The 5' methyl G cap
a.
all of the answers presented here are correcet
b.
would be found in a cell - prokaryotic and eukaryotic.
c.
would be found on the start codon of every ORF (open reading frame)
d.
would be found in the promoter of genes.
e.
is required to allow mRNA transport from the nucleus to the cytoplasm.

Answers

Answer 1

The 5' methyl G cap is  E. is required to allow mRNA transport from the nucleus to the cytoplasm.

The 5' methyl G cap is found at the 5′ end of the mRNA chain in eukaryotic cells. The 5′ end of an RNA molecule is the one that has a phosphate group attached to the 5' carbon of the ribose sugar in the nucleotide. The methylated guanine cap is covalently bonded to the first nucleotide at the 5′ end of the pre-mRNA molecule, which is usually transcribed from DNA. The 5' methyl G cap plays an important role in mRNA stability, translation initiation, and is necessary for the export of mature mRNA from the nucleus to the cytoplasm.

The presence of a 5' methyl G cap is required for the recognition of the mRNA by ribosomes, which are required for protein synthesis, as well as for the prevention of exonucleases from degrading the mRNA molecule. Additionally, the 5′ methyl G cap acts as a binding site for various proteins that aid in mRNA export from the nucleus to the cytoplasm. Without the 5' methyl G cap, mRNA export from the nucleus would be limited or entirely eliminated. The correct answer to the given question is option (e) "is required to allow mRNA transport from the nucleus to the cytoplasm."

Learn more about protein synthesis at:

https://brainly.com/question/32166673

#SPJ11


Related Questions

when an lfo is being used to modulate the pitch of the vco the lfo is being used to create .

Answers

When the pitch of the VCO is modulated by LFO, the VCO's output frequency shifts over time.

An LFO (low-frequency oscillator) is a periodic waveform that produces a repetitive signal at a frequency of fewer than 20 Hz but typically much lower than that.

The pitch of the VCO (voltage-controlled oscillator) is modulated by the LFO.

When an LFO is used to modulate the pitch of the VCO, the LFO is used to generate Vibrato.

When the pitch of the VCO is modulated by LFO, the VCO's output frequency shifts over time. To be more specific, when the LFO modulates the VCO's frequency, it alters the frequency of the VCO's output waveform.

This is accomplished by feeding the LFO signal to the input of the VCO's frequency control input, causing the VCO's frequency to increase or decrease cyclically with the LFO's frequency. The LFO's frequency determines the rate at which the VCO's frequency fluctuates.

Know more about frequency - brainly.com/question/26754018

#SPJ11

PLEASE HELP AND I WILL GIVE LOTS OF POINTS!!!!!!
What factors do you think might be making it difficult for farmers to treat this disease in their banana plants?

Answers

Answer: Panama disease. It's a fungus – known as fusarium wilt – that infects the root system of banana plants and, eventually, kills the plant. There is no cure for the disease, and when one plant is infected, an entire plantation can easily be brought down.

Hope the helps. If It does, please mark me brainliest.

Explanation:

the ossicles serve as attachment sites of several muscles that control the mandible, tongue, and larynx. (True or False)

Answers

False. The ossicles are the three small bones in the middle ear that transmit sound vibrations from the eardrum to the inner ear. They are not directly involved in the control of the mandible, tongue, or larynx.

What are mandibles?

Mandibles are the lower jawbones in vertebrates, including humans. The mandible is the largest and strongest facial bone and forms the lower jawline. It is a U-shaped bone that articulates with the skull's temporal bone at the temporomandibular joint.

What is the significance of mandibles?

The mandible bone has several vital structures, including the mandibular condyle, which articulates with the skull at the temporomandibular joint, and the coronoid process, an attachment point for the temporalis muscle. The mandible also houses the lower teeth in dental alveoli and contains the mental foramen.

To learn more about the larynx, visit here:

https://brainly.com/question/27008578

#SPJ1

What is the complementary mRNA strand to the template DNA strand
ACATGCGGTTAAATG

Answers

Answer:

Its UGUACGCCAAUUUAC

Explanation:

HELP ASAP ITS TIMED I ONLY HAVE 12 MINUTES LEFT!!!!!

