.) The table shows four account transactions. Find the account balance after all the
account transactions if the account started at zero.
deposit $35
deposit
$25
withdrawal -$50
withdrawal -$25

11.) The table shows four account transactions. Find the account balance after all theaccount transactions

Answers

Answer:

-15

Step-by-step explanation:

35+25=60

60-50=10

10-25=-15

A rock sample containing an isotope with a half-life of 28 million years has an initial mass of 184 grams. how much time has elapsed after three half-lives?

Answers

Half Life

The half life period is the time in which only half of the given population remains. It can be represented through this equation:

\(f(t)=a\times(1/2)^{\frac{t}{h}}\)

t = time passeda = y-intercepth = half life

Solving the Question

We're given:

h = 28 million yearsa = 184 grams (this is the initial mass, after 0 time has passed)

For most questions like this, we would have to plug these values into the equation mentioned above. However, this question asks for the time elapsed after 3 half-lives.

This can be calculated simply by multiplying the given half-life by 3:

28 million years x 3

= 84 million years

Answer

84 million years

Hi I need help with this

Hi I need help with this

Answers

Answer:

55

Step-by-step explanation:

90+35=125. 180-125=55. Answer: 55 degrees.

Answer:

Angle E = B. 55 degrees

Step-by-step explanation:

Every triangle's angles always add up to 180 degrees.

Angle F is marked as a 90 degrees angle, so we can then add 35 and 90 together to get 125.

Then, subtract 125 from 180 to get the measure of Angle E.

180 - 125 = 55

Angle E is measured at: B. 55 degrees.

Please mark me Brainliest, I need it to move on to the next level! =)

How many solutions does this system have?
y = 7 – 4x
y = -2(2x + 4)

A. Infinitely many
B.1
C.2
D. No solution

Will give brainliest.

Answers

Answer:

D

Step-by-step explanation:

Solving this algebraically causes the x terms to cancel out so you cannot solve for x.

Graphically, the lines never intersect meaning that there are no real solutions.

Linda had 90 fliers to post around town. Last week, she posted 1/5 of them. This week, she posted 1/3 of the remaining fliers. How many fliers has she still not posted?

Answers

The number of fliers that she has still not broadcasted will be 48 fliers.

What is Algebra?

Algebra is the study of ideational characters, while logic is the manipulation of all those opinions.

Linda had 90 fliers to post around town. Last week, she posted 1/5 of them. Then the number of fliers staying is given as,

⇒ (1 - 1/5) x 90

⇒ (4/5) x 90

⇒ 72 fliers

This week, she posted 1/3 of the remaining fliers. Then the number of fliers that she has still not broadcasted is given as,

⇒ (1 - 1/3) x 72

⇒ (2/3) x 72

⇒ 48 fliers

The number of fliers that she has still not broadcasted will be 48 fliers.

More about the Algebra link is given below.

https://brainly.com/question/953809

#SPJ1

A nurse provides a back massage as a palliative care measure to a client who is unconscious, grimacing, and restless. Which of the following findings should the nurse identify as indicating a therapeutic response? (Select all that apply.)
A. the shoulders droop
B. the facial muscles relax
C. the RR increases
D. the pulse is within the expected range
E. the client draws his legs into a fetal position

Answers

A nurse provides a back massage as a palliative care measure to a client who is unconscious, grimacing, and restless.

The therapeutic response that the nurse should identify in the client after a back massage includes relaxing of facial muscles and the pulse remaining within the expected range.
Massage is a fundamental nursing measure that is often utilized as part of palliative care for patients. The purpose of back massage is to promote relaxation, improve blood circulation, reduce muscle tension, and alleviate pain, stress, and anxiety. The nursing assessment of the patient before and after the massage is essential to determine its effectiveness as a therapeutic intervention for the patient.
When providing back massage as a palliative care measure to an unconscious, grimacing, and restless client, the nurse should identify several therapeutic responses as follows;
The shoulders droop: The nurse should expect the shoulders of the client to relax during massage therapy. If this occurs, it is a sign that the patient is experiencing relaxation and tension relief.
The facial muscles relax: Relaxation of the facial muscles is a common therapeutic response during back massage. The nurse should observe the patient's face for any signs of relaxation, which may include softening of facial lines, eyelids drooping, or a general expression of peacefulness.
The respiratory rate (RR) decreases: The nurse should expect the client's respiratory rate to decrease during a back massage. This is because relaxation stimulates the parasympathetic nervous system, resulting in decreased respiratory rate, heart rate, and blood pressure.
The pulse is within the expected range: The nurse should expect the client's pulse to remain within the expected range during a back massage. A normal pulse rate is between 60-100 beats per minute for adults. If the pulse remains within this range, it is a sign that the patient is responding positively to the massage therapy.

In conclusion, providing back massage as a palliative care measure to an unconscious, grimacing, and restless client can help to promote relaxation, improve blood circulation, reduce muscle tension, and alleviate pain, stress, and anxiety. The nurse should identify therapeutic responses in the patient during the massage therapy, which may include relaxation of the shoulders, facial muscles, decreased respiratory rate, and pulse remaining within the expected range.

To know more about blood circulation visit:

brainly.com/question/28915450

#SPJ11

Match each Item with the correct unit price.
1. 2 2/1/201
for one dollar
2. $3.78 for 6
3. 20 for $1.56
4.11
for $1.58
5. 5 at $3.90
NEXT QUESTION
ASK FOR HELP
78 cents each
63 cents each
7.8 cents each
$1.05 each
40 cents each

Answers

1.) $1 for 2 1/2 = 40 cents each

2.) $3.78 for 6 = 63 cents each

3.) $1.56 for 20 = 7.8 cents each

4.) $1.58 for 11 = $1.05 each

5.) $3.90 for 5 = 78 cents

1.) 2 1/2 for one dollar

Cost of 2 1/2 = 5/2 = $1

So, the cost of the item = 0.40 dollar

1 dollar = 100 cents, therefore 0.40 dollar = 40 cents

2.) $3.78 for 6

Cost of 1 item = 3.78/6

= 0.63 dollars

1 dollar = 100 cents, therefore 0.63 dollar = 63 cents

3.) $1.56 for 20

Cost of 1 item = 1.56/20

= 0.078

1 dollar = 100 cents, therefore 0.078 dollars = 7.8 cents

4.) $1.58 for 1 1/2

1 1/2 in improper fraction = 3/2

Cost of 1 item = 1.58/3/2

= $1.05

5.) $ 3.90 for 5

Cost of 1 item = 3.9/5

= 0.78 dollars

1 dollar = 100 cents, therefore 0.78 dollar = 78 cents

Learn more about unitary method:

https://brainly.com/question/28276953

#SPJ9

need answer quick
log √3 base 10 - 1/2 log 2 base 10​

Answers

The value of ㏒₁₀√3 - 1 / 2 ㏒₁₀2 is 1 / 2.㏒₁₀(1.5)

Given: To evaluate ㏒₁₀√3 - 1 / 2 . ㏒₁₀2

What are logarithms?

If a equation is given in the form of aᵇ = c, then ㏒ₐc = b or in a definitive way a logarithm is the power to which a number must be raised in order to get a number. As here 'a' is raised to the power 'b' to given a number c, so the number base 'a' if be raised to some power of 'b' then it will yield a number 'c'.

For example, 10² = 100 which can be written as ㏒₁₀100 = 2 by the following property of logarithm that is ㏒ₐ(bⁿ) = n.㏒ₐb.

So,  ㏒₁₀100 = ㏒₁₀10² = 2.㏒₁₀10 = 2 [ Another property ㏒ₐa = 1]

Some basic properties on logarithm operations are

1) ㏒ₙa + ㏒ₙb = ㏒ₙ(ab)

2) ㏒ₙa - ㏒ₙb = ㏒ₙ(a / b) [NOTE: ㏒ₙa - ㏒ₙb is not commutative]

3) ㏒ₐ(bⁿ) = n.㏒ₐb

4) ㏒ₐa = 1

Now let's solve the sum: ㏒₁₀√3 - 1 / 2 ㏒₁₀2

㏒₁₀√3 - 1 / 2 ㏒₁₀2 = ㏒₁₀(3)\(^{\frac{1}{2}}\) - 1 /2 .㏒₁₀2 [ Root means 1 / 2 power]

= 1 / 2.㏒₁₀(3) - 1 / 2.㏒₁₀(2)   [ ㏒ₐ(bⁿ) = n.㏒ₐb ]

= 1 / 2.(㏒₁₀(3) - ㏒₁₀(2))

= 1 / 2.(㏒₁₀(3 / 2)                  [ ㏒ₙa - ㏒ₙb = ㏒ₙ(a / b) ]

= 1 / 2.㏒₁₀(1.5)

Hence value of ㏒₁₀√3 - 1 / 2 ㏒₁₀2 = 1 / 2.㏒₁₀(1.5)

Know more about "logarithm functions" here: https://brainly.com/question/20785664

#SPJ9

. your customer is looking for new flooring for their kitchen. the room is 14’ x 24’. 4 boxes of flooring will cover 100 sq. ft. how many boxes will be needed to cover the kitchen floor?

Answers

The total number of boxes required to cover the kitchen floor is 14.

The dimensions of the kitchen floor are 14' × 24'

Length of the kitchen floor = 14 feet

Width of the kitchen floor= 24 feet

The area of the kitchen floor= Length × Width

⇒ Area = 14 × 24

⇒ Area = 336 sq. ft.

Since, 4 boxes of flooring cover 100 sq. ft.

1 box will cover = 100/4 sq. ft.

⇒25 sq. ft.

Now, Number of boxes required to cover the floor of the kitchen will be,

⇒ Area of the floor / Area covered by 1 box of flooring

⇒336/25

13.44

∴ The total number of boxes required to cover the kitchen floor is 14 (rounded up from 13.44).

Know more about Area: - https://brainly.com/question/16858316

#SPJ4

A sample of adults was asked to choose their favorite sport to watch from a list of four sports. Age Range 18-30 31-50 51 Total Sport Football 15 19 17 51 Baseball 7 12 18 37 Basketball 15 8 11 34 Soccer 12 9 6 27 Total 49 48 52 149 What proportion of those surveyed chose basketball as their favorite sport? StartFraction 34 Over 149 EndFraction StartFraction 15 Over 49 EndFraction StartFraction 18 Over 52 EndFraction StartFraction 37 Over 149 EndFraction

Answers

The proportion of those surveyed who chose basketball as their favorite sport is 34.149 (option a)

Let's denote the proportion of adults who chose basketball as their favorite sport as P(Basketball). To calculate P(Basketball), we need to divide the total number of adults who chose basketball by the total number of surveyed adults. Mathematically, it can be represented as:

P(Basketball) = (Number of adults who chose basketball) / (Total number of surveyed adults)

To calculate the number of adults who chose basketball, we sum up the values from the age range categories:

Number of adults who chose basketball = Number of adults (18-30) who chose basketball + Number of adults (31-50) who chose basketball + Number of adults (51 and above) who chose basketball

Looking at the table, we find that the number of adults (18-30) who chose basketball is 15, the number of adults (31-50) who chose basketball is 8, and the number of adults (51 and above) who chose basketball is 11. Adding these values together, we get:

Number of adults who chose basketball = 15 + 8 + 11 = 34

Now, let's calculate the total number of surveyed adults. We can sum up the values from the age range categories:

Total number of surveyed adults = Total number of adults (18-30) + Total number of adults (31-50) + Total number of adults (51 and above)

From the table, we find that the total number of adults (18-30) is 49, the total number of adults (31-50) is 48, and the total number of adults (51 and above) is 52. Adding these values together, we get:

Total number of surveyed adults = 49 + 48 + 52 = 149

Now, we have the values we need to calculate the proportion:

P(Basketball) = (Number of adults who chose basketball) / (Total number of surveyed adults)

= 34 / 149

Hence the correct option is (a).

To know more about proportion here

https://brainly.com/question/24232216

#SPJ4

How long will it take $2,000 to double at 10% simple interest?

Answers

Answer:

20 times

Step-by-step explanation:

2000 x 10% = 200

200x = 4000

x= 20

20 times

if xsqured +y squred =16, xy=10 find the value of x+y using bionomial expansion

Answers

Answer:

x+y=6

Step-by-step explanation:

to understand thisyou need to know about:algebraPEMDAStips and formulas:x²+y²=(x+y)²-2xylet's solve:

according to the question:

(x+y)²-2xy=16substitute the value of xy:(x+y)²-2.10=16simplify multiplication:(x+y)²-20=16add 20 to both sides:(x+y)²-20+20=16+20=>(x+y)²=36\( \sf squre \: root \: both \: sides : \\ \sqrt{ (x + y {)}^{2}} = \sqrt{36} \\ \therefore x + y = 6\)

what is the answer please help

what is the answer please help

Answers

Answer:

B: 22.5 degrees

Step-by-step explanation:

The interior angles of a pentagon add up to 540 degrees

(if you dont believe me you can turn a pentagon into three triangles, 3x180 = 540)

So you have four same angles say measure "x" degrees, and one final one that measures "5x" degrees, so 9x = 540, and x = 60

Unless I read the problem wrong, 60 degrees is the answer which is not an option :P

Edit: Yea I read it wrong, the final angle is 5 times the other four angles COMBINED, so that angle measures "20x" degrees.

