Saudi Arabia obtain the majority of its drinking water through gulf
streams

True or False

Answer: I predict that human use of fossil fuels will affect their distribution over time because.

Explanation: Because if we keep on using fossil fuels over and over we eventually loose all of it because nearly 67% of the worlds reserves of crude oil are currently in the Middle East. So if we keep on using it well then there won't be anymore fossil fuels left for us, And if we keep using it, it will also slowly kill us off and also kill everything else around us.

Answer:

Don't have sex. 5 points isnt a lot so I am not spending alot of time on it.

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

Answer:

A

Explanation:

Crop planted to attract insect pests from another crop to hinder their survival

The Calvin cycle is a series of light-independent reactions that occur in the chloroplasts of plants.

For more questions on Calvin's cycle

https://brainly.com/question/920840

#SPJ8

The correct order of contributions to the discovery of DNA is Friedrich Miescher, Phoebus Levene, Frederick Griffith, Avery, MacLeod, and McCarty, Erwin Chargaff, Rosalind Franklin and Maurice Wilkins, and James Watson and Francis Crick.

Regarding the tomato plant phenotype, if the plant has one allele for red skin (R) and one allele for yellow skin (r), the correct description for its phenotype would be heterozygous.

The correct answer would be heterozygous.

The correct order of contributions to the discovery of DNA can be represented by the following timeline:

1. Friedrich Miescher (1869): Miescher discovered a substance in the nucleus of cells, which he called "nuclein." This substance was later identified as DNA.

2. Phoebus Levene (1919-1929): Levene made significant contributions to understanding the chemical composition of DNA. He identified the components of DNA, including nucleotides and the sugar-phosphate backbone.

3. Frederick Griffith (1928): Griffith conducted an experiment with Streptococcus pneumoniae bacteria, demonstrating the concept of transformation. He observed that harmless bacteria could acquire the ability to cause disease by incorporating genetic material from other bacteria.

4. Avery, MacLeod, and McCarty (1944): Building on Griffith's work, this group of scientists identified DNA as the substance responsible for the transformation observed in bacteria. Their experiments provided strong evidence that DNA carries genetic information.

5. Erwin Chargaff (1949): Chargaff discovered that the amount of adenine (A) in DNA is equal to the amount of thymine (T), and the amount of cytosine (C) is equal to the amount of guanine (G). This finding became known as Chargaff's rules.

6. Rosalind Franklin and Maurice Wilkins (1952): Franklin and Wilkins used X-ray crystallography to obtain images of DNA's structure, including the famous "Photo 51" taken by Franklin. These images provided critical insights into DNA's helical structure.

7. James Watson and Francis Crick (1953): Watson and Crick, building on the work of others, proposed the double helix structure of DNA. They combined data from various sources to create a model that explained how DNA stores and transmits genetic information.

Regarding the tomato plant phenotype, if the plant has one allele for red skin (R) and one allele for yellow skin (r), the correct description for its phenotype would be heterozygous. The phenotype refers to the observable physical traits of an organism, and in this case, the presence of both red and yellow skin alleles results in a mixed phenotype with red skin being dominant over yellow skin. Therefore, the plant will exhibit red skin as its phenotype.

For more such information on: DNA

https://brainly.com/question/28406985

#SPJ8

Answer:

Explanation:

False sorry if it is wrong

Mitosis and Binary Fission are very similar except when comparing the size of the new daughter cells relative to the original parent cell is a false statement.

A cell prepares for cell division by replicating its chromosomes, segregating them, and creating two identical nuclei during the mitotic phase. The cell's contents are often evenly divided into two daughter cells with identical genomes after mitosis.

A cell copies each chromosome during mitosis and distributes one copy to each of its two daughter cells. With regard to our example of an instruction manual, it is crucial that each person receive a duplicate of each page.

Mitosis follows the same pattern. Each chromosome must be delivered to each of our cells exactly once, without any errors, or the cells may have problems carrying out the genetic instructions.

Therefore, Mitosis and Binary Fission are very similar except when comparing the size of the new daughter cells relative to the original parent cell is a false statement.

To learn more about mitosis, refer to the link:

https://brainly.com/question/26678449

#SPJ2

Answer:

here u go mate

Explanation:

Iron deficiency anemia is typically caused by a lack of iron in the body, which can be due to a variety of factors such as poor diet, blood loss, or difficulty absorbing iron.

Answer: C

Explanation: Bile is a fluid that is made and released by the liver and stored in the gallbladder. Bile helps with digestion. It breaks down fats into fatty acids, which can be taken into the body by the digestive tract. Bile contains: Mostly cholesterol.