Which of the following is an important part of a risk assessment for a potential toxicant?
A. Developing strategies to minimize risk

B. Performing a dose-response analysis

D. Performing a cost-benefit analysis

Answers

Answer:

Performing a dose-response analysis

Explanation:

A P E X

biomechanical characterization of isolated epineurial and perineurial membranes of rabbit sciatic nerve

Answers

The biomechanical characterization of isolated epi neurial and perineurial membranes of rabbit sciatic nerve involves various methods to study their mechanical properties and responses.

The mechanical properties of the epineurial and perineurial membranes are essential to understanding their function in the body and developing treatments for injuries and disorders.

The epineurium is a thick, outer layer of connective tissue that surrounds the entire nerve, while the perineurium is a layer of connective tissue that surrounds each individual fascicle of nerve fibers.

To characterize the biomechanical properties of these membranes, various techniques can be used, including tension testing, uniaxial testing, and biaxial testing.

These tests can be used to measure the mechanical response of the membranes to various types of stress, such as strain, compression, and shear forces.

The results of these tests can provide important information about the biomechanical behavior of the epineurial and perineurial membranes and their role in the overall mechanical behavior of the nerve.

This information can be used to develop treatments for nerve injuries and disorders and to understand the mechanics of the nervous system more generally.

In conclusion, biomechanical characterization of isolated epineurial and perineurial membranes of rabbit sciatic nerve is a complex process that requires advanced techniques to understand the mechanical properties and responses of these membranes.

To know more about biomechanical, visit:

https://brainly.com/question/518210

#SPJ11

The complete question is,

Biomechanical characterization of isolated epineurial and perineurial membranes of rabbit sciatic nerve. Journal of Biomechanics 2022;136:111058.

To______
means to allow another
road user to cross or use an intersection or
roadway before you do.

Answers

Answer: Yield

Explanation: Yielding is an important traffic rule that promotes safety and smooth flow of traffic.  It is an important practice that helps maintain order on the roads and promotes safety for all road users. It's essential to be attentive, follow traffic signs and signals, and be aware of the right of way rules in your area to ensure a safe driving experience.

When you yield, you give the right of way to another driver or pedestrian. This means that you let them go first, even if it might inconvenience you or require you to slow down or stop.

Yielding is typically required in situations such as:

Yielding to pedestrians: When you approach a crosswalk or intersection where pedestrians are waiting to cross, you should yield to them and allow them to safely cross the road before you continue to drive.  Drivers must yield to pedestrians within a crosswalk.  

Yielding at intersections: When you approach an intersection where there are other vehicles, you should yield to those already in the intersection or approaching from the right. This helps prevent accidents and ensures a smooth flow of traffic.

Yielding when merging: When merging onto a highway or another lane, you should yield to the vehicles already in that lane. This allows for a safe and efficient merging process.

Learn more driving laws here: https://brainly.com/question/32157970.

the combining form for the double membrane that lines the abdominal cavity is:_____.

Answers

Answer:

peritoneum (peritone/o)

Explanation:

The combining form for the double membrane tha5 lines the abdominal cavity is peritoneum (peritone/o)


hope this helps!

Which of these is NOT an organ found in the excretory system that helps to filter out liquid wastes in our body?
-kidneys
-lungs
-Skin
-heart​

Which of these is NOT an organ found in the excretory system that helps to filter out liquid wastes in

Answers

Answer: The heart.





Explanation: This is asking for an organ in the excretory system. The heart is above

Answer:

the heart

Explanation:

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

what is involved in creating genetically modified bacteria?

Answers

Answer:

A small piece of circular DNA called a plasmid? is extracted from the bacteria or yeast cell. A small section is then cut out of the circular plasmid by restriction enzymes, 'molecular scissors'. The gene for human insulin is inserted into the gap in the plasmid. This plasmid is now genetically modified.

Explanation:

what is the most likely reason that firms are implementing group incentive plans?

Answers

The most likely reason that firms are implementing group incentive plans is to motivate employees to work collaboratively towards a common goal or objective, as opposed to focusing solely on individual performance.

By rewarding groups for achieving specific targets, such as increased productivity or improved quality, firms can promote teamwork, communication, and a sense of shared responsibility among employees. This can ultimately lead to higher levels of engagement and job satisfaction, as well as improved business outcomes.

                                                    Additionally, group incentive plans can help to align individual goals with broader organizational objectives, which can increase overall effectiveness and drive better results. Overall, implementing group incentive plans can be an effective strategy for encouraging collaboration, driving performance, and fostering a culture of shared success within an organization.

Learn more about business outcomes

brainly.com/question/30602819

#SPJ11

To make a banana split, you halve a banana into two long, thin, right and left sides along the ________. Group of answer choices a. coronal plane c. midsagittal plane b. longitudinal plane d. transverse plane

Answers

Answer:

The correct answer would be C, midsagittal plane

Explanation:

The midsagittal runs through the middle of an object and is even on both sides. I hope this helps:)

Communication scheme
Explain the following scheme, mentioning the type of communication, cells and molecules involved, type of ligand, type of receptors, and its secretory pathway

Communication schemeExplain the following scheme, mentioning the type of communication, cells and molecules

Answers

The given image is of the synapse. Transmission of impulse from the presynaptic neuron to postsynaptic neuron.

What are receptors?

Although there are several varieties of receptors and ligands, they all come in closely matched pairs, with a receptor only being able to detect one (or a small number of) specific ligands and a ligand binding to just one (or a small number of) target receptors.

When a ligand attaches to a receptor, the receptor's shape or activity is changed, allowing the receptor to transmit a signal or cause a change in the cell directly.

Although there are many different kinds of receptors, they can be categorized into two groups: cell surface receptors, which are found in the plasma membrane, and intracellular receptors, which are found inside the cell (in the cytoplasm or nucleus).

The given image is of the synapse. Transmission of impulse from the presynaptic neuron to postsynaptic neuron.

To learn more about ligands, refer to the link:

https://brainly.com/question/2980623

#SPJ1

apply what you know about cooling rates to explain differences in crystal sizes

Answers

The rate of cooling is inversely proportional to the crystal size. The faster the cooling rate, the smaller is the crystal size and the slower the cooling rate, the larger is the crystal.

Rate of cooling can be defined as the elimination or removal of the high temperature from any object. This removal and be slow and gradual, therefore slow rate of cooling; or it cab quick and instant, therefore, fast rate of cooling.

Crystals are the solid components whose molecules are arranges in a regular fashion, giving it an ideal 3 dimensional pattern. They are symmetrical in nature. The examples of crystals are sugars, salt, etc.

To know more about crystals, here

brainly.com/question/1212769

#SPJ1

A person has suffered a spinal injury that has severed the right half of their spinal cord between thoracic vertebrae 9 and 10 . As a result of this damage, all three somatosensory pathways have been disrupted from the level of injury down (lower trunk and legs). Based on this information, circle the side of the body where the person will experience anesthesia and identify the sensations lost due to damage to the specific somatosensory pathway. Anterior spinothalamic tract: Right side / Left side Pain \& temperature / Light touch / Discriminatory touch Lateral spinothalamic tract: Right side / Left side Pain \& temperature / Light touch / Discriminatory touch Posterior column: Right side / Left side Pain \& temperature / Light touch / Discriminatory touch

Answers

Based on the information given, the person will experience anesthesia on the left side of their body because the right half of their spinal cord is severed.

The sensations that will be lost due to the damage to the specific somatosensory pathways are:Anterior spinothalamic tract: Left side, Pain & temperature, Light touch, and Discriminatory touch.Lateral spinothalamic tract: Right side, Pain & temperature, Light touch, and Discriminatory touch.

Posterior column: Right side, Pain & temperature, Light touch, and Discriminatory touch. The person would lose all three somatosensory pathways on the left side of their body, resulting in anesthesia. They will not be able to feel any pain, temperature, light touch, or discriminatory touch.

This is because the spinal cord is responsible for transmitting these sensations to the brain. When the spinal cord is severed, the signals are disrupted and cannot reach the brain.

The specific somatosensory pathways that have been damaged are the anterior spinothalamic tract, lateral spinothalamic tract, and posterior column. These pathways are responsible for transmitting specific types of sensations, and damage to them can cause specific types of sensory loss.

To know more about anesthesia click on below link:

https://brainly.com/question/31667044#

#SPJ11

Help!! Fill in the blanks, see picture below!! Biology!

Help!! Fill in the blanks, see picture below!! Biology!

Answers

Answer:

and __chromatin__...., other__organelles___

What events do solar flares and sunspots cause?