The total would be 24x = 540, and so x = 22.5

please do this it's due tommrow

please do this it's due tommrow

Answers

Answer:    10. equal 0.27

                  11. 5.12

                  12. 3.35

Step-by-step explanation:

10. 0.9 * 0.3 = 0.27

11. 1.6 * 3.2 = 5.12

12. 0.5 * 6.7 = 3.35

13. 0.81*7.3 = 5.873

14. 5.6*3.9 = 21.84

15. 1.2 * 0.05 = 0.06

Joy went to the community swap meet, where the cost to get in is $2. She plans to buy some candles for $1.60 each. If Joy has $50, how many candles can she buy after she pays to get in? *​

Answers

The answer is 30

Step-by-step explanation:

50-2=48 then divide 48 by 1.60 and you get 30!

Other Questions
Which of the following nucleic acid complexes would undergo correction by the DNA mismatch repair system? UAGUCUUACAUUCCAUAUGG 3' (6%) Antisense 3' _ ATCAGAATGTAAGGTATACC-5' B. GTGCCCACGATTCAGTGGGC 3' (2%) Antisense 3' CACGGGTGCTAAGTCACCCG-5' GCGCCACGATTTAACGTGGC (62%) Anlisense 3' CGCGGTGCTAAGTTGCACCG-5' GGGCCCACGCUACGACGUUC 3' (28%) Anlisonse 3' CCCGAGTGCGATGCTGCAAG X SUBJECTIVE NURSING VS. OBJECTIVE NURSING: WHATS THE DIFFERENCE? Triangle RST is translated so that point R (-2, 1) is mapped to point R (2, -4). If point S is (-4, 3), what ordered pair best represents point S? Why is crossing over of the chromosomes during meiosis important? (multiple choice)A. It prevents mutations from entering the gametes.B. It allows for even distribution of chromosomes in the gametes.C. It allows for more genetic diversity of gametes.D. It allows for genetic uniformity of gametes. Kali and Ryan are selling cheesecakes for a school fundraiser. Customers can buy New York style cheesecakes and apple cheesecakes. Kali sold 12 New York style cheesecakes and 1 apple cheesecake for a total of $79. Ryan sold 14 New York style cheesecakes and 1 apple cheesecake for a total of $91. Find the cost each of one New York style cheesecake and one apple cheesecake. A = 21B= 921Please type the solution. I always have hard time understanding people's handwriting.1) a. A random variable X has the following probability distribution:X 0x B 5 B 10 B 15 B 20 B 25 BP(X = x) 0.1 2n 0.2 0.1 0.04 0.07a. Find the value of n.(4 Marks)b. Find the mean/expected value E(x), variance V (x) and standard deviation of the given probability distribution. ( 10 Marks)C. Find E(-4A x + 3) and V(6B x-7) (6 Marks) help me out guys this is important id appreciate it, I'll give reward thing pls Please help me I have gone over the tutorial 3 times and I cant figure it out pleaaase help me i will love you forever 5. define a function div2 that performs integer division of a number n by 2, i.e., it computes n/2. a solution of 5 mmol/l cacl2 is separated from a solution of 1 umol/l cacl2 by a membrane that is selectively permeable to ca2 , but is impermeable to cl-. what are the magnitude and the sign of the potential difference that is generated across the membrane? Help please witch two statements are both ture? 1st Statement: When a fortuitous event concurs with a person's negligence resulting to loss, he is still exempt from liability2nd Statement: The creditor has a right to the fruits of the thing form the time ownership is transferredA Both statements are correctBO Only the first is correctCO Both statements are falseDO Only the second is correct 44 What is the main idea of the article?FNew Zealanders helped a lost emperor penguin return to the Antarctic.G A zoo in New Zealand saved the life of an ailing emperor penguin.H An emperor penguin traveled thousands of miles to reach New Zealand.JNew Zealanders turned an emperor penguin into an instant celebrity. pls help pls pls pls pls pls pls pls pls pls Find the volume of the solid enclosed by the surfaces x + y + z = a , x + y +z = b , (a Which describes a precipitate in a chemical reaction?a gaseous reactant that forms aqueous productsa solid reactant that forms aqueous productsa gaseous product formed from aqueous reactantsa solid product formed from aqueous reactants Determine if the table represents a linear function, quadratic function, or exponential function. companies often organize their salesforce along geographical lines or by product line, industries their customers belong to, or the size and type of customers. this best describes: Which of the following are part of the 10 essentials listA:MapB:CharcoalC:RadioD:PillowE:KnifeF:Matches What is 0.85 divided by 0.0527?