Answer:

where's the options for this question?

:/

there is no option?? ?

Answer:

True

Explanation:

When threatened, ostriches run away, but they can cause serious injury and death with kicks from their powerful legs. Contrary to popular belief, ostriches do not bury their heads in sand to avoid danger. This defensive behavior of lying low, so that they may appear from a distance to have their head buried.

Answer:

Answer D. Scratching it with other materials

Explanation:

Let's start eliminating some answers

Answer A; If you hit an object with a hammer, you will just figure out if that object can be broken with a certain amount of force. In most cases, this will not be helpful.

Answer B; When putting a material in an acid, many things could happen. This things that happen are called chemical reactions. Not every material will have a chemical reaction so this step could be useless.

Answer C; Chipping a piece off of a material will not grant you much information. Yes if may be easier to experiment will a smaller piece but the action by it's self is not useful.

Answer D; Scratching a material will another material can be very helpful. If you have two materials, labeled A and B, you can find out the Mohs hardness scale. If A is damaged by B, the hardness of A is less than B and vise versa. This can be very helpful when identifying materials.

So answer D makes the most sense

Answer:

It is not possible that the park has been irrevocably altered.

Explanation:

The fires are part of the ecology of Yellowstone National Park, and there is a very low risk that this park will be irreversibly modified after a fire. It is scientifically proven that Yellowstone has recovered from fires in a period of thirty years and that the risk of this recovery not happening is very low. In addition, the natural fires that occur in Yellowstone are, in a way, important for the maintenance of the park's ecosystem, since they are able to break the seed dormancy  that are in the soil, in addition to promoting the opening of the serine pine cones.

Seed dormancy is the difficulty of germinating that some seeds present, even in an environment with favorable conditions for germination.

The genetic similarity between the two organism is because DNA codes for the sequence of amino acids in a protein (option D).

DNA, meaning deoxyribonucleic acid, is a nucleic acid found in all living things made up of building blocks called nucleotides which are shaped into a double helix.

The DNA molecule is associated with the transmission of genetic information in a process called genetic expression i.e. transcription and translation.

DNA is first transcribed into mRNA, which is then translated into amino acid sequence, which are building blocks for protein.

Hence, the genetic similarity found when comparing the amino acid sequence of the enzyme is because DNA codes for amino acid sequence.

Learn more about genetic expression at: https://brainly.com/question/10189802

#SPJ1

Answer:

They cannot be stored by the body because they are water soluble and are eliminated daily.

Explanation:

Answer: A

Explanation:

B and D both describe the process of photosynthesis. A is the only one that describes respiration which is the breakdown of glucose into energy.

Answer:

The Doctrine of Specific Nerve Energies has been and continues to be enormously influential in the physiology, psychology, and philosophy of perception. In simple terms, the Doctrine states that we directly perceive in the first instance the activity of our nerves, rather than properties in the external world.

An organic compound that has an OH group on its side chain is called ethanol. It is flammable and a volatile liquid. Whereas, Glucose is a simple sugar molecule that has carbon and aldehyde groups.

The correct answer is:

This can be explained as:

Therefore, ethanol and glucose are similar in structures and some functions.

To learn more about ethanol and glucose follow the link:

https://brainly.com/question/4780314

Explanation:

Dear Uncle [Uncle's Name],

I hope this letter finds you in good health and high spirits. I have been meaning to share some news with you, and I believe your guidance and support can make a significant difference in my life.

As you know, the summer vacation is fast approaching, and my friends and I have been planning to join vacation classes together. It is an opportunity for us to learn and engage in activities that would enhance our skills and broaden our horizons. We are all excited about the prospect of spending quality time together while acquiring new knowledge.

However, I regret to inform you that my father is currently facing some financial difficulties. Due to unexpected circumstances, he is unable to afford the expenses associated with the vacation classes. It has been a challenging time for our family, and my father's priority is to ensure our basic needs are met.

In light of these circumstances, I am writing to you, dear uncle, with the hope that you may consider extending your support. Your assistance would mean the world to me and enable me to participate in these vacation classes alongside my friends. Your generosity has always been a pillar of strength for our family, and I am sincerely grateful for everything you have done for us.

Attending these classes would not only be a source of knowledge and skill development but also a chance for me to bond with my friends and create lasting memories. It would enhance my educational journey and contribute to my personal growth. I genuinely believe that this opportunity would be a valuable investment in my future.

I understand that everyone has their own financial responsibilities and commitments. Therefore, I completely respect any decision you make, and I am grateful for your consideration. If it is not feasible for you to provide financial assistance at this time, I completely understand, and I will continue to explore other alternatives.