Answers

Answer:

When sunspots interact with each other they cause explosions of energy. Solar flares are large eruptions of energy coming off the Sun containing several different forms of energy: heat, magnetic energy, and ionizing radiation. The ionizing radiation released during solar flares includes x-rays and gamma rays.

Answer:

explosions of energy

Explanation:

When sunspots interact with each other they cause explosions of energy. Solar flares are large eruptions of energy coming off the Sun containing several different forms of energy: heat, magnetic energy, and ionizing radiation. The ionizing radiation released during solar flares includes x-rays and gamma rays.

Suppose a person has one single mutation in their DNA and the first codon for the insulin gene now reads TAT instead of TAG. Using your codon chart, look up the amino acid that is coded for by the mutant DNA.

Answers

Answer:

Isoleucine

Explanation:

Using a codon chart, the gene TAT corresponds with AUA. U is Uracil and stands in place for Thymine since RNA does not use it. AUA results in the amino acid Isoleucine.

todo sobre la digestion

Answers

Answer: El sistema digestivo humano consiste en el tracto gastrointestinal más los órganos accesorios de la digestión. La digestión implica la descomposición de los alimentos en componentes cada vez más pequeños, hasta que puedan ser absorbidos y asimilados por el cuerpo. El proceso de digestión tiene tres etapas.

Explanation:

The air outside is so warm that this snowman is melting. During melting, the water molecules (gain/lose) thermal energy. How does the motion of the molecules change during melting?

Answers

Answer:

they gain thermal energy because they are warming up. the molecules are speeding up because liquid molecules are faster the solid molecules which don't move much.

Explanation:

The membrane-bound compartment indicated by structure D contains which of the following?
O ribosomes O oxidases and catalases O hydrolytic enzymes O nucleic acids

Answers

The membrane-bound compartment indicated by structure D contains  is d)nucleic acids.So,correct option is d.

Nucleic acids are biopolymers, macromolecules, vital for all known types of life.[1] They are made out of nucleotides, which are the monomers made of three parts: a 5-carbon sugar, a phosphate bunch and a nitrogenous base. The two fundamental classes of nucleic acids are deoxyribonucleic corrosive (DNA) and ribonucleic corrosive (RNA). On the off chance that the sugar is ribose, the polymer is RNA; assuming the sugar is the ribose subordinate deoxyribose, the polymer is DNA.

Nucleic acids are regularly happening engineered combinations that go about as the fundamental information passing on particles in cells and make up the genetic material. Nucleic acids are found in flood in each and every living thing, where they make, encode, and subsequently store information of every single dwelling cell of every single life-structure in the world.

Hence, correct option is d.

To know more about nucleic acids, visit here:

https://brainly.com/question/11309892

#SPJ4

(Complete question) is:

The membrane-bound compartment indicated by structure D contains which of the following?

a)ribosomes

b)oxidases and catalases

c)hydrolytic enzymes

d)nucleic acids

The membrane-bound compartment indicated by structure D contains which of the following?O ribosomes O

The seeds collected from the first generation monol
P1
F1
F3
F2

Answers

Answer:

The seeds collected from the first generation monohybrids are called F1. The first generation is called P generation or parental generation. The seeds collected from the first generation (P generation) is called F1 generation or the first filial generation. The seeds collected from the second generation (F1 generation) is called F2 generation or the second filial generation.

Explanation:

A student examines two bacterical cells, Cell I and cell II. He finds that cell I produces CO₂ and ethyl alcohol during cellular respiration while cell II produces carbon dioxide and water. What conclusions can you draw from his observation?​

Answers

If a student examines two bacterial cells, Cell I and Cell II, and he finds that cell I produce CO₂ and ethyl alcohol during cellular respiration while cell II produces carbon dioxide and water, then the conclusions are that cell I produce energy by Fermentation, while cell II produce energy by cell respiration.

What is cell respiration?

Cell respiration is a process that aerobic organisms use to produce energy, which releases carbon dioxide and water as byproducts of such chemical reactions in the organism.

Therefore, with this data, we can see that cell respiration produces energy and carbon dioxide, whereas fermentation does not produce carbon dioxide.

Learn more about cell respiration here:

https://brainly.com/question/14158795

#SPJ1

Some wetlands have high salinity. Does that restrict the number of species that live there?

