Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG

Answers

Answer 1

If a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3', the customized portion of an sgRNA for this target DNA sequence would be 5'_CGCUUAAGGUCAGUUACGCU-3'. This is because the sgRNA sequence must be complementary to the target DNA sequence in order for it to successfully bind and facilitate gene editing.

To create the customized portion of the sgRNA, we must first determine the complementary sequence to the target DNA sequence. The complementary sequence is determined by pairing the nucleotides in the target DNA sequence with their corresponding complementary nucleotides: A pairs with U, C pairs with G, G pairs with C, and T pairs with A. Therefore, the complementary sequence to the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' would be 5'_CGCUUAAGGUCAGUUACGCU-3'.

Once we have determined the complementary sequence, we can use it to design the customized portion of the sgRNA. The customized portion of the sgRNA will be the same as the complementary sequence, but with the addition of a 5' end and a 3' end. Therefore, the customized portion of the sgRNA for this target DNA sequence would be 5'_CGCUUAAGGUCAGUUACGCU-3'.

In summary, the customized portion of an sgRNA for the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' would be 5'_CGCUUAAGGUCAGUUACGCU-3'.

See more about gene in:

https://brainly.com/question/1480756

#SPJ11


Related Questions


Which term is used to describe the evidence of preexisting life found in layers of
sedimentary rock?
flora
invertebrates
fauna
fossilized

Answers

Answer: I think its fossils

Explanation:

the provider receives fetal karyotype results on one of his clients. the karyotype describes an absence of all or part of the x chromosome. which condition does the fetus exhibit?

Answers

The provider receives fetal karyotype results on one of his clients. the karyotype describes an absence of all or part of the x chromosome the fetus exhibit Turner syndrome.

A condition that exists from birth is referred to as congenital. Congenital illnesses may be inherited or brought on by outside influences. Their effects on a child's health and development aren't necessarily negative; in fact, they can occasionally be fairly moderate. However, a child with a congenital disease may live a life of impairment or health issues.

It's normal to worry about congenital abnormalities if you're pregnant or planning a pregnancy, especially if the disorder in question runs in your family. There are steps you may do to lessen the likelihood that your child will be born with a congenital condition, and while not all disorders can be detected during pregnancy, some can.

To know more about turner syndrome click here:

https://brainly.com/question/2487843

#SPJ4

What are three ways RNA differs from DNA

Answers

1. DNA is a double-stranded molecule, while RNA is a single-stranded molecule.
2. DNA is responsible for storing and transferring genetic information, while RNA directly codes for amino acids and acts as a messenger between DNA and ribosomes to make proteins.
3. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose

Answer:

1. DNA is double-stranded, and RNA is single-stranded.

2. DNA stores and transfers genetic information, RNA directly codes for amino acids and acts as a messenger between DNA and ribosomes to make proteins.

3. DNA contains the sugar deoxyribose, RNA contains the sugar Ribose.

1. Which of the following is a characteristic that both invertebrates and vertebrates share?

Answers

Answer:

Both vertebrate and invertebrate organisms are multicellular. Both vertebrate and invertebrate organisms contain eukaryotic cells.

Explanation:

1. How are organic molecules related to all living things?

Answers

Answer:

Explanation:

Organic molecules are the molecules which exist in all living things. They are life's building blocks. All things are formed from these organic molecules.

8. Review the four principles of how teratogens affect development that were discussed earlier in chapter 4. Explain how these principles are related to the principles of reaction range and gene-environment relations.

Answers

The principles of how teratogens affect development reflect the complex interplay between genes, the environment, and the timing of exposure.

Principle of Susceptible Periods: This principle states that there are specific periods during prenatal development when the developing organism is most vulnerable to the effects of teratogens. Different organs and systems have different windows of susceptibility. For example, the central nervous system is particularly susceptible during early embryonic stages. This principle is related to the principle of reaction range, which suggests that genes establish a range of potential outcomes, and environmental factors determine where within that range an individual's development will fall. Principle of Critical Periods: Critical periods refer to specific time frames during prenatal development when certain structures or processes are particularly sensitive to teratogens. Disruptions during these critical periods can have severe and long-lasting effects on development.

