Question 1 5 pts For this problem, type your answers directly into the provided text box. You may use the equation editor if you wish, but it is not required. Consider the following series. n² n=1 3n

Answers

Answer 1

The sum of the given series is 14.
The given series is:


1² + 2² + 3² + ... + (3n)²
To find the sum of this series, we can use the formula:
S = n(n+1)(2n+1)/6
where S is the sum of the first n perfect squares.
In this case, we need to find the sum up to n=3. Substituting n=3 in the formula, we get:
S = 3(3+1)(2(3)+1)/6 = 14
Therefore, the sum of the given series is 14.

To know more about series visit:

https://brainly.com/question/30457228

#SPJ11


Related Questions

WIILL GIVE BRAINLIEST.
Which statement best illustrates using the vertical line test to determine if the graph below is a function of x?

The graph is not a function of x because the line x = 0 intersects the graph at two points.
The graph is a function of x because the line x = 5 does not intersect the graph.
The graph is not a function of x because the line y = 0 intersects the graph at two points.
The graph is a function of x because the line y = 5 does not intersect the graph.

WIILL GIVE BRAINLIEST.Which statement best illustrates using the vertical line test to determine if the

Answers

Answer:

C: The graph is not a function of x because the line y = 0 intersects the graph at two points.

Step-by-step explanation:

The line y = 0 will intersect the ellipse at the points, (-4 , 0) , (4 , 0)

What is the radius and center of a circle with the equation (x – 2)2 + (y – 3)2 = 36?

radius: 6 units; center: (2, 3)
radius: 36 units; center: (2, 3)
radius: 6 units; center: (–2, –3)
radius: 36 units; center: (–2, –3)

Answers

Answer:

A

Step-by-step explanation:

Commenter is right cause I graphed it to doublecheck

The centre and radius of the circle is (2, 3) and 6 units respectively

What are equation of a circle?

The standard equation of a circle is expressed as:

(x – a)² + (y – b)² = r²

where:

centre = (a, b)r is the radius

Given the equation

(x – 2)² + (y – 3)² = 36

Compare

(a, b) = (2, 3)

r² = 36

r = 6 units

Hence the centre and radius of the circle is (2, 3) and 6 units respectively

Learn more on equation of a circle here:https://brainly.com/question/1506955

#SPJ2

(3 – 4x) – 3(2.4x – 7)

Answers

Answer: 24-11.2x

Step-by-step explanation:

Two athletic shoe brands were studied to see which brand was manufactured with the least amount of defects. Brand A was found to have 5 out of 600 pairs of shoes with a defect. Brand B was found to have 5 out of 250 pairs of shoes with a defect.

For Brand A, how many defects should they expect after manufacturing 2500 pairs of shoes?

Answers

Answer:

21

Step-by-step explanation:

We need to determine the percentage of defects of shoes for brand A

Percentage of shoes that have defect = (5/600) x 100 = 0.83%

shoes that would have defects when 2500 shoes are manufactured = 0.83% x 2500 = 0.0083 x 2500 = 20.75

rounding off to the nearest whole number gives 21 shoes

What is the value of x in the equation 8x – 2y = 48, when y = 4?
6
7
14
48

Answers

Answer:

x=7

Step-by-step explanation:

8x – 2y = 48

Let y = 4

8x - 2(4) = 48

8x - 8 = 48

Add 8 to each side

8x-8+8 = 48+8

8x = 56

Divide each side by 8

8x/8 = 56/8

x=7

Answer:

\(x = 7\)

Step-by-step explanation:

\(8x - 2y = 48 \\ 8x = 48 + 2y \\ x = \frac{48 + 2y}{8} \)

\(y = 4\)

\(x = \frac{48 + 2y}{8} \\ x = \frac{48 + 2 \times 4}{8} \\ x = \frac{48 + 8}{8} \\ x = \frac{56}{8} \\ x = 7\)

hope this helps

brainliest appreciated

good luck! have a nice day!

Five times a number decreased by nine is equal to twice the number increased by 23. Which equation could be used to solve the problem? 5x – 9 = x + 23 5x – 9 = 2x + 23 5x + 23 + 2x = 23 5x + 23 = 2x + 23

Answers

Answer:

5x - 9 = 2x + 23

Step-by-step explanation:

5 times a number is represented by 5x, with x representing the unknown number.  

5x decreased by 9 is (5x - 9) since 9 is being subtracted by 9.  

