The main source of energy used by the body is found in?

Answers

Answer 1

Answer:

carbohydrates


Related Questions

PLEASE HELP I AM STRESSED ANS CANT TAKE IT ANYMORE.. •Boll Weevils are an invasive species that has developed resistance to many major pesticides. Evaluate how
this influences the Boll Weevils' success and the options that can be used to control them.

Answers

Answer:

the boll weevil has an amazing complex gene system that allows them to quickly overcome many poisons. if so much as a few survive those few will have offspring and adapt being completely immune to the once deadly poison.

Fungi include which living organisms?

Answers

Answer:

Yeasts and molds.

Explanation:

Hope it's helpful to you

did mutations affect which trait was the most common at time 3?

Answers

Answer:

Explanation:

Without additional information about the specific traits and mutations in question, it is not possible to provide a definitive answer. However, in general, mutations can affect the prevalence and distribution of traits over time, as they can introduce new genetic variation into a population that can either increase or decrease the frequency of certain traits.

In evolutionary biology, the concept of natural selection can also play a role in determining which traits are most common over time. Traits that confer a selective advantage, such as increased fitness or survival, may become more prevalent in a population over time, while traits that are disadvantageous may decrease in frequency.

Therefore, to determine whether mutations affected the most common trait at time 3, it would be necessary to know which specific traits and mutations are being considered, as well as any selective pressures or environmental factors that may have influenced their prevalence over time.

what might happen if you were to damage your hypothalamus

Answers

Answer: YOU WOULD FALL OVER

Explanation:

YOUR MOM AND 69 LOOKIN SUS

Answer:

uh You might die because that is one of the functions of the nervous system

TRUE / FALSE. favors phenotypes at both ends of a range over intermediate phenotypes. this type of selection may occur when the habitat is varied.

Answers

The statement "Favors phenotypes at both ends of a range over intermediate phenotypes. This type of selection may occur when the habitat is varied" is true.

The described type of selection is known as disruptive selection or diversifying selection. In this form of natural selection, the extreme phenotypes at both ends of a range are favored over intermediate phenotypes. This means that individuals with traits at the extremes of a phenotypic spectrum have a higher likelihood of reproductive success compared to those with intermediate traits.

Disruptive selection is often observed in environments where the habitat is varied or exhibits diverse conditions. In such habitats, different phenotypes may be advantageous in different circumstances, allowing them to excel under specific environmental conditions.

Therefore, the statement is true.

To learn more about Favors phenotypes here

https://brainly.com/question/12462942

#SPJ4

of its brightness. C. Question: How does the addition of calcium to chicken's diet affect the hardness of eggshells? Hypothesis: Adding calcium to chicken's food is going to make the eggshells firmer. Independent variable:​

Answers

Answer:

it affects the hardness of the shells because calcium has a high reactivity which causes the shell to be hard

Explanation:

What best describes these two molecules?

What best describes these two molecules?

Answers

Answer:

B. They are structural isomers.

why was their more islands in cape cod in 2014 than in 1984

Answers

Answer:

The lowering water is causing the underwater lands to be exposed to the surface of the sea level.

Explanation:

Hope this helps! :)

At what part of the growing process is creativity more important? When is consistency more important?

Answers

Answer:

Creativity is most important . It develop in every stage of life. I t could be consistent when it get stable.

Explanation:

We could not count consistency as everything but it is counted for a lot. Creativity is more important at every stage when you grow up . The creative mind play role as a machinery. Consistent means you are not doing anything, you are constant.

As we can say that process is more important. When you are consistently working you are learning something new. So that when you are thinking about something too much then you wont do it. Creativity is rooted in the culture of an individual. Creativity is bounded with culture. It consists the dynamic thought. Creativity can no any exception.

I need help number 8

I need help number 8

Answers

Answer:

C. W is a metal and X is a non-metal

Explanation:

The elements in the "Periodic Table" are arranged in groups according to their characteristics.

X- Selenium

Z- Xenon

W- Magnesium

Y- Barium

A. X has a lower boiling point than Y. Selenium's boiling point is 685 while Barium's boiling point is 1,140. This makes choice A incorrect.

B. Y is a metal while Z is a non-metal. This makes choice B incorrect.

C. Both W and X are non-metals. Both are in the Alkaline Earth group. This makes choice C correct.

D. Z has different chemical properties than W because they don't belong in the same group. Z is a noble gas while W is an Alkaline Earth Metal.

what is the correct classification of the symbiotic relationship?
F - Predator/Prey
G - Mutualism
H - Commensalism
J - Parasite/Host

what is the correct classification of the symbiotic relationship?F - Predator/PreyG - Mutualism H - Commensalism

Answers

Answer:
H - Commensalism

Explanation:
F - Predator/Prey
This is where the predator benefits and the prey is harmed

G - Mutualism
Both benefit

H - Commensalism
One benefits while the other is unaffected

J - Parasite/Host
The parasite lives off of the host and the host is harmed and may even die. The parasite isn’t necessarily benefiting, but it wouldn’t be able to survive without the host.

With a few minor exceptions, all living things on earth utilize the same genetic code. A gene from one organism can even be copied and placed into another organism to produce the original protein! What is the implication of this fact

Answers

Answer:

It indicates that living organisms share same history.

Explanation:

The implication of this fact shows that all organisms living on this planet share a common evolutionary history means all organisms are evolved from a common ancestor. Due to common ancestor, gene from one organism can be taken, copied and placed into another type of organism to formed the original protein for that organism and this protein works the same as it work for other organism.

Help, I need answer for this, and I don’t understand

Help, I need answer for this, and I dont understand

Answers

Answer:

Read the Explanation below.

Explanation:

They could first test the density of the skeleton to see if it is real or not (bone has a different density and weight than plastic). They could also measure a sample of one part of the skeleton and see if it contains skeletal tissue (if it does, it is a from a human being).

cell division would be most common among cells in which of the labeled layers?

Answers

Answer:

What is the most common cell type in the epidermis? Cell division would be most common among cells in which of the labeled layers? Section of the epidermis indicating epithelial layers and cell types. D (Cells migrate upwards through the epidermis after being generated by mitosis in the stratum basale.)

Explanation:

Importance of photosynthesis​

Answers

Answer:

Photosynthesis is important to living organisms because it is the number one source of oxygen in the atmosphere. Without photosynthesis, the carbon cycle could not occur, oxygen-requiring life would not survive and plants would die. Green plants and trees use photosynthesis to make food from sunlight, carbon dioxide and water in the atmosphere: It is their primary source of energy. The importance of photosynthesis in our life is the oxygen it produces. Without photosynthesis there would be little to no oxygen on the planet.

Explanation:

It is the number one source of oxygen in the atmosphere.

It contributes to the carbon cycle between the earth, the oceans, plants and animals.

It contributes to the symbiotic relationship between plants, humans and animals.

It directly or indirectly affects most life on Earth.

It serves as the primary energy process for most trees and plants

A cell was found to have the following structures
DNA
Cell membrane
Mitchochondria
Based on the information provided what can be concluded about the cell

Answers

It could be a plant cell or an animal cell

what are the pros and cons of clear cutting

Answers

Answer:

Pro: Financial Reasons. Clearcutting advocates argue that the method is the most efficient for both harvesting and replanting trees. ...

Con: Effects on Plant and Wildlife. ...

Pro: Increased Water Flow. ...

Con: Loss of Recreation Land. ...

Pro: Increased Farmland.

Explanation:

No exp

Asthma is... Question 38 options: a) caused by Myobacterium tuberculosis. b) due to an excessive stimulation of smooth muscle in bronchioles. c) an obstructive tumor targeting primarily the terminal bronchioles. d) a collapsed lung resulting from insufficient production of surfactant. e) characterized by fluid buildup in the alveoli

Answers

Answer:

The answer is b) due to an excessive stimulation of smooth muscle in bronchioles.

is black coffee a strong or weak acid ?

Answers

It’s a 5 so weak I hope this helps

Answer:

Coffee often gets branded as an acidic drink, but in fact, coffee comes in at around a five on the pH scale, which is actually less acidic than drinks like beer, orange juice, and even soda.

The kind of genes an organism possesses is dependent upon the __________

a. type of proteins in the organism’s nuclei
b. sequence of nucleotides in the organism’s DNA
c. number of ribosomes in the organism’s cytoplasm
d. size of the mitochondria in the organism’s cells

Answers

Answer:

B. Sequence of nucleotides in the organism's DNA

Explanation:

The genes within an organism rely on the DNA within those organisms. Different DNA create different genes.

For a project I needed to ask 25 people : do you think eating meat is bad for the environment?

Answers

Answer:

Yes (It's more inefficient)

Explanation:

in ecology there are things called primary producers (plants) that are eaten by primary consumers (cows and chickens) and then there are humans, secondary consumers, that eat cows and chickens for energy.

The further we move from eating primary producers the more inefficient we become in consuming energy. Meaning, it requires a lot more natural energy consumption to support a human that lives on meat only as compared to a human that eats plants only. this inefficiency only magnifies when communities practice unsustainable food methods.

