Number of
Protons
Number of
Neutrons
Atomic
Number
Mass
Number
Element
(symbol)
4
2
А
B
C
D
12
10
Using the periodic table complete the table to describe each atom Type in your answers
Answer:4 2
Explanation:
27. What might be the result of a population growing larger than the carrying capacity?
a. Birth rate will increase.
b. Death rate will increase.
c. Resources will become abundant.
d. There will be an increase in immigration.
explain the importance of all 3 biomolecules in general and for making ATP.
The three biomolecules that are used for making ATP are Lipids (fats) , Carbohydrates and Proteins
The biomolecules also known as biological molecules serve a wide range of activities and they vary in shape and their size . It is also considered essential to life because they help organisms develop, survive, and propagate. The biomolecules interact with one another which play a role in the development of organisms .
There are four types of biological molecules which are carbohydrates which is used as an energy source , lipids which is used for storage and support , proteins is used for supporting essential vital functions and amino acids are the developing elements that make up proteins and nucleic acids for storing genetic information .
To learn more about biomolecules
https://brainly.com/question/12299485
All of the following best describes how does pollution affect a food web except?
A .Air pollution can block sunlight affecting plants.
B. Water pollution can kill plant species found a food chain.
C.Water pollution can eliminate population of first order consumers.
D. Water pollution can make secondary consumers better hunters.
Translate the DNA, mRNA, amino acid shown in picture (DNA sample)
DNA:
mRNA:
amino acid:
TACGCCTTTACT TACTCGTCAATT TACCCGACGACCACT TACTACTAGATC TACCACCACACT TACTCATCGATC TACTGGTAAGTAACT TACTTTCAGGGTACT
DNA: DNA stands for Deoxyribonucleic Acid, which is a molecule that contains the genetic instructions for the development, functioning, and reproduction of all living organisms.
It is a long, double-stranded molecule made up of four types of nucleotides: adenine (A), thymine (T), guanine (G), and cytosine (C).
TACGCCTTTACTTACTCGTCAATTTACCCGACGACCACTTACTACTAGATCTACCACCACACTTACTCATCGATCTACTGGTAAGTAACTTACTTTCAGGGTACT
mRNA:mRNA stands for Messenger Ribonucleic Acid, which is a type of RNA molecule that carries the genetic information from DNA to the ribosomes, where it serves as a template for protein synthesis.
mRNA is synthesized through a process called transcription.
AUGCGGAAAUGAAUGAGCAGUAAAUUGGGCUGUGCUGGUGAAUGAUGGUGGUGUGAUGAGUAGUAGGUGGUAGAUGAUGACCAUUCACCCAUUGAGUCA
Amino acid:Amino acids are the building blocks of proteins. They are organic compounds made up of an amino group (-NH2), a carboxyl group (-COOH), and a side chain that is specific to each amino acid. There are 20 different amino acids that are commonly found in proteins, each with a different side chain that gives it unique properties.
Met-Arg-Lys-Asp-Arg-Gln-Stop-Leu-Gly-Leu-Cys-Trp-Val-Asn-Asp-Val-Val-Val-Asp-Ser-Val-Gly-Asp-Met-Leu-Pro-Leu-Glu-Ser
To know more about amino acid, visit :
https://brainly.com/question/14583479
#SPJ1
The book named Principles of Geology, which influenced Darwin, was written by
Answer:
Principles of Geology, which influenced Darwin, was written by Charles Lyell
Explanation:
I don’t understand why mom doesn’t want me
Answer:
is because she wants you man. there no mom that dose not like their child
Take a look at tgis art piece of art
The cultures that created this form of art thought it important to pass the artwork on to future generations
What type of oceanic art is this considered to be?
A. Australian Art
B. Micronesian Art
C. Melanesian Art
D. Polynesian Art
Edmentum/Plato
The given art piece is considered to be Polynesian Art. So the correct option is option D.
Polynesia is divided into the East Polynesian and West Polynesian cultural groups. West Polynesian culture is characterized by a high population density. West Polynesia has strong marriage institutions and well-established judicial, monetary, and commercial customs. West Polynesia includes the groups, Tonga, Samoa, and Fiji.
People were artists and craftspeople of exceptional skill. Simple things like fish hooks would be made to exact specifications for various catches and embellished even when the embellishment wasn’t part of the purpose. Stone and wood weapons were seen as more powerful the more beautifully crafted and embellished they were. In many island groups, weaving was an integral part of their culture, and gift-giving of woven articles was a long-standing tradition.
To learn more about art, refer to the link:
https://brainly.com/question/19049629
#SPJ1
May I have help on This question please I’ll give you brainliest no links or I will report you
Option B. Pour the drinks into the plain paper cups as blind trials.