(5x - 9) is equal to twice the number (2x), increased by 23.  

So, the equation is (2x + 23).  

Therefore, 5x - 9 = 2x + 23

The equation is 5x - 9 = 2x + 23.

The answer is option A.

Which equation could be used to solve the problem?

5 times a number is represented by 5x, with x representing the unknown number.  

5x decreased by 9 is (5x - 9) since 9 is being subtracted by 9.  

(5x - 9) is equal to twice the number (2x), increased by 23.  

So, the equation is (2x + 23).  

Therefore, 5x - 9 = 2x + 23

What is an equation example?

An equation is a mathematical announcement this is made up of expressions related to the same signal. For instance, 3x – 5 = 16 is an equation. Fixing this equation, we get the price of the variable x as x = 7.

Learn more about the equation here: https://brainly.com/question/1214333

#SPJ2

what is 2² of 36
you can use google or a calculator

Answers

Answer is 144 my dude

it's tooo easy

answer -1296

15 books to 21 books increase or decrease

Answers

15 books to 21 books

21 is greater then 15 : 15 < 21

So, 15 books to 21 books is increasing

Answer : Increase

help please. it would really help if someone explained

help please. it would really help if someone explained

Answers

Answer:

0/8

Explanation:

There is no number greater than 10 on the spinner, so there is a 0/8 chance that the spinner will land on a number greater than 10.

There are four activities on the critical path, and they have standard deviations of 1, 2, 4, and 2 days. The standard deviation of the critical path is

Answers

Answer:

The standard deviation of the critical path = 5

Step-by-step explanation:

The formula for the standard deviation of a critical path is given as:

Standard deviation of a path

=√(sum of variances of activities on path)

Variance = (Standard deviation)²

In the above question, we are given:

Standard deviation of 1, 2, 4 and 2 days

Standard deviation of a critical path

=√(sum of variances of activities on path)

= √1² + 2² + 4² + 2²

= √1 + 4 + 16 + 4

= √25

= 5

Han's cell phone plan costs $200 to start. Then there is a $50 charge each month. What is the total cost for x months? write an equation:

Answers

Answer:

200+50x

Step-by-step explanation:

If Han's cell phone plan costs $200, Han will have to pay $200 at the start, and since Han has to pay $50 dollars each month, and x = months, we can create 50x for $50 each month. Put both of these together, and we get 200+50x.

As part of the Pew Internet and American Life Project, researchers surveyed a random sample of 800 teens and a separate random sample of 400 young adults. For the teens, 79% said that they own an iPod or MP3 player. For the young adults, this figure was 67%. Do the data give convincing evidence of a difference in the proportions of all teens and young adults who would say that they own an iPod or MP3 player? State appropriate hypotheses for a test to answer this question. Define any parameters you use.

Answers

the data provide convincing evidence of a difference in the proportions of teens and young adults who own an iPod or MP3

To determine if there is convincing evidence of a difference in the proportions of all teens and young adults who own an iPod or MP3 player, we can perform a hypothesis test.

Let's define the following parameters:

- p₁: Proportion of all teens who own an iPod or MP3 player.

- p₂: Proportion of all young adults who own an iPod or MP3 player.

The null hypothesis (H₀) assumes that there is no difference between the proportions:

H₀: p₁ = p₂

The alternative hypothesis (H₁) assumes that there is a difference between the proportions:

H₁: p₁ ≠ p₂

To test this hypothesis, we can use a two-proportion z-test. We calculate the test statistic using the formula:

z = ((p₁ - p₂) - 0) / √((\(\hat{p}_1\) * (1 - \(\hat{p}_1\)) / n₁) + (\(\hat{p}_2\) * (1 - \(\hat{p}_2\)) / n₂))

Where:

- \(\hat{p}_1\): Sample proportion of teens who own an iPod or MP3 player (79% or 0.79)

- \(\hat{p}_2\): Sample proportion of young adults who own an iPod or MP3 player (67% or 0.67)

- n₁: Sample size of teens (800)

- n₂: Sample size of young adults (400)

Using the given values, we can calculate the test statistic:

z = ((0.79 - 0.67) - 0) / √((0.79 * (1 - 0.79) / 800) + (0.67 * (1 - 0.67) / 400))

Calculating this yields the test statistic z = 5.525.

