what are the respiratory movement of Man?Are they same in a grasshopper or a fish?
Answers
Answer:
Respiratory movements are the muscular movement that helps in the entry or exit of air to and from the respiratory organs of an animal. The mechanism of the respiratory movement can be different in different animals.
In man, the respiration movements involve inspiration and expiration by the expansion and contraction of the thoracic cavity that leads to the flow of oxygen and carbon dioxide to and from the lungs.
In insects such as grasshopper, the flow of the air moves through the tracheae by rhythmic relaxation and contraction of abdominal muscles. In fish respiratory movements involves entering the oxygen through their mouth and release CO2 from the gills.
Related Questions
Which statement is true about the differences between plant and animal cells? A) Only plant cells have cytoplasm. Reactivate B) Animal cells are always larger than plant cells. Reactivate C) Plant cells have vacuoles, but animal cells do not. Reactivate D) Only plant cells have chloroplasts that help make food during photosynthesis.
Answers
Answer:
D. Only Plant Cells have Chloroplasts that help make food during photosynthesis.
Explanation:
I always think of it like this-
Plants are green...What make them green? Chloroplasts
Animal cells are not green because they do not have chloroplasts.
A cannot be the answer because animal cells also have cytoplasm that suspend organelles.
B cannot be the answer because all cells come in a range of sizes and some plant cells can be bigger.
C cannot be the answer because some animal cells can have vacuoles.
Answer:
d
Explanation:
took the usatestprep
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?
Answers
a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.
However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).
Therefore, the sequence o mRNA read in the 5' to 3' direction is:
5' CUAUGGAAACACAUCAGUAGAA 3'
b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.
The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.
The codons, then will be:
AUG GAA ACA CAU CAG UAG
Then, we can say that the amino acids translated will be:
Met Glu Thr His Gln
(Methionine - Glutamine - Threonine - Histidine - Glutamine
c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.
. What are several causes of cancer?
Answers
Answer:
Cancer is caused by accumulated damage to genes. Such changes may be due to chance or to exposure to a cancer causing substance. The substances that cause cancer are called carcinogens. A carcinogen may be a chemical substance, such as certain molecules in tobacco smoke.
Explanation:
Answer:
* smoking
* tobacco
*sun
* obesity
* lack of excercise
* chronic inflamation
*viruses
Hope this helped
During the current year, austin enterprise shareholders invested $8,000 in the business. based on the following end-of-year spreadsheet, prepare an income statement, statement of retained earnings, and balance sheet for austin enterprises for the year ended december 31.
Answers
The income statement, statement of retained earnings, and balance sheet for Austin Enterprises for the year ended December 31 are as follows:
* **Income Statement**
* Revenue: $59,500
* Expenses: $40,500
* Net income: $19,000
* **Statement of Retained Earnings**
* Beginning retained earnings: $0
* Net income: $19,000
* Shareholder investment: $8,000
* Ending retained earnings: $27,000
* **Balance Sheet**
* Assets: $68,500
* Cash: $26,500
* Accounts receivable: $7,000
* Supplies: $1,000
* Equipment: $18,500
* Liabilities: $40,500
* Accounts payable: $11,000
* Wages payable: $1,000
* Equity: $28,000
* Common stock: $6,000
* Retained earnings: $22,000
The income statement shows that Austin Enterprises had revenue of $59,500 and expenses of $40,500, resulting in net income of $19,000. The statement of retained earnings shows that the company had beginning retained earnings of $0, net income of $19,000, and shareholder investment of $8,000, resulting in ending retained earnings of $27,000. The balance sheet shows that the company had assets of $68,500, liabilities of $40,500, and equity of $28,000.
The shareholder investment of $8,000 is added to the beginning retained earnings balance of $0 to give an ending retained earnings balance of $27,000. The ending retained earnings balance is then added to the common stock balance of $6,000 to give the total equity balance of $28,000.
Learn more about Liabilities here
https://brainly.com/question/30805836
#SPJ11
Can 2 objects made from exactly same substance but different shape or size have the same density? Make a graph
Answers
Yes, 2 objects made from exactly same substance but different shape or size have the same density.
How is it possible for items to have varying sizes but the same density?A substance's density is typically independent of its size, both large and small, and independent of its shape. Despite having distinct masses and volumes, a gold brick and a statue both have the same density. A substance's density is generally understood to be its mass per unit volume.