Answers

Answer:

Yes

Explanation:

Wetlands as salinity increases over time, wetlands become degraded, endangering wetland species and decreasing biodiversity

Please choose two different organisms in your food web and describe their habitats. Where exactly do they live in the ecosystem? What is their niche (ecological role in the community)?

Please choose two different organisms in your food web and describe their habitats. Where exactly do

Answers

Answer:

hi

Explanation: I don't even know

Number the following structures to indicate their respective positions in relation to the nephron. Assign the number 1 to the structure nearest the glomerulus:
ascending limb of nephron loop
collecting duct
descending limb of nephron loop
distal convoluted tubule
glomerular capsule
proximal convoluted tubule
papillary duct in renal papilla

Answers

The structures in relation to the nephron can be numbered as follows: 1. Glomerular capsule, 2. Proximal convoluted tubule, 3. Descending limb of nephron loop, 4. Ascending limb of nephron loop, 5. Distal convoluted tubule, 6. Collecting duct, and 7. Papillary duct in renal papilla.

The nephron is the functional unit of the kidney responsible for filtering blood and producing urine. In relation to the nephron, the structures can be numbered based on their positions.

The glomerular capsule, also known as Bowman's capsule, is the first structure nearest to the glomerulus. It surrounds the glomerulus and collects the filtered fluid.

Next is the proximal convoluted tubule (PCT), which is responsible for reabsorbing water, ions, and nutrients from the filtrate.

The descending limb of the nephron loop follows, leading into the loop of Henle. This segment allows for water reabsorption.

Then comes the ascending limb of the nephron loop, which is divided into thin and thick segments and plays a role in reabsorbing ions.

The distal convoluted tubule (DCT) is positioned after the nephron loop and is involved in fine-tuning electrolyte balance and acid-base regulation.

The collecting duct is responsible for further water reabsorption and concentrates the urine.

Finally, the papillary duct in the renal papilla is the last structure, where the urine is eventually expelled from the nephron into the renal pelvis and then to the ureter.

Learn more about nephron here: brainly.com/question/12307837

#SPJ11

Which of these comparisons describing subatomic particles makes the most sense

Answers

First day of school! I'm excited and a little nervous about starting a new grade. Met my new classmates and teachers. Got my schedule and textbooks. Looking forward to a great year ahead!

Day 30 - Tuesday, October 10th

Fall break has arrived! Finally, some time to relax and catch up on sleep. Planning to spend quality time with family and friends. Also, need to work on a project for history class. Hoping to strike a balance between rest and productivity.

Day 40 - Friday, October 20th

Back to school after the break. Feeling refreshed and ready to tackle new challenges. The weather is getting colder, and we have a field trip to the local museum next week. Looking forward to exploring new exhibits.

Day 55 - Wednesday, November 8th

Report cards were handed out today. Happy to see my hard work paying off with good grades. Received positive feedback from my teachers, which boosts my confidence. Need to maintain this momentum throughout the year.

Day 70 - Monday, November 27th

Thanksgiving break is here! Grateful for the time to relax, spend time with loved ones, and indulge in delicious food. Reflecting on what I'm thankful for this year and setting some personal goals for the upcoming months.

Day 90 - Friday, December 22nd

Final day of school before the winter break! Excited for the holiday season and the chance to recharge. Teachers gave us some assignments to work on during the break, but I'll make sure to balance it with fun activities.

Day 110 - Monday, January 15th

Back to school after winter break. New year, new opportunities. We have a group project in Social Studies, and we get to pick our teammates. Hoping to work with friends and create something impressive.

Day 125 - Friday, February 2nd

Time is flying! The school's annual talent show is coming up, and I decided to participate with my singing skills. Nervous, but I'm practicing hard to give my best performance. Fingers crossed!

a report on the role of chromosomal multiplicity(polyploidy)in the field of agriculture.
Not less than 50 words.

50 points plz help me guys !!

Answers

Answer and explanation:

Chromosomal multiplicity, also known as polyploidy, is the name given to the cell or organism that has a numerical change in its whole set of chromosomes (for example, a triploid organism of a diploid species is a polyploid because it has an extra set of chromosomes than the rest of its species). Most species are diploids, but polyploidy is quite common in plants.