Learn more about geneshere:

https://brainly.com/question/1167303

#SPJ11

Scientists in the field of evo-devo have determined that evolutionary changes can be a result of changes in ________.

Answers

Scientists in the field of evo-devo have determined that evolutionary changes can be a result of changes in homeotic genes.

Homeotic genes are a class of genes that regulate how the body forms in the early stages of organism development. These genes produce proteins known as transcription factors that instruct cells to generate different body components.

In the hierarchy of genes governing the initial stages of embryonic development in Drosophila, homeotic genes play a key role. They are involved in defining the unique identities of each of the insect's bodily parts.

Evo-devo offers proof that significant morphological change is both feasible and not always necessitated by significant alterations in the DNA. Gilbert (2003) and Arthur (2004) have also argued that when teaching evolution, development should be taken into consideration.

To know more about Homeotic genes refer to:  https://brainly.com/question/28042306

#SPJ1

Which of the following types of microscopy are known for their ability to support the creation of three-dimensional images? Select all that apply. Light microscopy Standard fluorescence microscopy Confocal microscopy Scanning electron microscopy

Answers

The following types of microscopy are known for their ability to support the creation of three-dimensional images are C. Confocal microscopy and D. Scanning electron microscopy

The reason why these types of microscopy are known for their ability to support the creation of three-dimensional images is because of the way they capture images. Confocal microscopy is a light-based microscopy technique that provides three-dimensional images of thick specimens by eliminating out-of-focus light from the specimen. Confocal microscopy is capable of achieving high spatial resolution and has been used in a variety of scientific and medical research applications, including studies of cell biology, neuroscience, and tissue engineering.

Scanning electron microscopy is an imaging technique that uses a focused beam of electrons to produce images of the surface of a sample. In scanning electron microscopy, the electron beam is scanned across the surface of the sample, and the electrons that are scattered from the surface are detected and used to create an image. Scanning electron microscopy is capable of providing high-resolution images of the surface of a sample and is commonly used in materials science, biology, and other fields of research. So therefore the correct answer is C. Confocal microscopy and D. Scanning electron microscopy are the types of microscopy known for their ability to support the creation of three-dimensional images.

Learn more about electron microscopy at

https://brainly.com/question/16710784

#SPJ11

which is an example of a pioneer species?

A. lichens
B. ferns
C. spiders
D. squirrels

Answers

Answer:

lichen

Explanation:

Common examples of pioneer species include bacteria, lichen, mosses, and fungi.

Answer:

Lichens

Explanation:

How does increasing carbon dioxide in the atmosphere threaten marine life? a. It acidifies the ocean. b. It raises oxygen levels. c. It decreases water temperature. d. all of the above e. none of the above

Answers

Increasing carbon dioxide in the atmosphere threatens marine life by a. acidifying the ocean.

How does rising atmospheric carbon dioxide affect marine life?

Increasing carbon dioxide in the atmosphere threatens marine life by acidifying the ocean. This phenomenon, known as ocean acidification, occurs when excess carbon dioxide dissolves in seawater, leading to a decrease in pH levels.

As the ocean becomes more acidic, it poses a significant threat to various forms of marine life, including shell-forming organisms like coral reefs, oysters, and other shellfish. The acidic conditions make it difficult for these organisms to build and maintain their calcium carbonate structures, essential for their survival and growth.

Additionally, acidification can also impact the food chain by affecting the development and survival of small planktonic organisms that serve as a crucial food source for many marine species.

As a result, the overall ecosystem balance and biodiversity of marine environments are at risk.