Next, we can determine the critical value or p-value associated with this test statistic using a significance level (α). Assuming a significance level of 0.05, for a two-tailed test, the critical values are approximately -1.96 and 1.96.

Since the calculated test statistic (5.525) is beyond the critical values of -1.96 and 1.96, we can reject the null hypothesis. There is convincing evidence to suggest that there is a difference in the proportions of all teens and young adults who own an iPod or MP3 player.

In conclusion, the data provide convincing evidence of a difference in the proportions of teens and young adults who own an iPod or MP3 player.

Learn more about test statistic here

https://brainly.com/question/31746962

#SPJ4

The appropriate hypotheses for testing the difference in proportions of all teens and young adults who own an iPod or MP3 player are:

Null Hypothesis (H0): The proportion of teens who own an iPod or MP3 player is equal to the proportion of young adults who own an iPod or MP3 player.

Alternative Hypothesis (Ha): The proportion of teens who own an iPod or MP3 player is not equal to the proportion of young adults who own an iPod or MP3 player.

To test if there is a significant difference in the proportions of all teens and young adults who own an iPod or MP3 player, we need to set up appropriate hypotheses. Let's denote the proportion of teens who own an iPod or MP3 player as p1 and the proportion of young adults who own an iPod or MP3 player as p2.

The null hypothesis (H0) assumes that there is no difference between the proportions, so we can state it as:

H0: p1 = p2

The alternative hypothesis (Ha) assumes that there is a difference between the proportions, so we can state it as:

Ha: p1 ≠ p2

Here, p1 represents the true proportion of teens who own an iPod or MP3 player, and p2 represents the true proportion of young adults who own an iPod or MP3 player.

To test these hypotheses, we can use a significance level (α) of 0.05, which is a common choice in hypothesis testing. If the p-value (the probability of observing a test statistic as extreme as the one calculated) is less than 0.05, we reject the null hypothesis and conclude that there is a significant difference in the proportions.

Learn more:

About hypothesis testing here:

https://brainly.com/question/17099835

#SPJ11

0.904 subtract 0.1 anyone help me pls i just haven’t figured it out

Answers

Answer:

0.804

Step-by-step explanation:

First, we can express 0.1 as 0.100 for easier subtraction.

Then, we can subtract 0.100 from 0.904.

0.904 - 0.100 = 0.804.

Note: You can use the traditional subtracting method to get the answer too.

I'm confused someone help!!!

I'm confused someone help!!!

Answers

Answer:

me also confuse lol

Step-by-step explanation:

Answer:

x=90°

Step-by-step explanation:

They're all 90° angles

32. Write a rule to represents the
function
(2, 10), (4, 20), (5, 25), (7, 35), (9, 45)

Answers

y equals x times 5 is the answer because 2 times 5 is 10 and so on and so forth hope this helps :D

The defining characteristic of a representative sample is that it is selected in such a way as to assure that:

Answers

The defining characteristic of a representative sample is that it is selected in such a way as to assure that it accurately represents the larger population from which it is drawn.

In other words, a representative sample should possess similar characteristics, proportions, and attributes as the population it is intended to represent.

To achieve representativeness, the sample selection process should be carefully designed to minimize biases and ensure that every member of the population has an equal chance of being included in the sample. This typically involves using random sampling techniques, such as simple random sampling or stratified sampling, to eliminate any systematic patterns or favoritism in the selection process.

By obtaining a representative sample, researchers can make valid inferences and generalizations about the population based on the characteristics and findings observed in the sample. It allows them to draw conclusions that can be applied to the larger population with a certain degree of confidence.

Learn more about sample here:

https://brainly.com/question/27860316

#SPJ11

Vanessa has ordered a meal that costs under $12. She is having a baked potato, costing $7, and d salads costing $2 each. Write an inequality to describe this information.​

Answers

Answer:

$7 + $2d = $12

Step-by-step explanation:

d = Salads



Solve. Check for extraneous solutions.

√x - 3 = 4

Answers

The solution to the equation √x - 3 = 4 is x = 49. There are no extraneous solutions.

To solve the equation √x - 3 = 4, we can follow these steps:

1. Add 3 to both sides of the equation to isolate the square root term:

  √x - 3 + 3 = 4 + 3

  √x = 7

2. Square both sides of the equation to eliminate the square root:

  (√x)^2 = 7^2

  x = 49

So, the solution to the equation is x = 49.

To check for extraneous solutions, we need to substitute the obtained solution back into the original equation and verify if it satisfies the equation.

√(49) - 3 = 4

7 - 3 = 4

4 = 4

Since the equation is true when x = 49, there are no extraneous solutions.

Therefore, the solution to the equation √x - 3 = 4 is x = 49.

To learn more about equation  Click Here: brainly.com/question/29538993

#SPJ11

A beaker has a mass of 129 g. What is the mass of this beaker in kilograms?

Answers

Answer: 0.129 kg

Step-by-step explanation:

A gram to a kilogram can be found by dividing the value of grams by 1000, or multiplying the value by 0.001

a 700-liter tank initially contains 100 liters of brine with 50 kilograms of salt dissolved in it. brine containing 1 kilogram of salt per liter is pumped into the tank at the rate of 8 liters per second, and the wellmixed brine in the tank flows out at the rate of 6 liters per second. how much salt will the tank contain when it is just full of brine?

Answers

Hence, when the is full, it will hold 700 liters of brine and 250 kg of salts dissolved in it.

What is a kilogram exactly?

The fundamental mass unit in the measuring units is the kilogram (kg). The weight of 1,000 cubic centimeters of water is very close to (and was initially planned to be exactly) one kilogram. The precise definition of a pound is 0.45359237 kg.

Let's first figure out how long is takes for the brine tank to fill.

The tank must be filled up to its maximum capacity of 700 liters, which is 100 liters of brine at first. As a result, the amount of brine that must be added is:

700 liters - 100 liters = 600 liters

The time required to fill it up 600 liters of brine if 8 liters of brine per second are injected into the tank is:

600 liters / 8 liters per second = 75 seconds

Let's check the tank's salt content after 75 seconds.

The amount of salt in the tank after 75 seconds is equal to: 100 kilograms (the original amount of salt) + (8 liters per unit - 6 each second) x 1 kilogram of salt per liter x 75 seconds. The rate of salt in the tank increasing is 1 kilogram per liter per second.

= 100 kilograms + 150 kilograms

= 250 kilograms

To know more about Kilogram visit:

https://brainly.com/question/9301317

#SPJ1

Assume we have two events, A and B, that are mutually exclusive. Assume further we knowP(A) = .30 and P(B) = .40.What is P(A ⋂ B)?What is P(A | B)?

Answers

From the given question, we can easily calculate that P(A⋂ B) is equal to 0 and  P(A | B) is also equal to 0.

Mutually exclusive events are those events that indicate that two or more events “do not occur” at the same time.

that clearly means that the intersection of their probabilities will be equal to 0

i.e. P(A⋂ B) = 0

and P(A|B) is called "Conditional probability", which means the possibility of an event or outcome happening(A), based on the given probability of a previous event or outcome(B)

and is given by,

P(A|B) = P(A ⋂ B)/P(B)

= 0/0.40

= 0

Learn more about mutually exclusive events on

https://brainly.com/question/30512497?referrer=searchResults

#SPJ4

How do you calculate the axis of symmetry?

Answers

To calculate the axis of symmetry, you must first identify the shape of the figure in question. The calculation for finding the axis of symmetry is different for each shape.

Rectangle: In a rectangle, the axis of symmetry is the midline, which runs vertically through the center of the figure. To calculate the axis of symmetry, divide the width of the rectangle in half and draw a line from the midpoint of the top side to the midpoint of the bottom side.

Parallelogram: In a parallelogram, the axis of symmetry is also the midline, which runs vertically through the center of the figure. To calculate the axis of symmetry, divide the width of the parallelogram in half and draw a line from the midpoint of the top side to the midpoint of the bottom side.

Axis of symmetry is a straight line that separates a two-dimensional figure into two mirror-image halves. The line runs vertically through the center of the figure and can be found in a variety of shapes, including rectangles, parallelograms, and parabolas.

Here you can learn more about axis of symmetry

https://brainly.com/question/22495480#

#SPJ11

PLEASE HELP ME OUT. THANKS!
A circular pool has a diameter of 30 feet. A section of the top railing with a central angle of 27° is broken and needs to be replaced. What approximate length of railing needs to be replaced? Round your answer to one decimal place.
About ____ feet of railing needs to be replaced.

Answers

Using the circumference of the circle, it is found that:

About 7.1 feet of railing needs to be replaced.

What is the circumference of a circle?

The circumference of a circle of radius r is given by:

\(C = 2\pi r\)

It is equivalent to 360º.

In this problem, the diameter is of 30 feet, hence the radius is 15 feet, so:

\(C = 2\pi (15) = 30\pi\)

Then, considering that the circumference is equivalent to 360º, the length to be replaced is given by:

\(L = \frac{27}{360} \times 30\pi = 7.1\)

About 7.1 feet of railing needs to be replaced.

More can be learned about the circumference of a circle at https://brainly.com/question/25846963

Answer: 7.1

Step-by-step explanation: ANSWER ON EDMENTUM/PLUTO

PLEASE HELP ME OUT. THANKS!A circular pool has a diameter of 30 feet. A section of the top railing with

A builder mixes sand and cement in the ratio
4
:
1

Altogether he mixes 250 kg

How much sand and cement does he use?

Answers

Answer:

He uses 200kg of sand and 50 kg of cement

Explanation:

I don't know what you guys are learning at school but I solved it with a system of equations. Check out the image. Hope it helps.

A builder mixes sand and cement in the ratio 4:1Altogether he mixes 250 kgHow much sand and cement does

Abc similar to def the area of abc is 45cm and the area of triangle def is 20cm one side of triangle abc is 3.6cm the the length of corresponding side of triangle def is

Answers

Answer:

2.4cm

Step-by-step explanation:

the area of a triangle is

baseline × height / 2

that means two lengths of the triangle have to be multiplied.

and to have 2 similar triangles means that all lengths inside one triangle are the corresponding lengths inside the other triangle multiplied by the scaling factor f.

multiplying 2 if these lengths with each other means also including the square of the scaling factor (multiplying with the scaling factor twice).

so, if the area of triangle 1 is

"baseline 1" × "height 1" / 2 = 45 cm²

then the area of triangle 2 is

"baseline 2" × "height 2" / 2 =

= "baseline 1"×f × "height 1"×f /2 =

= "baseline 1" × "height 1" × f² / 2 =

= ("baseline 1" × "height 1" / 2) × f² =

= 45 × f² = 20 cm²

f² = 20/45 = 4/9

f = 2/3

so, for a side of ABC being 3.6cm long, that means the corresponding side in DEF is

3.6 × f = 3.6 × 2/3 = 7.2/3 = 2.4cm

Mr Castle shares out 48 marbles between Emily
and Asif in the ratio 5: 1
How many marbles does each child get?

Answers

Step-by-step explanation:

Hope it will help you a lot.

Mr Castle shares out 48 marbles between Emilyand Asif in the ratio 5: 1How many marbles does each child

aya has 14 2/5 feet of chain. She wants to make pieces foot long math. How many can she make? b Solve the problem using decimals

Answers

Aya can make 14 mats of 1 foot long.

What is division?

Division is one of the fundamental arithmetic operation, which is performed to get equal parts of any number given, or finding how many equal parts can be made. It is represented by the symbol "÷" or sometimes "/"

Given that, Aya has 14\(\frac{2}{5}\) feet of chain. She wants to make pieces foot long mat.

Let can make x mats out of the given chain, since each mat is 1 foot long, so,

1×x =  14\(\frac{2}{5}\)

x = 72/5

x = 14.4

x ≈ 14

Hence, She can make 14 mats out of the given chain.

For more references on division, click;

https://brainly.com/question/21416852

#SPJ1

Jared has $500 in his checking account. He spent $180 on his light bill. What percent of his money is spent on his light bill?​

Answers

Answer:

36%

Step-by-step explanation:

180/500=36

Hope this helped!

Can someone give me all the right answers??!!! Please!!!:))

Can someone give me all the right answers??!!! Please!!!:))

Answers

If it goes up it’s growth if it goes down it’s decay

Anyone know this one? Quick!

4(x – 5) + (3x + 15) – 5x

Answers

Answer:

4(x-5)+(3x+15)-5x

4x-20+3x-20+15=0

collect like terms

4x-5x+3x-20+15=0

2x-5=0

2x÷2=5÷2

x=5÷2

Other Questions
Thinking in terms of a situations current state and not having the ability to mentally reverse actions are limitations of the __________ stage. a. formal operational b. sensorimotor c. concrete operational d. preoperational Defenders of the electoral college argue that ____________.a.its a known process, created by Americas founding fathers.b.its problems are over-exaggerated.c.it identifies the winning candidate quickly and accurately.d.all of the above are true.e.only b and c are true. this is not a question but just some notes for science i am just trying to help people who dont study and wake up at 7am for this s**t (im talking about vr school)NOTES: PLS GIVE ME BRAINLIESTGene: strands of DNA that determine a single inherited traitGenetic variation: the variety of genes that may be inherited in a population of a speciesLaw: a descriptive statement or equation that accurately predicts a natural event or process that always occurs under certain conditionsNatural phenomena: any state or process known or observed through evidence gathered using the five sensesNatural selection: a mechanism for the evolution of a population to become better adapted for survival in a specific environmentTheory: the explanation for a natural process or phenomenon that is well-supported using a large quantity of empirical evidence, including observations, experimentation, and reasoningTrait: feature or characteristic that is inherited How did the Great compromise resolve the issue between small and large states? Describe the purpose of jails and prisons to include theresponsibilities and organization of the correctional system Using the information below, compute the Days' sales in raw materials inventory: Raw Materials Used $ 85,500 Beginning Raw Materials Inventory 8,000 Ending Raw Materials Inventory 9,000 A. 11.02. B. 10.06. C. 38.4 D. 9.94. E. 36.3. A visual metaphor is effective because Discuss any five focus areasfor Green Computing you can concentrate on (Related to Checkpoint 9. 2 and Checkpoint 9. 3) (Bond valuation) Fingen's 13-year, $1,000 par value bonds pay 11 perc a. Compute the bond's yield to maturity. B. Determine the value of the bond to you, given your required rate of return. C. Should you purchase the bond? 10. Victoria has a coupon for 30% off of any item in a department store. She decides to purchase a treadmill. The original price of the treadmill is $595. There is also 7% sales tax in her state. What is the final price of the treadmill, including tax? * Age If you add Natalie's age and Fred's age, the result is 43. If you add Fred's age to 4 timesNatalie's age, the result is 79. Write and solve a system of equations to find how old Fred andNatalie are.Fred isyears old. Natalie isyears old. PLEASE ANSWER QUICKWhat is the unit rate for the ratio 96:8 western attitudes toward sexual behavior for nearly 2,000 years were molded primarily by christianity. which statement accurately describes the purpose of sex, according to the dominant view within historic christianity? How do you calculate the force of gravity FG between two objects?. Sebastian was in a hotel lobby and took the elevator up 7 floors to his room. Then he took the elevator down 9 floors to the parking garage. He described his movement with the expression below. 9 + (negative 7) What is Sebastians error? What is the intersection of AC and plane Q? What is the force of buoyancy?A. It pushes objects away.B. It pulls objects together.C. It pulls objects to the bottom.D. It pushes upward. diabetes is a disease of improper glucose regulation that results in approximately 200,000 deaths per year in north america. the majority of people with diabetes in north america have . which of the follwoing statement concernin the great wall of china is false quizlt Please see image attached. I was told by the instructor the answer is B but I dont understand why? each daugher cell inherits a daughter strand and original template strand from parent, so shouldnt the answer be A? Why do the strands split up to each daughter cell?Although DNA polymerases replicate DNA with extremely high fidelity, these enzymes do make mistakes at a rate of about 1 per every 100,000 nucleotides. Given that each human cell contains 23 pairs of DNA molecules with a collective 3 billion base pairs, it would amount to about 60,000 mistakes every time a cell replicates its DNA! Fortunately, there are extremely sophisticated mechanisms that fix most, but not all, of those mistakes. Suppose a cell (let's call it cell X ) in the regenerating liver of a patient is replicating its DNA molecules for mitosis, and suppose an " A " to " C " mismatch (see the sequences below) is present in one of the newly synthesized chromosome DNA because somehow this mismatch has escaped detection by repair mechanisms. Original template strand: 5'GGTTCAGTACGATTGCAAGGCCTTAAGGT3Newly synthesized strand: 3'-CCAAGTCATGCTAACGCTCCGGAATTCCAA- 5Which one of the following statements is most likely correct? A. After mitosis of the cell X, both daughter cells possess a permanent mutation. B. After mitosis of the cell X, one daughter cell possesses a permanent mutation. C. After mitosis of the cell X, one daughter cell will possess the AC mismatch, which will give rise to a permanent single base mutation after the DNA is replicated once. D. After mitosis of the cell X, both daughter cells possess the AC mismatch, which will give rise to a permanent single base mutation to be inherited by all of their daughter cells.