The compass has advanced dramatically over the years, evolving into a
Global Positioning System (GPS). The GPS is a device that is simple to use
and gives a lot of information on your position.
Which is a positive effect of the technological advance of going from a
compass to a GPS?
O A. The GPS uses less electricity.
B. The GPS gives more accurate information
O C. The GPS is less expensive,
D. The GPS is easier to manufacture,

There are four main types of tissues in the human body, each with its unique structure, function, and location. These four types of tissues are Epithelial tissue, Connective tissue, Muscle tissue, and Nervous tissue.

Epithelial tissue: This tissue covers the surfaces of the body, both inside and outside, and lines the body's organs and cavities. It provides protection, secretion, and absorption and can be further classified into simple, stratified, squamous, cuboidal, and columnar epithelia.

Connective tissue: This tissue connects, supports, and anchors various structures of the body. It includes bone, cartilage, adipose tissue, blood, and lymphatic tissue.

Muscle tissue: This tissue is responsible for body movement, both voluntary and involuntary. There are three types of muscle tissue: skeletal, smooth, and cardiac.

Nervous tissue: This tissue is composed of specialized cells called neurons and is responsible for transmitting and receiving signals between different parts of the body. It forms the brain, spinal cord, and peripheral nerves.

To learn more about tissues

https://brainly.com/question/17664886

#SPJ4

Answer:

GENES

"genes contain the information needed to make functional molecules called proteins"

the manual is a gene

the bricks are amino acids

and the structures are proteins

Answer:

Organism I (circular chromosomes)

Explanation:

I can eliminate organisms II, III, and IV because these organisms have linear chromosomes therefore making it the most closely related to eukaryotes because they consist of linear chromosomes. My only other choice would be organism I, and since it has circular chromosomes we can conclude that this is the most distantly related to eukaryotes.

The organism I is most likely predicted to be the most distantly related to eukaryotes by the researchers.

Eukaryotes may be defined as any cell or organism that possesses a clearly defined nucleus and other cell organelles.

Except for organism I, all other organisms possess a linear set of genetic material, while organism I possess a circular set of chromosomes which is closely related to prokaryotes.

Therefore, the organism I is most likely predicted to be the most distantly related to eukaryotes by the researchers.

To learn more about Eukaryotes and prokaryotes, refer to the link;

https://brainly.com/question/495097

On the lagging strand, DNA synthesis restarts many times, resulting in many short fragments (Okazaki fragments). On the leading strand, DNA synthesis occur continuously. Therefore, the statement is FALSE.

Answer

Yes because a organ will survive longer than a heart

Explanation:

because i am smart

I. soil

Soil is NOT a renewable resource that is frequentl transformed into energy.

Myosin is one of the major proteins in fast-glycolytic muscle fibers and its primary function is to enable contraction.

Myosin is a motor protein which binds to actin and is responsible for the sliding filament mechanism that produces muscle contraction. It is made up of two heavy chains and four light chains and contains a motor domain which binds to and hydrolyzes ATP.

Myosin works in conjunction with actin to produce muscle contraction, where the myosin head binds to the actin filament and pulls it along, thus creating tension and allowing the muscle to contract. This allows the muscle to produce rapid and powerful contractions in fast-glycolytic muscle fibers.

Myosin is also responsible for maintaining the structure of the muscle fibers, which enables them to contract efficiently and maintain their shape. Without myosin, muscles would not be able to contract, so it is essential for the efficient functioning of fast-glycolytic muscle fibers.

know more about motor protein here

https://brainly.com/question/28256779#

#SPJ11

Answer:

A GOOD WAY IS TO TURN IT UP TO AROUND 74 OR 75.

Explanation:

BEST TEMP NO DOUBTS.

hope this helps mate.

Answer: Ductility

Explanation:

The term that is ductility is the Capacity of a material to deform permanently that is stretch, bend, or it can be spread in response to stress.  And therefore we can say that it fractures easily. When a material specimen is stressed then it plastically deforms we can see elasticity at first that is above a certain deformation which is known as the elastic limit of the deformation becomes permanent.

The materials that are easily deformed even without breaking when they are put under mechanical pressure are considered to be malleable. The materials that are easily deformed when they are put under tensile stress are considered to be ductile.

The word malleable comes from the latin medieval malleability which itself came from the original Latin malleare that is meaning "to hammer."

Since these materials do not break while it is being deformed that they can be forced into different shapes or sheets that are thin. This can be done by hammering as well as rolling or pressing.

A common very example for this is of a material that is malleable is gold which is often compressed into a leaf of gold for use in art as well as architecture, jewelry, and even food. There are other malleable metals which include iron, and copper, aluminum, silver, and lead, as well as the transition metal zinc at certain temperatures. There are many materials that are very malleable and are also very ductile, and it generally leads to an exception which is with low ductility and high malleability.

They are closely related to the concept of malleability that is said to be ductility. While the term that is malleability has to do with compressive stress or mechanical pressure and ductility relates to tensile stress or mechanical stretching.

Something we notice is ductile which is sometimes also known as tractile that can be easily stretched or drawn out into a thin wire. Copper is a very good ductile material and is a very good example of both malleability and ductility which is able to be pressed and rolled into sheets as well as stretched into wires.

The metals are often mixed as we mix the alloys to improve their physical properties. There is high-tensile steel which is an example of an alloy that has higher ductility than any of its component metals. And it is said to be often used in airplanes and cars and other engineering applications.

Please give a thanks or 5 stars if this helped!

Answer:

B. Interneurons

Explanation:

The basic unit of the central nervous system is the neuron or the nerve cells. Billions of neurons allow the different parts of the body to communicate with each other via the brain and the spinal cord. A fatty material called myelin coats nerve cells to insulate them and to allow nerves to communicate quickly.

Answer: The hypothesis proposed by Oparin and Haldane that life formed in pools of water containing common chemicals found in living organisms was supported by further experimentation and observations that produced results consistent with their hypothesis. Over time, other scientists conducted experiments and made observations that provided evidence to support the idea that life could have emerged from non-living matter in a primordial soup. While not all scientists may have agreed with the hypothesis, the accumulating evidence led to its acceptance as a plausible explanation for the origins of life on Earth. Therefore, the correct answer is "Further experimentation produced results that supported the hypothesis."

Explanation: Hope that covers it :)

Answer:

metaphase

Explanation:

Answer:

full

Explanation:

Biochemical variations, the true statement is option A, Compared to fish, humans and monkeys have more in common in terms of amino acid sequences.

The complete question is,

Considering the graph illustrating biochemical variations, which statement is correct?

A) Compared to fish, humans and monkeys have more in common in terms of amino acid sequences.

B) Compared to turtles and pigs, moths are more closely linked to candida.

C) The amino acid sequences of fish and humans are completely distinct.

D) Human and duck cytochrome c are not connected to one another.

To learn more about Biochemical variations refer to:

https://brainly.com/question/28482054

#SPJ1

Answer:

I think it has to do with osmosis

Explanation:

Osmosis is the process of having water pass from a low concentration medium to a high concentration one, given that the barrier (membrane) is semi-permeable.

When a cell is placed into distilled water, hypertonic solution takes place.

A cell may contain many solutes so it is considered hypertonic when compared to distilled water which is hypotonic So in this case, when a cell is placed in distilled water, water moves from outside of the cell to the inside leading to swelling of the cell.

The myelin sheath, which surrounds the axons that make up the white matter of the nervous system, is a crucial component.

The Schwann cells in the peripheral nervous system create this myelin sheath.

The innermost sheet-like glial process in touch with the axon spirals around it and spins out several overlapping membrane layers to generate myelin in the PNS (peripheral nervous system) and CNS. All save the innermost and outermost layers of the myelin sheath experience cytoplasm expulsion.

Around nerves, particularly those in the brain and spinal cord, a shield or sheath known as myelin forms. Protein and fatty acids make up its structure. The myelin sheath allows electrical impulses to travel along nerve cells efficiently and quickly. When myelin is compromised, these impulses become slower.

To learn more about myelin sheath, refer:-

https://brainly.com/question/14895639

#SPJ4

Answer:

Water

Explanation:

A medium is the substance through which a wave can propagate. Water is the medium of ocean waves.

Louis Pasteur's experiment to disprove the theory of spontaneous generation was crucial in the development of the scientific method. He was required to maintain a few variables to keep the experiment fair. This process involved the use of swan-necked flasks, sterilized broth, and control experiments.

Louis Pasteur's experiments aimed to disprove the spontaneous generation theory by creating a sterile environment, removing all microorganisms that would cause the broth to spoil. He used swan-necked flasks that allowed air to reach the broth but kept the microorganisms out of the broth. It was important for Pasteur to maintain a few variables in the experiment, such as the temperature of the broth, the source of the broth, and the duration of the experiment. Pasteur used boiled meat broth in his experiment as a nutrient source for microorganisms.The use of control experiments was critical to the experiment.

Control experiments were conducted in a similar manner as the experimental groups, but no change was made to the variable being tested. Pasteur kept the control experiments under the same conditions as the experimental group to determine if there was any growth of microorganisms in the control group. If there was no growth in the control group, it would indicate that the results observed in the experimental group were due to the treatment of the experimental group and not because of any variable factor. The control experiment showed that microorganisms do not arise spontaneously, but from pre-existing microorganisms.

learn more about Louis Pasteur's experiment

https://brainly.com/question/8101586

#SPJ11

Answer:

Slime molds are example of protists that can produce energy

Explanation:

Slime molds are known as photosynthetic protist. They can produce their own foods.  Like plants, slime molds also have cellulose in the cell walls of their spores. They are unicellular but they can form colonies.

Hence, it can be said that Slime molds are example of protists that can produce energy

Answer:

1. Having two similar gametes in which no differentiation can be distinguished, or reproducing by the union of such gametes.

e.g. in Spirogyra and Ulothrix

2. Anisogamy refers to a type of sexual reproduction in which two dissimilar gametes unite or fuse. The gametes may differ in size or form.

Example : human beings, the male gamete sperm is smaller and motile while the female gamete egg is non motile and larger.

3. having or involving a small motile male gamete and a large immotile female gamete.

E.g. Volvox, Fucus

The target heart rate range for an 18-year-old with a resting heart rate of 60 who wants to work between 60 and 80 percent of her maximum heart rate is 141.2 bpm to 170.6 bpm.

Using the Karvonen Method:

The maximum heart rate (HRmax) :

HRmax = 220 - age.

For an 18-year-old, the maximum heart rate (HRmax) will be:

HRmax = 220 - 18

HRmax = 202 bpm

Therefore, the maximum heart rate (HRmax) for an 18-year-old is 202 bpm.

Heart rate reserve (HRR) :

HRR = HRmax - RHR (Resting Heart Rate).

RHR is the resting heart rate of the individual. For an 18-year-old with a resting heart rate of 60 :

HRR = HRmax - RHR

HRR = 202 - 60HRR = 142 bpm

Therefore, the heart rate reserve (HRR) for an 18-year-old is 142 bpm.

The target heart rate - 60% (THR 60%) :

THR 60% = (HRR x 0.6) + RHR

THR 60% = (HRR x 0.6) + RHR

THR 60% = (142 x 0.6) + 60

THR 60% = 141.2 bpm

Therefore, the target heart rate - 60% (THR 60%) for an 18-year-old is 141.2 bpm.

The target heart rate - 80% (THR 80%) :

THR 80% = (HRR x 0.8) + RHR

THR 80% = (HRR x 0.8) + RHR

THR 80% = (142 x 0.8) + 60

THR 80% = 170.6 bpm

Therefore, the target heart rate - 80% (THR 80%) for an 18-year-old is 170.6 bpm.

To know more about Heart rate visit:

https://brainly.com/question/1155838

#SPJ11

Fertilization, meiosis, and mutations in the germ line are potential causes of variation in shared, inheritable traits. The correct answer is (A, D, and E).

Mutation, which can result in the creation of completely new alleles in a population, random mating, random fertilization, and recombination between homologous chromosomes during meiosis, which reshuffles alleles within an organism's offspring, are all examples of genetic variation.

Hereditary data is stored in units called genes. Mutations, genetic recombination, and population gene flow are the three primary sources of genetic variation.

Because they are encoded in our DNA, traits that are inherited can be transmitted to subsequent generations. Examples: hair color, height, eye color, and so on.

To learn more about Fertilization here

https://brainly.com/question/3204813

#SPJ4

Q- Within a diploid animal species, what are the potential sources of variation in shared, heritable traits? Select all that apply.

A) Fertilization

B) Mitotic division of somatic cells

C) Genetic engineering of somatic cells

D) Meiosis

E) Mutations in the germ line

Plants are autotrophs because they can prepare their own food.  Photosynthesis takes place in leaves which contain stomata that allow for the exchange of gases.

Photosynthesis may be defined as the process that converts carbon dioxide into glucose in the presence of sunlight.

Leaves of plants possess stomata through which the exchange of gases and loss of water takes place. These pores in the leaves of plants also help in the process of transpiration.

Therefore, it is well described above.

To learn more about Transpiration, refer to the link:

https://brainly.com/question/6899

Answer:

i hope this one helps

Explanation:

The phospholipids membrane has two halves of the lipid bilayer are called leaflets. Phospholipids have the ability to "flip-flop" between the two leaflets of the bilayer in a transverse motion. In the lipid bilayer, phospholipids can travel laterally inside one bilayer, transversely between bilayers, or rotationally.

Learn more about phospholipids here:

https://brainly.com/question/3856949

#SPJ4

Answer:

Long abd sharp teeth, sharp talons, sharp beak, quiet paws, agile, camouflage

The effects of human activities on the school community that can affect lives in return may be associated with healthy eating habits and regular physical activity.

The expression school community is associated with different activities in the school, which may be related with healthy food habits as well as performing regular physical activities. In general, these healthy habits are not followed in other settings such as occur in the holiday season.

School communities are well known to promote mental health and physical well-being in order to maximize the abilities of the students.

Therefore, with this data, we can see that school communities may be key to maintaining healthy habits associated with diet and physical activities, it is one important reason to assist to the school during the normal season and thus maintain a healthy mental and physical state (well-being state).

Learn more about the school and  community here:

https://brainly.com/question/834809

#SPJ1

"How to Differentiate Your Brand of Butter from Competitors" would most likely be a slide in Marcus's presentation on marketing agribusiness commodities.

This slide would focus on strategies to set one's brand of butter apart from competitors in the market. It may discuss various marketing techniques such as branding, packaging, advertising, and product positioning. The goal would be to highlight unique selling points and create a distinct identity for the brand, making it more appealing to consumers.

By emphasizing factors like taste, quality, sourcing, or production methods, Marcus can guide the audience on how to effectively differentiate their butter brand from competitors. This could include showcasing organic or locally sourced ingredients, promoting sustainable farming practices, or highlighting artisanal craftsmanship.

By addressing differentiation strategies, Marcus acknowledges the importance of standing out in a competitive market, capturing consumer attention, and creating a loyal customer base. This slide would offer practical insights and tips on how agribusinesses can leverage marketing techniques to carve a niche for their butter brand and gain a competitive edge.

know more about Marcus's here:

https://brainly.com/question/15084500

#SPJ8

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

Answer:

horizon 0 forms from organic material or B

Explanation:

Answer:

Horizon O forms from organic material.

Explanation:

I toke the test