Learn more about marine life

brainly.com/question/14950319

#SPJ11

One field of biology in particular has sparked
ethical concerns over whether or not we should
be editing the genes of organisms.
Which field of biology sparked these concerns?
A. biotechnology
B. ecology
C. taxonomy

One field of biology in particular has sparkedethical concerns over whether or not we shouldbe editing

Answers

It’s A it makes sense

Ethical concerns over whether or not we should be editing the genes of organisms is the field of biotechnology. Thus option A is correct.

What is Biotechnology ?

The branch of science that deals with application of technology to the biological organisms for the sustainable development, it has a broad range of applications from medical to agricultural sectors

It provide nutrient supplements like Golden rice which is most accepted supplement food prepared by the addition of beta-carotene into the rice.

It help the crops to handle abiotic stress like cold, drought, salinity, harsh climatic conditions etc.

In industry it has huge amount of application like production of alcohol, cosmetic products, even biological element production and cellular structures.

It has been widely used in the field of energy production such as Biofuels which is alternative source of natural resource, it is also eco friendly and not release green house gases.

It is applied in pharmaceutical industries. Thus option A is correct.

Learn more about biotechnology , here:

https://brainly.com/question/16536830

#SPJ2

Which term describes the role or S. carcini in this relationship?

A. Prey
B. Host
C. Parasite
D. Predator​

Which term describes the role or S. carcini in this relationship?A. PreyB. HostC. ParasiteD. Predator

Answers

S. Carcini is a parasite (C) as it feeds in the Crab (Host)

Answer:

Explanation:

its a parasite

how does plant makes their own food​

Answers

Photosynthesis

What is it?

Photosynthesis is the process in which plants make food for themselves by a constant growth cycle. Photosynthesis benefits us and the plant. Photosynthesis helps us by providing the release of oxygen into the air, and the plant gets food. Plants are autotrophs, I will explain what those are in a moment.

What are autotrophs?

Autotrophs are organisms able to create their own food for themselves through a process or cycle. Autotrophs are interesting creatures. They can create this food for themselves out of the substances within our environment, such as carbon dioxide.

Process of photosynthesis

Plants absorb CO2 and H2O from the soil and air. The water inside the plant cell is oxidized, which causes it to lose electrons. Since the CO2 is reduced, this water, at the same time, gains electrons. The water transforms into oxygen, which the plant releases during this process, and the CO2 turns into glucose, which is major for the energy needed across the plant cell.

I hope this helped you understand! Please leave a thanks and have a great day! :)

The characteristics of all organisms and viruses are determined by the instructions carried in

Answers

Answer:

DNA

Explanation:

maybe... BUT PROBABLY YESS

Answer:

nucleic acids

Explanation:

Kidneys remove what kind of waste from the body?

Answers

Answer:

Healthy kidneys filter about a half cup of blood every minute, removing wastes and extra water to make urine. The urine flows from the kidneys to the bladder through two thin tubes of muscle called ureters, one on each side of your bladder. Your bladder stores urine.

Explanation:

hope this helps have a good day

Answer:

they remove the waste called urea

What do you predict would happen to the cytoplasm of the onion cell as salt is added?

Answers

If you put the onion cell in a solution with a high concentration of salt the solution is considered hypertonic. That means the onion cell will loose water. The membrane will shrink but the shape of the cell will stay the same because of the cell wall.


Which of these is a characteristic of prokaryotes?

They have a nucleus.
They are always unicellular.
They are larger than eukaryotes.
They have membrane-bound organelles.

Answers

Answer:

They are always unicellular

Explanation:

The other options are false:

Prokaryotes do not have nucleus

Eukaryotes are larger than Prokaryotes

They do not contain membrane bound organelles

Answer:

It is B.

I looked everything up and the second option was the only thing that made sense.

4. How many glands are part of the endocrine system?

A. 8

B. 2

C. 4

D. 6

Answers

Answer: 7.

Explanation: The endocrine system is made up of seven different glands that make chemicals called hormones.