Therefore, object with the highest density will be the smaller of two things if they both have the same mass but differ in size. So one can say that two things have comparable densities if they have the same mass.
Learn more about density from
https://brainly.com/question/1591709
#SPJ1
Debris from the west coast of the U.S. Often collects in the Great Pacific Garbage Patch. What are the most likely impacts to marine life in this area?
Answers
Answer:
Microplastics contain harmful chemicals that can accumulate in the food chain.
Explanation:
I have taken the exam, and this was shown as the correct answer. Although some classes may be different depending on the wording of the question. But I hope this helps! Good Luck with the exams!
What is the process of protein synthesis?
Answers
Answer: The process of protein synthesis occurs in two stages: transcription and translation
Explanation:
Answer:
Protein synthesis is the process by which cells create new proteins, which are essential for various cellular functions. The process of protein synthesis involves two main stages: transcription and translation.
Transcription:
1. DNA double helix is unzipped by the enzyme helicase to expose the nucleotide bases.
2. RNA polymerase binds to a specific site on the DNA strand called the promoter region.
3. RNA polymerase adds complementary RNA nucleotides to form a single-stranded mRNA molecule.
4. mRNA molecule is created by reading the template strand of DNA (non-coding) in the 5' to 3' direction.
Translation:
1. mRNA molecule is transported out of the nucleus and into the cytoplasm of the cell.
2. Ribosomes attach to the mRNA molecule and begin translating the sequence of codons into amino acids.
3. Transfer RNA (tRNA) molecules bring the corresponding amino acid to the ribosome.
4. The ribosome reads the codon on the mRNA and matches it with the appropriate amino acid brought by the tRNA.
5. The ribosome forms a peptide bond between the amino acids, and the growing protein chain is elongated.
6. The process continues until a stop codon is reached, and the completed protein is released from the ribosome.
After protein synthesis is complete, the new protein is folded and modified as needed to create a functional protein.
Explanation:
Arrange the following terms from most inclusive to least inclusive.
1. embryophytes
2. green plants
3. seedless vascular plants
4. ferns
Answers
The most inclusive term is "green plants," which encompasses a wide range of organisms. "Embryophytes" is a more specific term that includes all land plants. "Seedless vascular plants" further narrows down the group to include plants with vascular tissues but without seeds. Finally, "ferns" refers to a specific group of seedless vascular plants with distinct characteristics.
The terms can be arranged from most inclusive to least inclusive as follows:
1. Green plants: This term encompasses a wide range of organisms that possess chlorophyll and carry out photosynthesis. It includes both aquatic and terrestrial plants.
2. Embryophytes: This term refers to a group of plants that have embryos protected within specialized structures. It includes all land plants, which are characterized by their ability to reproduce and develop embryos on land.
3. Seedless vascular plants: This term includes a diverse group of plants that have vascular tissues for conducting water and nutrients. They reproduce through spores and do not produce seeds. Examples of seedless vascular plants include ferns, horsetails, and clubmosses.
4. Ferns: This term specifically refers to a group of seedless vascular plants that reproduce via spores. Ferns are characterized by their feathery leaves and distinct life cycle involving alternation of generations.
To know more about Embryophytes,
https://brainly.com/question/14870533
#SPJ11
Several bird species feed in a certain species of tree. each bird species feeds in a different part of the tree. which factor are the species of birds responding to in the environment?
a.) symbiosis
b.) competition
c.) parasitism
d.) omnivores
Answers
Competition factor are the species of birds responding to in the environment. Thus, the correct option is B.
What is competition?If numerous bird species eat on the same tree species, there will be fierce competition for food. As a result of the competition, each species will seek out a certain portion of the plant to feed on, most likely the part of the plant where it will be easiest to outcompete the competitors for food.
As a result, we may deduce that the right response is "They have evolved to diverse niches as a result of competition."
For more information regarding competition, visit:
https://brainly.com/question/15525466
#SPJ1
Answer:
simply jus competition
in one sense the animal classification system above the species level is artiffical. In another sense, however, it is real explain the paradox
Answers
Answer:
Yes it does
Explanation:
thank you
The graph below shows population data for two species.
What can be said about the relationship between species 1 and species 2?
A.
The population of species 1 is not influenced by the population of species 2.
B.
The populations of species 1 and species 2 stay the same over the time period shown.
C.
When the population of species 1 increases, the population of species 2 decreases.
D.
When the population of species 1 increases, the population of species 2 increases.
Answers
Answer:
never give up its an order if you do then so dose life
Explanation:
never give up
Answer:
The answer is c
Explanation:
Because I got it right on a quiz and it’s obvious on the graph.
scientists have created a transgenic chick embryo that expresses tbx4 in both the forelimb and hindbud regions but no tbx5. what would you expect in the resulting chicken?
Answers
In the resulting chicken with a transgenic chick embryo that expresses TBX4 in both the forelimb and hindbud regions but no TBX5, you would expect the chicken to have hindlimb-like structures in both the forelimb and hindlimb positions.
This is because TBX4 and TBX5 are transcription factors that play crucial roles in limb development. TBX4 is responsible for the development of hindlimbs, while TBX5 is responsible for the development of forelimbs.
In this scenario, since TBX4 is expressed in both limb regions and there is no TBX5, the chicken would develop hindlimb-like structures in place of forelimbs due to the absence of the transcription factor that typically guides forelimb development.
You can learn more about chick embryos at: brainly.com/question/7803720
#SPJ11
What does a nucleus do in a cell?
Answers
Answer:
The nucleus is known as the brain of the cell, it is the organ of the cell that controls all the cell activities like growth, metabolism, etc. it carries genes, structures that contain hereditary information.
Seismic waves go faster through
S waves
than through
Answers
Seismic waves go faster through S waves than through P waves.
1. Seismic waves are waves of energy that travel through the Earth's interior, primarily generated by earthquakes or other geological disturbances.
2. There are two main types of seismic waves: P waves (primary waves) and S waves (secondary waves).
3. P waves are compressional waves that travel by compressing and expanding the material they pass through. They can travel through solids, liquids, and gases.
4. S waves, on the other hand, are shear waves that move particles perpendicular to the direction of wave propagation. They can only travel through solids.
5. The speed of seismic waves depends on the properties of the material they pass through. Generally, P waves travel faster than S waves.
6. However, when seismic waves encounter a boundary between different materials, their speeds can change. In some cases, S waves may travel faster than P waves through certain materials.
7. This phenomenon occurs because the elasticity and density of the materials affect the speed of the waves. The specific properties of the materials at a given location determine how seismic waves will propagate through them.
8. In most cases, S waves travel at about 60% to 70% of the speed of P waves. This speed difference is one of the factors that seismologists use to analyze seismic data and determine the nature of the Earth's interior.
9. By studying the arrival times and characteristics of P and S waves at different seismic stations, scientists can gain valuable insights into the structure and composition of the Earth's layers.
10. Therefore, it is accurate to state that seismic waves go faster through S waves than through P waves, as long as we consider their relative speeds within a specific material or medium.
For more such questions on Seismic waves , click on:
https://brainly.com/question/16977343
#SPJ8
Most phenotypic traits—features of the organism that we can observe—are not easy to put into a Punnet Square. Give at least two reasons, or factors, that make most phenotypic traits complicated. How, then, can we measure these traits?
Answers
Most phenotypic traits are complex due to polygenic inheritance and environmental influences.
Phenotypic traits often result from the combined effects of multiple genes (polygenic inheritance) and can be influenced by environmental factors. Punnett Squares, which illustrate single gene pair inheritance, are not suitable for capturing the complexity of such traits. Additionally, environmental factors can interact with genetic factors, leading to variations in trait expression.
To measure complex phenotypic traits, alternative approaches are used. Quantitative measurements, such as height or weight, provide precise numerical values. Statistical analysis helps identify patterns, correlations, and heritability estimates in populations. It involves studying large sample sizes and employing statistical models to understand the contributions of genetic and environmental factors. Molecular genetics advancements have further enhanced our ability to study complex traits at the genetic level.
To learn more about phenotypic follow the link:
https://brainly.com/question/28447708
#SPJ4
Pls help me with #6!
Tysm!
Answers
From this, it is concluded that the otters are the agile swimmers that depend upon speed to get away from predators, which is the last option as the otters swim in water and sometimes rest on the mud.
What is the significance of the otters?They are significant as they have cultural significance, such as being valued by different cultures for their fur that is used to make clothing, blankets, and other items, and are valuable subjects of scientific study.
Hence, from this, it is concluded that the otters are the agile swimmers that depend upon speed to get away from predators, which is the last option as the otters swim in water and sometimes rest on the mud.
Learn more about the otters here.
https://brainly.com/question/2792530
#SPJ9
1. What is the name of the body system responsible for breathing?
complete for brainlist
1. What is the name of the body system responsible
for breathing?
2. What are the parts of the respiratory system?
Your answer
3. What is the correct name for the windpipe?
Your answer
4. What do we Inhale and what do we Exhale?
Your answer
5. What happens in the Lungs?
Answers
Answer:
Explanation:
1)respiratory system
2)trachea, bronchi, bronchioles, alveoli, lungs, diaphragm
3)trachea
4)inhale oxygen and exhale carbon dioxide
5)gas exchange
A crocodile-like morphology evolved independently in a group of Triassic reptiles called phytosaurs, and later, after phytosaurs were extinct, in true crocodiles. This is an example of: Sympatric speciation. Iterative evolution Evolutionary drift Genetic drift Lamarckian evolution
Answers
The correct answer is iterative evolution. A crocodile-like morphology evolved independently in a group of Triassic reptiles called phytosaurs, and later, after phytosaurs were extinct, in true crocodiles. This is an example of iterative evolution.
Iterative evolution is the development of similar structures or forms independently over time in separate lineages. This is frequently seen in unrelated lineages of organisms that evolve similar features through convergent evolution. The crocodile-like morphology that evolved independently in Triassic reptiles called phytosaurs and later in true crocodiles is an example of iterative evolution as they evolved independently in separate lineages. The ability of the phytosaurs to thrive in an aquatic environment likely contributed to the development of this morphology, which later allowed true crocodiles to similarly thrive.
Phytosaurs as flying birds:
https://brainly.com/question/32090966
#SPJ11
The ear canal has glands that secrete ____________, a waxy, sticky substance that traps dirt and has an antibiotic action against microorganisms that enter the canal.
Answers
cerumen
The ear canal has glands that secrete __Cerumen_, a waxy, sticky substance that traps dirt and has an antibiotic action against microorganisms that enter the canal.
Using the picture above, place the correct letter next to each term
1. Order:
2. Genus:
3 Species:
4 Phylum:
5 Class:
6 Family:
Answers
Answer:
D- phylum
E- class
C- Order
B- Family
A- Genus
F- Species
The fourth and final phase of mitosis or meiosis during which a nuclear membrane forms around chromosomes on opposite sides of the cell and the chromosomes become unwound dna in a newly formed nucleus.
Answers
Answer:
The fourth and final phase of mitosis or meiosis is called telophase. During telophase, the nuclear membrane forms around the chromosomes on opposite sides of the cell, and the chromosomes become unwound DNA in newly formed nuclei.
In mitosis, telophase is the final phase of the cell cycle, during which the cell's genetic material is divided into two new daughter cells. In meiosis, telophase is the final phase of the meiotic cell division, during which the genetic material is divided into four new daughter cells, each with half the number of chromosomes as the original cell.
During telophase, the cell also begins to rearrange its cytoskeleton and reorganize its cytoplasm in preparation for cell division. This allows the two new daughter cells to separate and become independent organisms.
The telophase is the fourth and final phase of mitosis or meiosis, when a nuclear membrane forms around chromosomes on opposite sides of the cell and the chromosomes become unwound DNA in a newly formed nucleus.
What is the significance of the telophase?It is the final stage of cell division, in which the cell is about to divide into two different cells in mitosis, and there are four cells meiosis, and in telophase, the genetic contents are present at opposite poles and the DNA is decondensed. In all the phases of the cell cycle, the telophase is the last one where cytokinesis begins.
Hence, the telophase is the fourth and final phase of mitosis or meiosis, when a nuclear membrane forms around chromosomes on opposite sides of the cell and the chromosomes become unwound DNA in a newly formed nucleus.
Learn more about the telophase here.
https://brainly.com/question/29766833
#SPJ2
Why would losing just a few dozen aquatic species lead to the end of life in the ocean as we know it?
I NEED THE ANSWER BEFORE 11:59!!!!
First one gets brainiest
Answers
Answer: It would unbalance the ecosystem.
Due to the fact that if some species die off, the other species that rely on those species for food or protection would loose that food/ protection which may lead to their extinction and their extinction would lead to another extinction and so on.
Who is Ross Carr? Who is Ross Carr?
Answers
What is the answer for this question?
Answers
Why are fish dying in Prospect Park Lake?
Fish are dying because the park keepers are putting too much fertilizer on the grass that then runs off into the water.
Fish are dying because the water comes from NYC tap water, which has added
phosphorus to prevent lead from lead pipes from leaching into the tap water.
Fish are dying because there is human waste in Prospect Park lake.
(this is 7th grade science). please help
Answers
Answer:
because of pollution
Explanation:
Please help!!
Describe the nitrogen cycle.
Answers
Answer:
The nitrogen cycle is the biogeochemical cycle by which nitrogen is converted into multiple chemical forms as it circulates among atmospheric, terrestrial, and marine ecosystems. The conversion of nitrogen can be carried out through both biological and physical processes.
Answer: biogeochemical cycle
Explanation: nitrogen is converted into multiple chemical forms as it circulates among atmospheric terrestrial, and marine ecosystems. The conversion of nitrogen can be carried out through both biological and physical processes.
5. Four different types of cells are shown below.
N
eukaryotic prokaryotes
Which characteristic is shared by all four cells?
Unanswered
Answers
Answer:
All cells share four common components: (1) a plasma membrane, an outer covering that separates the cell's interior from its surrounding environment; (2) cytoplasm, consisting of a jelly-like region within the cell in which other cellular components are found; (3) DNA, the genetic material of the cell;
Explanation:
Can only be found in the nucleus
DNA only
RNA only
Both DNA and RNA
Neither DNA nor RNA
Answers
DNA only, because RNA is kind of like in the cytoplasm.
Answer: C. Both DNA and RNA
Hope this helps!!
in drosophila, an ncrna called rox is involved in dosage compensation. rox is part of the msl complex, which binds to the x chromosome and recruits histone-modifying enzymes to the chromatin. rox is required for the msl to bind to the x chromosome. what function is this ncrna playing?
Answers
In Drosophila, an ncRNA plays a crucial role in directing Rox RNA and its non-coding genes for protein production.
RoX RNA can be a non-coding RNA (ncRNA) shown inside the male-specific dangerous (MSL) complex and is required for sex estimation compensation in Drosophila.
This can be fulfilled by the MSL complex official to the X chromosome and inciting histone H4 lysine 16 acetylation and licenses for the course of action of euchromatin. These ncRNAs were, to start found in RNA removed from neuronal cells.
Two roX RNAs have been recognized inside the MSL complex from Drosophila melanogaster and have shown up to be directed over different drosophila species.
The two roX RNAs, known as roX1 and roX2 have been shown up to differentiate in the basic course of action and course of action length but despite these contrasts, they both contain an MSL definitive area and are essentially redundant.
Cloning roX qualities and resulting gathering course of action from a few unmistakable drosophila species recognized some directed districts and it was moreover taken note that roX RNA is because it appeared in male flies.
Learn more about Drosophila at
https://brainly.com/question/13389187
#SPJ4
A farmer has been observing his plants and has stated that the concentration of nitrogen in the soil of his lands attects plant growth. Such statement can be best labeled an Time R Ant 1 Hour experiment theory wypothes Owarable
Answers
The farmer's observation that the concentration of nitrogen in the soil affects plant growth can be best labeled as a hypothesis (H₁).
The farmer's statement can be considered a hypothesis because it proposes a relationship between two variables, the concentration of nitrogen in the soil and plant growth. A hypothesis is a tentative explanation or prediction that can be tested through experiments or observations. In this case, the farmer is suggesting that the level of nitrogen in the soil has an impact on the growth of plants.
To further investigate this hypothesis, the farmer can design an experiment (E) to test the relationship between nitrogen concentration and plant growth. The experiment may involve growing plants in different soil samples with varying nitrogen concentrations and measuring their growth over a period of time. By analyzing the data collected from the experiment, the farmer can draw conclusions about the influence of nitrogen concentration on plant growth.
learn more about Hypothesis here:
https://brainly.com/question/32456224
#SPJ11