A sort of scientific trial wherein neither the contributors nor the researcher is aware of which remedy or intervention participants are receiving till the clinical trial is over. This makes the consequences of the study much less probably to be biased. The blind trials is a test of belief and verbal exchange. a group is blindfolded and then led around the path beneath the instruction of one or more people.
A blind trial examination is one in which neither the individuals nor the experimenters recognize who's receiving a particular treatment. This manner is applied to prevent bias in studies results. Double-blind research is especially beneficial for stopping bias because of the call for traits or the placebo impact.
Learn more about the blind trials here:-https://brainly.com/question/9292513
#SPJ1
5. Which molecule loses electrons in cellular respiration?
water
carbon dioxide
oxygen
glucose
Answer:
Organic fuel molecules are 'oxidized 'during cellular respiration.Explanation:
Respiration, the oxidation of glucose and other molecules in food, is a redox process. In a series of reactions, glucose is oxidized and oxygen is reduced. The electrons lose potential energy along the way, and energy is released.
2. ______ are made up of at least one cell. Which word best fits in the blank? * 1 point A. Animals B. All living things C. Plants D. Atoms
Living things are made up of at least one cell which is option B.
Living things explained.
Living things are organisms that have one or more cells and have life i.e they can breathe.
Living things are organisms that can perform some essential processes and has the ability to maintain their internal environment.
Some essential processes perform by living things are metabolism, respiration and so on.
The mature characteristics of living things are movement, respiration, nutrition, irritabilility, growth, excretiuon, reproduction and death.
Examples of living things are plants and animals.
Therefore, living things are composed of one or more cells and have a complex organization that help them to maintain their internal environment.
Learn more about living things below.
https://brainly.com/question/280237
#SPJ1
Hi i have a biology quedtions please
Using the Punnett square, there is a 50% chance that III-11 and III-12's next offspring will have the CH genotype.
How is the Punnett square used to determine the probability?To use a Punnett square to determine the probability of individuals III-11 and III-12 having offspring with the CH genotype, we need to know the genotype of both parents.
Let's assume that both III-11 and III-12 are heterozygous carriers of the CH allele (CH/ch).
We can represent their genotypes as:
III-11: CH/ch
III-12: CH/ch
To create a Punnett square, we write the possible gametes for each parent along the top and left side of the square. Since both parents are heterozygous, each can produce two types of gametes, one with the CH allele and one with the ch allele. The Punnett square looks like this:
CH ch
CH CH/CH CH/ch
ch ch/CH ch/ch
Each box in the Punnett square represents a possible offspring genotype resulting from the combination of one gamete from each parent.
To determine the probability of an offspring having the CH genotype, we look for the boxes that contain at least one CH allele. There are three such boxes: CH/CH, CH/ch, and ch/CH.
The probability of an offspring having the CH genotype is therefore:
(1/4) + (1/2) + (1/4) = 1/2 or 50%
Learn more about a Punnett square at: https://brainly.com/question/3522181
#SPJ1
in contrast to an exergonic reaction, which of the following accurately describe an endergonic reaction? multiple select question. the products have more free energy than the starting compounds. the starting compounds have more free energy than the products. the reaction consumes energy. the reaction releases energy as it proceeds.
in order for the cells to acquire energy, they eliminate electrons from an energy source and eventually give them to the terminal electron acceptor.
Exergonic responses have a negative change in free energy though endergonic responses have a positive change in free energy.
Exergonic responses discharge energy, implying that the results of the response are more steady than the reactants. Interestingly, endergonic responses assimilate energy from the environmental elements. This implies that the items are less steady than the reactants.
In cells, the hydrolysis of adenosine triphosphate (ATP) is the prompt wellspring of energy for an endergonic response. ATP gives suddenness and advances cell work by connecting exergonic to endergonic responses.
To learn more about exergonic here
https://brainly.com/question/13711393
#SPJ4
describe clinical features of meningitis
Fever, neck pain/stiffness, and photophobia are common symptoms. Headache, dizziness, disorientation, and delirium are meningitis that can manifest differently depending on the host's age.
Are stiff neck and headache common meningitis symptoms?The infection and inflammation of the fluid and membranes around the brain and spinal cord are known as meningitis. These membranes are known as meninges. Meningitis inflammation often causes symptoms such as headache, fever, and stiff neck.
Is a test for meningitis available?Hospital tests, A physical examination to seek for signs of meningitis. A blood test to detect germs or viruses. A lumbar puncture is a procedure in which a sample of fluid from the spine is removed and tested for germs or viruses. a CT scan to look for any brain issues, such as oedema.
to know more about meningitis here;
https://brainly.com/question/29559952
#SPJ1
Helppppppppppppp
......................................
Answer:
A triangleeeeeeeeeeeeeeeeeeeeeeeee
which measurement is likely the least accurate? Explain.
What observations and/or patterns do you see in the data?
Based on the information, we can infer that the measurement that could be the least probable is caudal peduncie depth strandard error. Also, the trend is for lake values to be higher than river values.
What difference do we see in the values in the table?To identify the values we must analyze the table and identify they are not the trends. In this case we can infer that the tendency is for the values of the lake to be higher than the values of the river because all the values of the lake are higher than those of the river.
On the other hand, we can infer that the value that could be the least successful is the peduncie depth strandard error because it shows equal values. However, if we take into account the previous values, it should not be the same in both cases.
Learn more about lakes in: https://brainly.com/question/858802
#SPJ1
Jacqueline Butler is a 27 year-old woman who presented at your primary care practice with tingling in her left hand that had been persistent for the past week. She has also been experiencing increasing clumsiness and weakness when using her left arm, as well as fatigue and trouble concentrating. A surface examination of her extremities showed no swelling, inflammation of joints, or noticeable cysts. Her body temperature was normal, as was a complete blood count (CBC) including a blood glucose test. Subsequently, you order a lumbar puncture to rule out infection and an MRI with contrast dye. The lumbar puncture shows elevated levels of IgG antibodies and the MRI showed three small inflammatory lesions within the brain. Based on these results, you diagnose Jacqueline with which disease?
Answer:
Multiple Sclerosis
Explanation:
Multiple sclerosis (MS) is the most common neurodegenerative and demyelinating inflammatory disease in adults between 18 and 35 years of age and is the second leading cause of neurological disability in young adults. This pathology is considered an organ-specific autoimmune disorder, characterized by multiple focal areas of demyelination called plaques or lesions, which are accompanied by different degrees of gliosis, inflammation and neuroaxonal damage. It usually manifests itself in coordination and balance problems, muscle weakness, difficulties in thinking and memorizing and sensations of numbness, as well as other symptoms. Diagnosis of MS is based on a clinical evaluation in which all symptoms, as well as the signs (overactive reflexes, incoordination, weakness of specific muscle groups, etc.) of the disease are documented. Magnetic resonance imaging (MRI) is used to obtain cross-sectional images of the brain and spinal cord, which can detect the small areas of inflammation and scarring in the brain typical of MS.Lumbar puncture is an analysis of a sample of cerebrospinal fluid (CSF), which has the function of cushioning the brain and spinal cord, to evaluate the abnormalities that occur in patients with MS. The most common CSF abnormality found in 80-90% of MS patients is an increase in the number of cells and proteins of the immune system (immunoglobulins), suggesting inflammation or a strong immune response. This test is particularly useful to diagnose patients who experience a slow and progressive decline in their functions without exacerbation pictures; that is, people with primary progressive multiple sclerosis, especially when no abnormalities are detected in the MRI images of the brain. CSF evaluation can also be used to exclude infections difficult to distinguish from multiple sclerosis.
Hydrogen bonds form between neighboring water molecules because of:
Answer:
Hydrogen bonds form between neighboring water molecules because of: polarity of water molecules. Covalent bonds form between hydrogen and oxygen atoms in a water molecule as a result of the: sharing of electrons between atoms.
Explanation:
I hope it helped
How does capillary action happen?
Which statement best explains heating by radiation?
A. Warm air rises and takes heat with it; eventually it cools and sinks.
B. Sunlight travels through space without the aid of fluids or solids.
C. Land and ocean absorb and re-emit heat from the sun.
Answer: B. Sunlight travels through space without the aid of fluids or solids.
Explanation:
Heating by radiation refers to the process by which energy is transferred from one place to another in the form of electromagnetic waves. In the case of the sun, the heat is transmitted to the Earth through space as radiation. This is possible because radiation does not require a medium to travel through and can propagate through a vacuum.
Blink-blanks use a complex mathematical formulas to predict temperatures win cloud formation and prediction
Answer:
Weather forecasting is the application of science and technology to predict the conditions of the atmosphere for a given location and time.
Explanation:
Which of the following words describes the reality that the universe looks the same
from various perspectives
distribution pattern
cosmological
symmetrical
isotropic
Answer:
Isotropic
Explanation:
When astronomers look inside of a powerful telescope they were able to see that the universe looks the same in all directions. Isotropic is just another word for 'same in every direction' even if you stand in the center and look in every direction.
Hope this helped :)
if light shines through a medium with a higher index of refraction than air why do the different wavelengths of light separate?
Answer:
Explanation:
f light enters any substance with a higher refractive index (such as from air into glass) it slows down. The light bends towards the normal line. If light travels enters into a substance with a lower refractive index (such as from water into air) it speeds up. The light bends away from the normal line.
which body system contains major organs found in pairs?