In agriculture, polyploidy can be beneficial by giving the plants better chances of survival and/or providing more desirable traits. Crop species such as bread wheat and triticale (a wheat and rye hybrid), for example, have 6 sets of chromosomes. Quinoa, coconut, and peanut are tetraploids (4 sets of chromosomes). Many of these cases of polyploidy in plants of importance for the agriculture field are a result of hybridization (which occurs when two different species are crossed in order to produce offspring with a combination of characteristics of the two-parent species).

lll. Picture Gallery

Identify the following tools used in farming.

25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.​

lll. Picture Gallery Identify the following tools used in farming.25.26.27.28.29.30.31.32.33.34.35.

Answers

Answer:

27. Digging shovel

25. Bucket

26. Spray bottles

27. Digging shovel

28. Crow bar

29. Trowel

31. Spade

32. Rake

33. Pickaxe

34. WheelBarrow

35. Watering can

Explanation:

Hope this helps

Tell me if I put something wrong

Other Questions
the global minimum variance portfolio formed from two risky securities will be riskless when the correlation coefficient between the two securities is Read carefully and choose the option with the correct series of words that corresponds to the text. Read carefully and choose the option with the correct list of words based on the text.Hello! My name is Juan and I'm from Alaska. On the weekend I will visit my friend Jorge and meet his family in Spain. I'm going to be in Jorge's country for a month. In my suitcase I want to wear summer clothes because it is July and it is very hot in Spain. I also > I'm going to put in my suitcase a suit to go to Jorge's sister's wedding in Cordoba. Jorge wants to go with me to the Mosque of Cordoba and buy at the Victoria market.On the weekend we go to the stadium to see our favorite footballteam.In the evening I will read about Spain on theinternet. I am very happy and my parents are proud because I am going to travel and learn. (1 point)Question 26 options: 1) Protagonist or protagonists: Juan and Jorge;scenario: Alaska; theme: The clothes needed.2)Protagonist or protagonists:Jorge; scenario: Spain; theme: the importance of friendship.3)Protagonist or protagonists:Juan; scenario: his house or State; theme: preparation for a trip.4)Protagonist or protagonists: Juanand Jorge; scenario: Crdoba; theme: The parents' feelings. The average living adult has___ liters of blood.03-404-85-66-8 SOMEONE PLEASE HELO ASAPPPPP WILL MARK BRAINLIESTTTTT PLEASEEEEE Construction zones have often __ speed limits? Factor polynomial by its greatest common monomial factor Which of the following is TRUE about the stages of grieving?A.Each stage should be experienced only once for each loss.B.Everyone must move through the stages in the same order.C.Progressing through these stages will help to deal with loss in a healthy manner.D.none of the abovePlease select the best answer from the choices provided.ABCD Where do tectonic activities, such as earthquakes or volcanic eruptions, tend to occur?A. near plate boundariesB. near all mountainsC. in the center of continentsD. only on the ocean floorWhere do tectonic activities, such as earthquakes or volcanic eruptions, tend to occur?A. near plate boundariesB. near all mountainsC. in the center of continentsD. only on the ocean floor What phase of the cell cycle involves condensing of chromosomes and separation on the centrioles in the centrosome? Suppose you placed an isolated neuron in a solution similar to extracellular fluid and later transferred the neuron to a solution lacking any sodium ions. What change would you expect in the resting potential? The legislation prohibiting opium smoking in opium dens or houses was most likely strongly influenced and prompted by _____. Which type of function is shown in the table below?xf(x)1O5-33-64.-95-12 Y= 5x -8 function rule What kind of work did Harriet Tubman do before she ran away? the correct decimal with bar notation for the repeating decimal. 0.9191919... 0.19 0.919 0.3 0.91 Bruno mentions that "the Fury" came for dinner. To whom is Bruno referring? Why is"the Fury" an appropriate play on words?I need help on this the story is The Boy in the Striped Pajamas can anyone help me? in your own opinion, what role do objectives play in the mainstream school curriculum? Jeff fell asleep in his chair while Elizabeth was delivering a speech on the effects of pollution on the atmosphere. This is an example of failing to _________________.a.listen for total meaningb.listen with empathyc.listen with an open mindd.listen ethicallyPlease select the best answer from the choices providedABCD Statistics A basketball player has the following points for a sample of seven games: 20, 25, 32, 18, 19, 22, and 30. Compute the Coefficient of variation. 4 Select one: O A. 21.2% B. 33.2% O C. 20.2% 50 Points! Multiple choice geometry question. Photo attached. Thank you!