There are sustainable ways to eat meat, but (at least in the US) our current conventions of meat production are unsustainable and environmentally destructive.

PLAY

5

A student examined an unknown molecule that contained carbon (C), hydrogen (H), oxygen (O), nitrogen (N), and

phosphorus (P). No additional elements were found in the molecule.

Which type of molecule was examined?

A nucleotide

B A quarter-pounder with cheese. Hold the tomatoes!

protein

D carbohydrate

Eid

Answers

The types of biomolecules that contain carbon (C), hydrogen (H), oxygen (O), nitrogen (N), and phosphorus (P) are nucleotides. The other types of biomolecules, such as proteins, carbohydrates, and lipids, contain only some of these elements, but not all of them.

The nucleotides are the basic building blocks of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid), which are the genetic materials of all living organisms. A nucleotide is composed of three parts: a nitrogenous base, a five-carbon sugar, and a phosphate group. The nitrogenous base can be adenine (A), thymine (T), cytosine (C), guanine (G), or uracil (U), depending on whether it is DNA or RNA and whether it is single-stranded or double-stranded.

The sugar can be deoxyribose or ribose, depending on whether it is DNA or RNA. The phosphate group is the same in both DNA and RNA. When the nucleotides are joined together by phosphodiester bonds, they form a long polymer chain that can store and transmit genetic information from one generation to the next. Hence, the molecule that was examined is a nucleotide.

To know more about biomolecules visit:

https://brainly.com/question/12299485

#SPJ11

1. (a) A bench top centrifugation machine has 3000 rpm and has an arm length of 11 cm. Calculate the relative centrifugal force experienced by the analytes put in this type of a machine. [4] (b) (i) What do you understand by the term relative centrifugal force (RCF)?

Answers

The relative centrifugal force is 990,000. By adjusting the RCF in a centrifugation process, scientists can control the separation of analytes based on their desired outcome.

(a) To calculate the relative centrifugal force (RCF) experienced by the analytes in the centrifugation machine, we can use the following formula:

RCF = (1.12 × 10^-5) × r × (rpm)^2

where r is the arm length in centimeters and rpm is the revolutions per minute of the centrifuge.

Given that the arm length is 11 cm and the rpm is 3000, we can substitute these values into the formula:

RCF = (1.12 × 10^-5) × 11 × (3000)^2

Calculating this expression, we find that the relative centrifugal force experienced by the analytes is:

RCF = 11 × 9 × 10^4 = 990,000

Therefore, the relative centrifugal force is 990,000.

(b) (i) The term relative centrifugal force (RCF) is a measure of the gravitational force experienced by particles or analytes in a centrifuge. It quantifies the acceleration applied to the analytes during centrifugation and is expressed as a multiple of the acceleration due to gravity (g). RCF is used to determine the sedimentation rate and separation efficiency of particles based on their size, shape, and density. When a centrifuge rotates, the analytes experience a centrifugal force that pushes them away from the axis of rotation. This force causes the analytes to sediment or settle at different rates depending on their physical properties. RCF is directly proportional to the square of the rotational speed (rpm) and the radius (arm length) of the centrifuge. By adjusting the RCF in a centrifugation process, scientists can control the separation of analytes based on their desired outcome. Higher RCF values lead to faster and more efficient sedimentation, enabling the separation of particles with greater resolution. Understanding RCF is crucial in optimizing centrifugation protocols for various applications, including sample preparation, cell separation, and purification techniques in molecular biology, biochemistry, and clinical diagnostics.

Learn more about centrifugal force here:

https://brainly.com/question/545816

#SPJ11

a point mutation is a change to a single ___.

A. Base
B. Protein
C. Gene
D. Molecule

Answers

Answer: A. Base

A point mutation occurs in a genome when a single base pair is added, deleted or changed.

Explanation: Hope this helps :)))

Suppose a DNA triplet has the sequence 3'YATG-5'. Which of these three possible mutations of the triplet will stop translation?

A. 3-ACG-5
B. 3-ATC-5
C. 3-ATT-5

Answers

Answer:

B.3-ATT-5 beacuse it's obvious

What are the reactants in the dark reactions ?

Answers

Answer: The reactants in a dark reaction are carbon dioxide (CO2) and water (H2O).

Explanation:

Dark reactions are a type of photosynthetic reaction.

Photosynthesis is the process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. Photosynthesis in plants generally involves the green pigment chlorophyll and generates oxygen as a byproduct.

Dark reactions occur in the grana of chlorophyll and get energy from ATP and NADPH.

The reactants are carbon dioxide (CO2) and water (H2O).

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

A tudent made the following obervation about atronomical bodie. Obervation 1: Mar revere it direction of motion in the night' ky. Obervation 2: The tar move acro the ky. Which obervation() can be explained uing the heliocentric model but not the geocentric model?
Only obervation 1
Only obervation 2
Both obervation 1 and obervation 2
Neither obervation 1 nor obervation 2

Answers

The heliocentric model, but not the geocentric mode, can explain both observations 1 and 2.

What observations are compatible with the geocentric model?

Two observations proved that Earth is at the center of the universe: First of all, from every point on the planet, the Sun appears to revolve once a day around Earth. The Moon and the planets both appear to make one daily orbit around Earth, despite the fact that they move in different ways.

What does it mean to view the universe from a geocentric perspective?

The geocentrism theory. According to the geocentric hypothesis of the cosmos, the Earth is the center of the universe and around which everything else is said to revolve. This system was widely regarded as true in ancient Greece.

To know more about heliocentric model  visit:-

https://brainly.com/question/957540

#SPJ4

Which organism in the food web would be considered both a primary consumer and a secondary consumer?

Which organism in the food web would be considered both a primary consumer and a secondary consumer?

Answers

It would be an organism that is an omnivore so it would be a mouse

List out 3 caste of honey bees with their description​

Answers

Answer:

There are three castes in honey bees:

dronesworkersqueens.

Explanation:

There are three castes in honey bees:

Drones-Male honey bees are drones. The head and thorax of the drone are bigger than the females.Queens-Honey bee queens are the species' reproductive women.Workers-Workers' sweet bees are generally non-reproductive women.
Other Questions
In Exercises 20-23, find the arc length corresponding to the given angle on a circle of radius 6.2. 20. -180 21. 45 22. (180) 23. a how does a virus differ from a bacterium? select all that apply. how does a virus differ from a bacterium?select all that apply. a virus, unlike a bacterium, lacks a genome. viruses, unlike bacteria, lack metabolic enzymes. viruses are two-dimensional, whereas bacteria are three-dimensional. which of the following would be a reasonable estimate for a company's before-tax cost of debt? group of answer choices the coupon rate on the company's existing bonds. the interest rate charged on a bank loan that the company received last year. the current yield on the company's existing bonds. the yield to maturity on the company's existing bonds. what technological solution has been created to solve the e coli problem Simplify the expression 4(5a+b)9a+3 G(z) = K(z + 2/z^2) a) Draw root locus of G(z) (18 points) b) Find the K values where this system is stable (Closed loop poles inside unit circle) (7 points) can someone help me with this Marco and Colby decide to rob a pet store. The meet at malt shoppe to go over their plans. Marco leaves to buy a gun, and Colby leaves to steal a get-away car. Marco is arrested as he walks out of the gun shop with a new gun. Colby is arrested while trying to hotwire a car.Should Marco be charged with attempt? Should Colby? Explain. the nurse is doing discharge teaching with a new mother regarding the recommended position to lay her infant down for sleep; the nurse and will recommend which position? Use integers to represent the values in the statement the highest elevation in a country is a mountain with an altitude of 14,240 ft the lowest elevation in the country is a valley with an altitude of 285 feet below sea level Ruth is training for a half-marathon. On Saturday, she ran 3 miles in 34.5 minutes. On Sunday, she ran 2.5 miles in 28 minutes. How much faster, in minutes per mile, was her pace on Sunday than on Saturday? Which of the following is an example of cultural diffusion from Arab traders during the Mali Empire?A. ChristianityB. IslamC. JudaismD. Catholicism Please help me ;-; idk how to do this 32, 27, 29, 24, 26, 21, 23 , _____ What is the value of the (2/3) exponet 3 times (3 + 6 x 4) As a science, sociology relies on empirical evidence, which is information that researchers gather from observation, experimentation, and data collection to answer questions.True or False Which of these statements describe the changes that happened in American in the 1950s Answer if you know your right, bur dont answer just for the points a circus performer walking across a tightrope often carries a long pole for balance because the pole: ConflictEnvironmental changeEconomic conditionsReligious differencesPolitical conditionsSocial conditionsConsider those issues again in light of what youve learned about European exploration and expansion. Which of the factors listed above caused people to move during the period of new global interactions from the 1400s through the 1700s?How did European colonization affect Native Americans?What was the impact of the slave trade?How did the Commercial Revolution and the free enterprise system affect Europe and the Americas?How does the movement of people, culture, goods, plants, animals, and ideas from the 1400s through the 1700s still shape the world you live in today?