Answer:
I belive it is the urinary system
Explanation:
My reasoning is because you have 2 pairs of kidneys which filter excess water, and waste called urea from blood and urine. Connecting to the kidneys are ureter tubes, which come in pairs. I'm not sure if this helps, but I tried lol.
write a letter to your uncle who is in abroad telling him u want to join vacation classes with ur friends but ur father is facing some financial problems so he can't afford so u need the help of your uncle who is in abroad
Explanation:
Dear Uncle [Uncle's Name],
I hope this letter finds you in good health and high spirits. I have been meaning to share some news with you, and I believe your guidance and support can make a significant difference in my life.
As you know, the summer vacation is fast approaching, and my friends and I have been planning to join vacation classes together. It is an opportunity for us to learn and engage in activities that would enhance our skills and broaden our horizons. We are all excited about the prospect of spending quality time together while acquiring new knowledge.
However, I regret to inform you that my father is currently facing some financial difficulties. Due to unexpected circumstances, he is unable to afford the expenses associated with the vacation classes. It has been a challenging time for our family, and my father's priority is to ensure our basic needs are met.
In light of these circumstances, I am writing to you, dear uncle, with the hope that you may consider extending your support. Your assistance would mean the world to me and enable me to participate in these vacation classes alongside my friends. Your generosity has always been a pillar of strength for our family, and I am sincerely grateful for everything you have done for us.
Attending these classes would not only be a source of knowledge and skill development but also a chance for me to bond with my friends and create lasting memories. It would enhance my educational journey and contribute to my personal growth. I genuinely believe that this opportunity would be a valuable investment in my future.
I understand that everyone has their own financial responsibilities and commitments. Therefore, I completely respect any decision you make, and I am grateful for your consideration. If it is not feasible for you to provide financial assistance at this time, I completely understand, and I will continue to explore other alternatives.
Thank you, dear uncle, for taking the time to read my letter. I eagerly await your response and value your guidance and support. Regardless of the outcome, please know that your love and presence in our lives mean more to me than anything material.
Sending my warmest regards and affection to you and the family. Take care, and I hope to hear from you soon.
With heartfelt gratitude,
[Your Name]
The primary role of phospholipids is _________________.
The primary role of phospholipids is _________________.
to keep cells hydrated
to form cell membranes
organelle structure
energy storage
The primary role of phospholipids is to form cell membranes. Phospholipids are a type of lipid molecule that consists of a hydrophilic head and a hydrophobic tail. In the cell membrane, the hydrophilic head faces the aqueous environment, while the hydrophobic tail is oriented towards the interior of the membrane. This creates a selectively permeable barrier that allows certain molecules to pass through the membrane while preventing others from doing so. Phospholipids play a crucial role in maintaining the structure and function of cell membranes.
g Identify the statements that accurately describe how hydrogen ion concentration relates to energy production in oxidative phosphorylation. Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space. The pH in the mitochondrial matrix is lower than the pH in the intermembrane space. Energy is generated as a result of the difference in hydrogen ion concentration between the intermembrane space and the cytoplasm. Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain. Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.
Answer:
- Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space.
- Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain.
- Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.
Explanation:
Oxidative phosphorylation is a metabolic pathway by which Adenosine Triphosphate (ATP) molecules are produced through the transfer of electrons from NADH or FADH2 to molecular oxygen (O2). The hydrogen (H+) ions are pumped from the mitochondrial matrix to the intermembrane space, and this movement of protons generates an electrochemical gradient across the mitochondrial membrane which is used by the ATP synthase to produce ATP. This gradient is generated by the movement of electrons through a series of electron carriers (e.g., cytochrome c and ubiquinone) that are embedded in the inner mitochondrial membrane. The movement of these H+ ions across the semipermeable mitochondrial membrane moving down their electrochemical gradient is named chemiosmosis and is an example of facilitated diffusion.
Which of the following is an example of olfactory sense?
Select one:
a. Salim predicted the lunch menu by touching the food
O b. Salim predict
the lunch menu just by the smell
of the food
c. Salim predicted the lunch menu by looking at the food
d d. None of these
b. Salim predict
the lunch menu just by the smell
of the food
most of the long wave energy radiated from Earth and lost space on a cloudless night is
1. ultraviolet
2.infrared
3.visible light
4. gamma rays
Answer:
2.infrared
Explanation:
Infrared radiation or infrared light is electromagnetic radiation.
Infrared A radiation (IR-A) accounts for almost a third of total solar radiation, while UVA and UVB radiation make up only seven percent of the total solar spectrum.
Of the total solar energy that reaches the Earth's surface, the largest part of the radiation of as much as 54-56 percent is IR radiation, 39 percent is visible light and about five to seven percent is UV radiation.
The primary factors which determine each biome are:
land features
plate tectonics
sunshine
rainfall
temperature
Answer:
temperature is the most important factor of any biome