Answer:8

Explanation There are 8 glands in the endocrine system

Deep sea bacteria live at ocean depths too great for light to
reach. These bacteria make their own food. These bacteria
are:

Deep sea bacteria live at ocean depths too great for light toreach. These bacteria make their own food.

Answers

Answer:

Chemoautotrophs

Explanation:

With the knowledge that radiation causes mutations, many assume that human-made forms of radiation are the major contributors to the mutational load in humans.
A. Approximately half of the radiation exposure to humans comes from natural sources and half comes from human-made sources. Although diagnostic X rays do contribute about 10 percent of the exposure, other forms of human-made forms of radiation contribute only a relatively small amount. Human-made radiation exposure is not a major factor.
B.Most known sources of radiation are human-made, but natural sources are more harmful. Human-made radiation exposure is not a major factor.
C.Approximately 78 percent of the radiation exposure to humans comes from natural sources. Although diagnostic X rays do contribute about 10 percent of the exposure, other forms of human-made forms of radiation contribute only a relatively small amount. Human-made radiation exposure is not a major factor.

Answers

The correct answer is A.

Where did radiation exposure to humans come from?

Approximately half of the radiation exposure to humans comes from natural sources and half comes from human-made sources. Although diagnostic X-rays do contribute about 10 percent of the exposure, other forms of human-made forms of radiation contribute only a relatively small amount. Human-made radiation exposure is not a major factor. This means that while human-made forms of radiation can cause mutations, they are not the major contributor to the mutational load in humans. Natural sources of radiation, such as cosmic rays and radon gas, are responsible for a significant portion of radiation exposure.

Learn more about Radiation Exposure

brainly.com/question/13052466

#SPJ11

All of the babies were in the same nursery and p.Vulgaris infections did not occur in any other unit in the hospital. P. Vulgaris was not found in the tap water. Now what will you look for

Answers

Answer:

You would look for the virus in other places

Explanation:

.. Which statement describes starches, fats, proteins, and
DNA?

Answers

Answer:

They are all examples of the four major organic compounds: carbohydrates, lipids, proteins, and nucleic acids.

Explanation:

Answer:

they are complex molecules made from smaller molecules

Explanation:

Which best describes the flow of energy in the artic food web

Answers

The Arctic food web is a complex system that involves various organisms, from microscopic phytoplankton to large polar bears. The flow of energy in this ecosystem begins with the sun, which provides the energy for the photosynthesis of phytoplankton and other aquatic plants.

These primary producers are then consumed by zooplankton, which are in turn eaten by small fish and crustaceans.
The small fish and crustaceans are then eaten by larger fish, seals, and seabirds. At the top of the food chain, we have polar bears and other predators that feed on these animals. As these animals die and decompose, they provide nutrients for scavengers, detritivores, and decomposers, which help to recycle the energy and nutrients back into the ecosystem.
Overall, the flow of energy in the Arctic food web follows a hierarchical structure, where energy is transferred from one level to another. The energy flows from the sun to the primary producers and then to the consumers, and finally to the decomposers, which help to recycle the nutrients back into the ecosystem. The Arctic food web is a delicate balance, and any disruption in this ecosystem can have severe consequences for the entire food chain.

To know more about Arctic Food Web visit:
https://brainly.com/question/31020462
#SPJ11

100 POINTS!!!!

HAS ANYONE DONE THE LAB: Pigeonetic ASSIGNMENT IF SO COULD U SEND THE WORKSHEET

Answers

Answer:

I have not done it yet give me a sec

No I have not done it but u can put this on g.o.o.g.l.e. “pigeonetic” worksheet

Does a person do more cellular respiration when asleep or awake

Answers

Answer:

Sleep deprivation causes cellular respiration proteins up regulation.

Explanation:

When asleep, the body is in the resting state and is not required to produce as much energy because you are not up and active.

Therefore, a person does more cellular respiration when asleep.  

Answer:

Explanation: A person does more cellular respiration while asleep because they are inactive.

____ means examining the whole in order to learn about the individual elements.

Answers

Holistic analysis means examining the whole in order to learn about the individual elements.

This approach involves looking at something as a complete system or entity, rather than simply focusing on isolated parts or components. By taking a holistic approach, we can gain a deeper understanding of how each individual element contributes to the overall function and purpose of the system.

Holistic analysis can be applied to various fields, including medicine, psychology, and business. In medicine, doctors may use a holistic approach to understand how different symptoms and conditions are interconnected and affecting a patient's overall health. In psychology, therapists may use a holistic approach to assess a person's mental health by examining factors such as their environment, relationships, and lifestyle habits.

Overall, holistic analysis is a valuable tool for gaining a comprehensive understanding of complex systems and how their individual elements interact and influence each other.

Learn more about holistic approach here: https://brainly.com/question/28281368

#SPJ11

What is the Organization of life from broad and specific groupings?

What is the Organization of life from broad and specific groupings?

Answers

The organization of life from broad to specific groups is the following:

Biosphere

Ecosystem

Community

Population

Organism

Organ Systems

Organ

Tissue

Cells

Organelles

Molecules

Atoms

Or, the second answer choice.

neurons can have processes as long as 3 feet in the nerves of the leg. explain how this structure relates to the function of nervous tissue.

Answers

Nerve cells are commonly very lengthy and branched in order that it allows the transmission of signals or electrical impulses over all parts of the frame.

Multipolar neurons are defined as having 3 or greater approaches that expand out from the cell frame. They incorporate greater than 99% of the neurons in people and are the important neuron type found in the CNS and the efferent department of the PNS.

The axon of 1 neuron connects to the dendrite of every other to shape a synapse, and that is how nerve indicators are transmitted from one neuron to the subsequent. Axons may be very long, with some human axons extending extra than three toes from the mobile body.

Their feature is to send electric impulses and chemical alerts to and from the mind. maximum neurons have 3 elements, inclusive of a mobile frame, which includes the nucleus and the cytoplasm, an axon, which transmits data far from the nucleus, and dendrites, which receive messages from other neurons.

Learn more about nervous tissue here:-https://brainly.com/question/869589

#SPJ4

One species benefits and the other species is neither harmed nor helped.

Answers

Answer:

The answer is Commensalism.

Explanation:

Commensalism is a long-term biological interaction (symbiosis) in which members of one species gain benefits while those of the other species neither benefit nor are harmed.

Answer:

Commensalism

Explanation:

members of one species gain benefits while those of the other species neither benefit nor are harmed.

chứng minh sự đa dạng và phong phú của các loại động vật trên thế giới

Answers

Answer:

???? get into the right server

Other Questions
Lab: Electromagnetic Induction: Instructions Click the links to open the resources below. These resources will help you complete the assignment. Once you have created your file(s) and are ready to upload your assignment, click the Add Files button below and select each file from your desktop or network folder. Upload each file separately. Your work will not be submitted to your teacher until you click Submit. Find the radius of convergence, R, of the series. [infinity] n = n/6^n (x + 4)^n R = Incorrect: Your answer is incorrect. Find the interval, I, of convergence of the series. (Enter your answer using interval notation.)I = Suppose that the function f is given by f(z, 3) = 4 8 +1. Find the critical points of f. For each critical point of f. determine whether it is a local minimum, local maximum, or a saddle point. Question 5.Read the following excerpt from "Theme for English B" by Langston Hughes before you choose your answer. "Well, I like to eat, sleep, drink, and be in love. I like to work, read, learn, and understand life. I like a pipe for a Christmas present, or recordsBessie, bop, or Bach. I guess being colored doesn't make me not like the same things other folks like who are other races. So will my page be colored that I write?" In this excerpt, the author's tone is best described as A.harsh and stridentB. informal and matter-of-fact C.sentimental and mournfulD. enthusiastic and optimistic What do aaron and bear nickname the portland street assisted living center(book restart by gorn korman) which reason uses ethos to support this argument? Solve each of the following problems. 1. If the lengths of two sides of an isosceles triangle are 9cm and 17em, find thelength of the third side. 2. In a triangle with integer side lengths, one side is two times as long as the second side and the length of the third side is 22 cm. What is the greatest possibleperimeter of the triangle? 3. Aaron has two bamboo sticks with measures 39cm and 18 cm, if he will make a triangular picture frame, how many possible frames can he make, if the thirdside has integral length? The percentage decrease in value when the yield-to-maturity (YTM) increases by a given amount is smaller than the increase in value when the yield-to-maturity (YTM) decreases by the same amount.Select one:TrueFalse If a firm is at or near financial distress, it has an incentive to 'gamble for resurrection', because of a conflict of interest between debt and equity arising out of the seniority of debt. Carefully describe this conflict of interest, possible remedies for it, and the kinds of firms that are more susceptible to it. operation as an institute of electrical and electronics engineers (ieee) 802.11ac device occurs only in the 5 gigahertz (ghz) unlicensed national information infrastructure (u-nii) radio band, so how are 802.11ac devices able to maintain compatibility with earlier standards that operate in the 2.4 ghz industrial, scientific, and medical (ism) radio bands? What is the negation of the statement "Some cows have spots"? 8.7.5 practice questions you are the administrator for the westsim domain. organizational units (ous) have been created for each company department. user and computer accounts for each department have been moved into their respective department ous. computers in the accounting department use a custom application. during installation, the application creates a local group named acctmagic. this group is used to control access to the program. by default, the account used to install the application is made a member of the group. you install the application on each computer in the accounting department. all accounting users must be able to run the application on any computer in the department. you need to add each user as a member of the acctmagic group. you create a domain group named accounting and make each user a member of this group. you then create a gpo named acct software linked to the accounting ou. you need to define the restricted group settings. what should you do? which of the following is the correct sequence when tracing the path of air from the nose to the lungs? in order to start the new project, the firm has to replace an old machine with a remaining book value of $25,000. however, while still functional, the machine has no market value and will be scrapped if the new equipment is acquired. the new machine will cost the firm $220,000. in order to put the machine in working condition, abc will spend $6,000 in installation and $4,000 in shipping. if the new machine is purchased net working capital will be increased by $10,000. the new machine will be depreciated via the straight-line depreciation method to a salvage value of $0. however, at the end of the new machine's five-year life, it can be sold for $30,000. if accepted, the new machine will increase annual revenues by $150,000 and will increase annual operating costs by $45,000. the company has a marginal tax rate of 40% and a cost of capital of 14%. the project will last 5 years. what is the initial outlay of this project?\ Supernormal GMR Inc. expects to pay the following dividends over the next three years: $4.00, $4.40, and $4.84. After that, Supernormal GMR's dividends will grow at a constant rate of 3% thereafter (to infinity and beyond). If Supernormal GMR's shareholders require a return of 14%, what is the intrinsic price of one share of Supernormal GMR's stock? FILL IN THE BLANK ______ can creep into a study if subjects are picked (intentionally or not) according to some criterion and not randomly. (a) In the figure below, m CED=50 and m AB = 140. Find m CD.(b) In the figure below, m VYW=36 and m VX = 62. Find m VW you plan to implement a new security device on your network. which of the following policies outlines the process you should follow before implementing that device? Metamorphism can transform a shale composed of clay (Diagram A) into a metamorphic rock containing many different minerals (Diagram B). The metamorphism of a pure quartz sandstone, however, yields a metamorphic rock containing only quartz. Why? Choose one: A. Quartz in a shale is different than quartz in a sandstone, so it will behave differently under metamorphic conditions. B. The sandstone is made up only of quartz (silicon and oxygen), and there are no other combinations these elements can be arranged into except polymorphs. C. Quartz is a very resistant mineral and does not undergo any metamorphic processes when subjected to intense heat and pressure. the set is a basis of the space of upper-triangular matrices. find the coordinates of with respect to this basis.