Thank you, dear uncle, for taking the time to read my letter. I eagerly await your response and value your guidance and support. Regardless of the outcome, please know that your love and presence in our lives mean more to me than anything material.

Sending my warmest regards and affection to you and the family. Take care, and I hope to hear from you soon.

With heartfelt gratitude,

[Your Name]

The two similarities between chromosomes that you get from your parents are Genetic Material and Number of Chromosomes.

In terms of Number of chromosomes: Every Humans have 23 pairs of chromosomes, for a total of 46 chromosomes. Each parent contributes 23 chromosomes to their child, for a total of 46.

in tems of Genetic material: The chromosomes that you get from your parents contain the same genetic material. This is why you look like your parents and why you have inherited some of their traits.

Find more exercises on chromosomes;

https://brainly.com/question/1596925

#SPJ1

After an action potential's hyperpolarization phase, the Na/K pump aids in the axon segment's recovery to its resting potential.

The potassium channel close after hyperpolarization, allowing the neuron to revert to its resting state of -70 mV thanks to its inherent permeability to sodium and potassium. Depolarization, a sudden rise in potential, occurs all-or-nothing in neurons and is brought on by the activation of sodium channels in the cell membrane. Repolarization, the ensuing restoration to the resting potential, is facilitated by the activation of potassium channels. Potassium rushes out from the cell along its electrical potential as a series of voltage-gated ion channel open. The membrane potential is quickly reduced by these occurrences, returning it to its regular resting condition.

Learn more about hyperpolarization

https://brainly.com/question/14836491

#SPJ4

Answer:

The correct answer is - 7 cc or ml.

Explanation:

Given:

The volume of water in a graduated cylinder = 30 mL

The volume of rock = ?

Final volume = 37 ml

Formula:

If an object is placed in water, then the amount of water that is displaced or increased by submerging the object is equal to the volume of the object.

Vi + Vo = Vf

Vi = initial volume

Vo = volume of object

Vf = final volume

Solution:

Placing the values in formula -

30 + Vo = 37

Vo = 37 - 30

Vo = 7 ml or cc.

Answer:

trophoblast

Explanation:

Answer:

No, evolution from simple origins is not impossible. Evolution by natural selection, which is a well-established scientific theory, proposes that species can change over time through small genetic variations that confer a survival advantage. Over many generations, these variations can accumulate, leading to the development of new species with increasingly complex characteristics. This process can explain the diversity and complexity of life on Earth today.

From the protein hydrolysis cycle, the missing words are;

Protein hydrolysis is a complicated process that comprises a series of enzymatic processes, each with a unique kinetic response for numerous substrates.

Two enzymes that aid the digestion of protein in the body are;

Learn more about protein hydrolysis at;
https://brainly.com/question/7175239
#SPJ1

Answer:

1) Option b is correct. a founder effect

2) Option a is correct. keeping the sex ratio as close to 50:50 as possible

Explanation:

The exposed situation is an example of an ex-situ conservation program. These programs are planned to keep and restore the population of species that are in danger of extinction. There are many challenges associated with captivity, and one of them is related to maintaining genetic diversity in the population.

1) Introducing a few animals of an endangered species into the zoo might be considered an example of the founder effect. Just a pregnant female is enough for it to occur. And the most significant problem associated with this event is the loss the genetic diversity or variability. When breeding animals in captivity there is a high risk of losing some genes and fixating others, due to inbreeding.    

Genetic drift is the random change that occurs in the allelic frequency of a population through generations. The magnitude of this change is inversely related to the size of the original population. These changes produced by genetic drift accumulate in time. Eventually, some alleles get lost, while some others might set. Genetic drift affects a population and reduces its size dramatically due to a disaster or pressure-bottleneck effect- or because of a population split -founder effect-. In founder effect, a new population originates when a few individuals, coming from a bigger-sized population and carrying their genes, settle down in a new area and reproduce. This small population might or might not be genetically representative of the original one. Some rare alleles might be exceeded or might be lost by complete. Consequently, when the small population increases in size, it will have a genetically different composition from the original one. In these situations, genetic variability is reduced, and there exists the possibility of developing a peculiar allelic composition. When the number of individuals that originated the new population is low, the founder effect will be very extreme because the genetic drift effects are inversely proportional to the original number of individuals.

2) When selecting the animals that are being kept in captivity, it is significant to consider a few aspects concerning genetic diversity maintenance. The main objective is to prioritize the original genetic material.

Answer: