what is : A warrant that appeals to the credibility the audience assigns to the source of the evidence; also called an ethos-based appeal.

Answers

Answer 1

A warrant that appeals to the credibility the audience assigns to the source of the evidence is essentially an appeal to ethos, or the ethical character and credibility of the speaker or source. This type of warrant is often used in persuasive writing or speaking to establish trust and credibility with the audience.

It relies on the assumption that the audience will assign greater value and trust to information that comes from a credible and trustworthy source. For example, if a doctor is speaking about a particular medical treatment, their expertise and authority in the field can serve as a warrant for the effectiveness of the treatment. It is important to fully explain the concept and its application. Understanding the different types of warrants and how they appeal to the audience is crucial for effective persuasion and communication.

To know more about Warrant visit:

https://brainly.com/question/30710000

#SPJ11


Related Questions

why might a government want to restrict or abridge what is written about them

Answers

To protect public safety, the government wishes to limit or abridge what is written about them. Inciting a riot is not protected speech because it is harmful to others.

Freedom of speech is a fundamental guarantee that allows individuals and communities to express their ideas and beliefs without fear of government censorship. The right to free speech, press, and assembly is guaranteed by the First Amendment to the United States Constitution.

The exchange of ideas between people from various backgrounds is critical to the health of a democracy. While the government has the authority to ban some speech, American citizens have the right to express themselves publicly.

This safeguard is critical because it allows people to provide solutions to problems that reflect their unique point of view. It is also a different manner of contributing in society than voting.

To know more about freedom of speech:

https://brainly.com/question/31030676

#SPJ1

If James kill ruby and the lawyer lie to the law who is repunseble

Answers

Answer:

The lawyer is a trash bec. he is the only one that can keep the evidence and the crime. The lawyer only wants money he didnt want the true investigations...

And btw this app is trash amd the lawyer too

The lawyer is the liar

a police officer stops a car for a traffic violation. the officer conducts a legal search of the vehicle after obtaining consent from the driver. the officer discovered stolen property and a large amount of illegal prescription drugs in the car. the driver is given a choice to be charged with felony possession with intent to deliver a controlled substance or cooperate with the police to identify and arrest the source of the drugs. what process is the officer using?

Answers

A police officer stops a car for a traffic violation and conducts a legal search of the vehicle after obtaining consent from the driver. the process is known as flipping.

Flipping is a strategy by which law enforcement turns a suspect into an informant to acquire data and make more arrests. In the hypothetical situation, the motorist is offered the option of working with law enforcement to find and apprehend the source of the narcotics or facing substantial criminal charges.

In exchange for their help, drivers who collaborate with the police become their informants and may receive a less sentence or other rewards. While flipping can be a useful tool for law enforcement, there are still doubts regarding its moral implications and the possibility of putting informants in peril or having them give false information.

Read more about traffic violation on:

https://brainly.com/question/28301000

#SPJ4

when government agents are lawfully executing a warrant they:

Answers

When government agents are lawfully executing a warrant they must strictly adhere to the terms of the warrant.

What is a warrant?A warrant is a document issued by a court that authorizes government officials to perform certain actions. Warrants are typically granted to enable searches, seizures, or arrests in criminal cases.The Fourth Amendment to the United States Constitution guarantees the right to be protected against unreasonable searches and seizures. Law enforcement officials must, therefore, obtain a warrant in order to search or seize any person, place, or object, unless an exception to the warrant requirement exists.Therefore, it is important for government agents to strictly adhere to the terms of the warrant when lawfully executing a warrant to protect the constitutional rights of individuals.

To know more about warrant  visit:

https://brainly.com/question/33239116

#SPJ11

On the first day of Richard Skelton's trial for
drug distribution, Ed Pitts approached deputy
Fox in the Fairfax County Courthouse. Ed told
deputy Fox that he would pay Fox $5,000. if Fox would not go into the rest room with Richard, the prisoner, during the first recess called in the
trial. Ed told the deputy that while in the rest room, Richard would climb out the window,
where Richard's girlfriend would be waiting with
a car. Ed would most likely be charged with:

A. corruptly influencing a defendant.

B.attempting to embezzle an officer of the court

C. bribery

D.tampering with an officer.

Answers

Answer:

shakti Jayne Snell is eight Jersey hawk

Which of the following is not a FCC principle for EMS related responsibility?

Answers

Answer:

hhhhhkskskskskskisssss

which is not a federal cabinet department?
a. Homeland Security
b. veterans Affairs
c. Energy
d. Foreign Relations

Answers

Answer:

c

Explanation:

The 15 executive department heads make up the Cabinet, an advisory body. The members of the Cabinet are frequently the President's closest allies and are chosen by the President and ratified by the Senate.

Thus, Option C is correct.

Which three Cabinet roles are the most crucial?

The vice president and the chiefs of the 15 executive departments make up the Cabinet today. There are currently seven additional posts that fall under the category of "cabinet-rank," including the White House chief of staff, EPA administrator, and US ambassador to the UN.

The four original Cabinet positions—Defense, State, Treasury, and Attorney General—remain the most crucial and are sometimes referred to as the "inner Cabinet," according to Andrew Rudalevige, a professor of government at Bowdoin College in Maine. These positions are also known as the "inner Cabinet."

For more information about federal cabinet department refer to the link:

https://brainly.com/question/11202591

#SPJ2

Which of the following are benefits of being a judge?

Answers

Answer:

well, since you didnt provide any answers, i will just have to use the internet.

info found at

https://blog.classesandcareers.com/advisor/the-life-and-work-of-a-judge/#:~:text=Benefits%20of%20being%20a%20judge&text=Most%20salaried%20judges%20receive%20insurance,be%20sued%20for%20official%20conduct.

learn more at

https://brainly.com/question/18074483

Which of the following are benefits of being a judge?
1 )judge have high levels of responsibility and power.
2)judges can make our world a little bit fairer by their judgment .
3) judges earn good money as a judge .
4) judges can have insurance ,health,life and dental benefits .
5)judges cannot be sued for official conduct .
This are just a few points I hope it helps

what is required for all automated criminal history system (achs) inquiries via the california law enforcement telecommunications system (clets)

Answers

Answer: Your welcome!

Explanation:

In order to make an ACHS inquiry via CLETS, you must have a valid CLETS terminal operator certificate and a valid ACHS inquiry authorization number. The terminal operator certificate is issued by the California Department of Justice (DOJ) and is required to access the CLETS system. The ACHS inquiry authorization number is issued by the DOJ and is required to access the ACHS system. These two items are necessary in order to make an ACHS inquiry via the CLETS system.

The power to sue, notification requirements, public comment periods, and responses to comments are _______.
Group of answer choicesReflections of the "privileged position" of the public under CEQA
Steps in the process mandated by key court cases
NEPA regulations required under CEQA
Items required in an EIR that are not required in an ND or MND

Answers

The energy to sue, notification necessities, public remark durations, and responses to comments are reflections of the "privileged role" of the public below CEQA.

(California Environmental Quality Act), CEQA is a country law in California that ambitions to protect the surroundings and sell public participation in the selection-making process for tasks that can have full-size environmental influences. These factors are all necessary components of CEQA's framework to make sure transparency and accountability.

The energy to sue lets people and companies assign tasks that they believe violate CEQA requirements. Notification requirements make sure that potentially affected events are knowledgeable approximately proposed initiatives and have the possibility to participate in the process.

Public comment durations offer a platform for the general public to express their perspectives, issues, and guidelines regarding the undertaking's environmental effects. Responses to feedback ensure that undertaking proponents deal with the remarks acquired during the public comment period.

Together, those factors empower the public, recognizing their proper to be concerned in decisions that can impact their environment and excellent existence. They contribute to CEQA's aim of fostering knowledgeable decision-making and promoting environmental stewardship via public engagement.

To know more about CEQA,

https://brainly.com/question/31459504

#SPJ4

An acceleration clause is sometimes added to reverse mortgages. This means that the loan could become due and payable under certain circumstances, which may include all but which of the following?
A. A new owner is added to the title
B. The borrower adds MIP to the loan
C. New debt against the home is taken out
D. All or part of the home is rented out

Answers

Answer:

the borrower adds MIP to the loan

when the congress investigates federal agencies to make sure that they are following us laws, it is exercising its

Answers

The answer is: the oversight function

when the congress investigates federal agencies to make sure that they are following us laws, it is exercising its oversight function.

Congress is using its oversight power when it looks into federal agencies to make sure they are abiding by American laws. The legislative branch's crucial role in ensuring executive branch accountability and transparency is Congressional oversight. Through oversight Congress is able to look over and assess how federal agencies are run, what programs and policies they have and whether they are upholding the law and effectively serving the public interest.

This may entail holding hearings requesting papers and data, speaking with witnesses, and generating reports. Through oversight Congress is able to spot any potential wrongdoing, inefficiencies or opportunities for improvement within the federal government and take the necessary steps to address any problems that may arise.

learn more about oversight power here

brainly.com/question/33593160

#SPJ2

5. Which of the following has the ability to alter Authority Removal laws?
A. Commercial vehicle involvement
B. Motorcycle involvement
C. Fatalities
D. Unattended vehicles

Answers

Unattended cars are one of the following that can change the regulations governing authority removal. Thus, choice (D) is the right one.

What is meant  by the law of removal?

Law 169 After providing him with a reasonable opportunity to be heard, a company may dismiss a director by ordinary resolution who is not a director appointed by the Tribunal under section 242 before the end of his term of office:

With the caveat that nothing in this subsection will apply if the firm chooses to use the section 163 option that allows it to appoint at least two-thirds of the total number of directors in accordance with the proportional representation concept.

The board of directors may remove a director before their term of office expires by ordinary resolution adopted at a general meeting of the company's members,

Learn more about Law of Removal , from :

brainly.com/question/15394717

#SPJ9

in the text of this scenario explain how a structural barrier may challenge amash's political success as an independent

Answers

idjsjsjwjajaahahahjdjsjs

before a court can exercise jurisdiction over a defendant, the court must have proof that the defendant was properly notified of the lawsuit. delivering the summons and complaint to the defendant is referred to as:

Answers

Before a court can exercise jurisdiction over a defendant, the court must have proof that the defendant was properly notified of the lawsuit. Delivering the summons and complaint to the defendant is referred to as: the service of process.

The service of process is the procedure by which a party to a lawsuit is provided with legal notice of a case against them, including the summons and complaint. This involves the physical delivery of these documents to the defendant or to someone else who is authorized to receive service on their behalf.

Service of process is a crucial step in initiating legal proceedings and is necessary to establish the jurisdiction of the court over the defendant. Without proper service, the court cannot proceed with the case, as the defendant must have the opportunity to respond to the allegations made against them.

To know more about jurisdiction, refer here:

https://brainly.com/question/10377896#

#SPJ11

o conveys to a and his heirs as long as the property is not used for commercial purposes, otherwise to b and his heirs.

Answers

Based on the information provided, it seems that there is a legal agreement or deed in which the owner of the property, represented by "o," has conveyed ownership of the property to two parties: "a" and "b," and their respective heirs. However, there is a condition attached to this conveyance, namely that the property can only be used for non-commercial purposes.

If "a" and their heirs continue to use the property for non-commercial purposes, they will retain ownership. However, if they decide to use the property for commercial purposes, ownership will automatically transfer to "b" and their heirs. It is important to note that this type of arrangement is known as a "conditional conveyance" and is often used in real estate transactions to ensure that the property is used for a specific purpose or in a particular way.

In this case, the terms you've mentioned are: O, A, B, commercial purposes, and heirs. O conveys the property to A and his heirs, but with a specific condition: the property must not be used for commercial purposes. This condition needs to be respected by A and his heirs to maintain ownership of the property. If the condition is violated, meaning the property is used for commercial purposes, the ownership will transfer to B and his heirs.

This type of conveyance ensures that the property remains in non-commercial use, and if not, it will be passed on to the designated alternative owner (B and his heirs).

To know more legal agreement, refer here:

https://brainly.com/question/4702081#

#SP11

1. What are some examples of growing political radicalism in the US?


2. What is the difference between patriotism and nationalism?

Answers

1.White Supremacy
2.Patriotism is the feeling of commitment or attachment to a country,nation or political community where as a nation is a community filled with a large amount of people.

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Answers

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

LOOK AT THE PICTURE ATTACHED!!

LOOK AT THE PICTURE ATTACHED!!

Answers

Answer:

40%9:14pm

Which of the following is correct?

Merry buys stocks for $3,000 and sells them

a year and a half later for $7,000.

Merry has to pay short-term capital

gains taxes on $3,000.

Merry has to pay long-term capital

gains taxes on $4,000.

Merry has to pay long-term capital

gains taxes on $7,000.

CLOSE

True or False. if an appellate court concludes that the trial court's ruling was incorrect and remands the case, the appellate court will conduct the new trial or hearing.

Answers

The statement you indicate is false: an appellate court does not conduct new trials or hearings. Instead, if an appellate court concludes that the trial court's ruling was incorrect and remands the case, the trial court will conduct the new trial or hearing.

What is the appellate court?

An appellate court is a higher court that reviews the decisions of lower courts, such as trial courts.

If an appellate court finds that the trial court made an error, it may remand the case, which means sending it back to the trial court for further proceedings.

However, the appellate court does not conduct the new trial or hearing itself. Instead, the trial court will conduct the new trial or hearing in accordance with the appellate court's instructions.

Another question of appellate court in https://brainly.com/question/29614649

#SPJ11

Dirty headlight lenses are safe and do not cut the amount of light your headlight emit by as much as 90

Answers

Answer:

What type of headlight lens can cut the amount of light it emits by 90 percent? Low beam Keep headlights clean Dirt on the lenses can reduce the light by percent?

Explanation:

The plastic lenses that commonly cover headlight bulbs become cloudy and hazy over time, reducing the amount of light illuminating the road.

Mens rea examines the state of whose mind?
O The Defendant
O The Victim
O The Prosecutor
O The Witness

Answers

the defendant, it refers to criminal intent. it means “guilty mind” in latin.

Some scientists are studying the frogs in a pond near a factory. The factory has been known to dump old chemicals in a gutter that sometimes leaks into the pond. The scientists suspect that the chemicals may be causing the frogs to die before they can lay eggs. They decide to compare the frogs in this pond to the frogs in a pond with clean water.

If you were one of these scientists, what might be your hypothesis?

Answers

Due to the information given, I can conclude that the old chemicals being dropped into the gutter are killing the frogs!
This is because their is a major possibility gutter water or whatever is sucked into the gutter can leak into a pond. Any chemical uses would be the first thing to kill a frog just like any overdose of medicine or poison could be harmful to a human.

Here's the sample response:

If the first pond contains chemicals, then it will have fewer frogs because the chemicals will kill the frogs before they can lay eggs.

Here's my response that will get you a 100%:

If the first pond contains chemicals, less frogs will be present because the chemicals can destroy the frogs until they can lay eggs.

Limited partners are best described as:

Question 1 options:

Investors in a partnership


Partners that make only a limited financial contribution


Partners in a general partnership


Partners that receive a smaller portion of the partnership’s profits

Answers

Limited partners are best described as partners that make only a limited financial contribution to a partnership. option b is correct option.

Limited partners are investors who provide capital to a partnership but do not take an active role in the management of the business. In a limited partnership, there are both general partners, who manage the business and are personally liable for the partnership's debts, and limited partners, who are passive investors and have limited liability for the partnership's debts. Limited partners typically receive a portion of the partnership's profits, but this portion is smaller than what the general partners receive. The limited partners' liability is limited to the amount of their investment in the partnership.

For such more question on financial

https://brainly.com/question/13999832

#SPJ4

how many amendments have been approved? according to akhil amar, have most amendments improved the constitution?

Answers

There have been 27 amendments approved to the US Constitution.

According to Akhil Amar, some amendments have improved the Constitution while others have had unintended consequences. For example, the 14th Amendment expanded rights for African Americans but also led to the development of the doctrine of "corporate personhood" which has been controversial.

Overall, Amar believes that the Constitution is a living document that must adapt to changing times and societal norms, and some amendments have been successful in achieving this while others have fallen short.

To know more about societal norms  click on below link:

https://brainly.com/question/1278457#

#SPJ11

a property owner who owns his property in fee simple does not have to abide by zoning regulations. group of answer choices true false

Answers

Owning a property in fee simple, which confers unlimited ownership, enjoyment, and transfer of interests in the real estate, does not mean that the owner will not abide by zoning regulations.  So the statement is FALSE.

The property owner must abide by zoning regulations, deed, or subdivision restrictions and covenants.  The owner must not infringe on the public welfare with the use of the property.

Otherwise, a property in fee simple means that the owner can:

do whatever he likes with the propertyuse the property sell the property to another personrent it out instead of outright saleallow heirs to inheritand ownership is not limited in time.

Thus, ownership of property in fee simple confers the highest ownership right in real estate.

Learn more about property in fee simple at https://brainly.com/question/17276804

a. Raul is in an auto accident with a delivery truck. At the hospital, he tells

his wife, Serena, that the accident was all his fault. Later, in a lawsuit for

damages resulting from the accident, the delivery company subpoenas

Serena to testify about Raul's statements at the hospital. Does Serena

have to testify against her husband? What if Raul had made the statements

to his daughter? Could she be forced to testify about those statements?

Answers

In general, spouses have a privilege not to testify against each other in criminal or civil cases in the United States (spousal testimonial privilege). Whether or not the privilege applies would depend on the jurisdiction and the specific circumstances of the case.

As for Raul's daughter, there is typically no testimonial privilege between a parent and a child. So, she could be compelled to testify about the statements made by her father.

The duty of loyalty, which is the other main fiduciary obligation in addition to the duty of care, tries to stop directors from seeking to act against the company's best interests.

To establish liability for negligence, the plaintiff must show that the defendant owes them a duty of care. The plaintiff must then provide evidence of the defendant's negligence.

For such more question on civil cases

https://brainly.com/question/29535273

#SPJ4

a. What happened in this case? Why was Atkins given the death penalty?

b. Based on the opinions, what are the strongest arguments for upholding the state Supreme Court decision? For reversing it?

c. How should this case be decided? Explain.

d. Assume the U.S. Supreme Court decides to overturn the Virginia Supreme Court decision. Now assume the Court is presented with a case where a 15-year-old is convicted and sentenced to death in a state that allows such sentences for juveniles. If that case is appealed to the U.S. Supreme Court, how might the justices analyze it?

a. What happened in this case? Why was Atkins given the death penalty?b. Based on the opinions, what

Answers

Daryl Atkins and his accomplice abducted Eric Nesbitt, robbed him, forced him to withdraw cash from an ATM, and then shot him eight times. Atkins had a history of felony convictions. During the penalty phase of the trial, Atkins's lawyer presented evidence from a psychologist indicating that Atkins was mildly mentally disabled. The jury imposed the death penalty and the Virginia Supreme Court upheld the sentence. The case was appealed to the U.S. Supreme Court.

What are the responses to other questions?

Opinion A argues that mentally disabled individuals should be tried and punished for their crimes if they meet the legal requirements of criminal responsibility. Opinion B argues that some states have passed laws exempting mentally disabled defendants from the death penalty, but it argues that not all states have reached a consensus on this issue.

A majority of states have rejected the application of the death penalty to mentally disabled defendants. This aligns with Opinion A, which argues that the Eighth Amendment prohibits excessive punishments and that mentally disabled offenders should be spared from the death sentence. In deciding this case, the court should consider evolving standards of decency and societal consensus.

The U.S. Supreme Court ruled in 2005 that the Eighth Amendment forbids the imposition of the death penalty for crimes committed while under the age of 18. A 15-year-old sentenced to death in a state that allows such sentences for juveniles would violate the prohibition on cruel and unusual punishment for juveniles.

learn more about U.S. Supreme Court: https://brainly.com/question/18228641

#SPJ1

Another name for intelligence-led policing is ______ policing a. social b. interactive c. predictive d. reactive.

Answers

The correct option is predictive policing. The right answer to the question is option C (predictive).

Intelligence-led policing involves the use of criminal intelligence data to inform police operations and strategies. Intelligence-led policing helps the police and law enforcement agencies become more effective and efficient by enabling them to target their resources where they are most needed to prevent and detect crime. Another term for intelligence-led policing is predictive policing. Predictive policing involves the use of algorithms to analyze data, identify patterns, and make predictions about the likelihood of future crimes. Predictive policing helps the police anticipate and prevent crime before it occurs. It also helps police prioritize their resources and target high-risk areas. This solution helps police reduce crime rates and increase public safety. Predictive policing is controversial and has raised concerns about privacy and the potential for bias. However, when used correctly, it can be an effective tool for law enforcement.

To know more about crime visit:

brainly.com/question/28311530

#SPJ11

name two kinds of statutes under workers’ compensation

Answers

Two kinds of statutes under workers' compensation are Compulsory Coverage Statutes and Benefit Statutes. Workers' compensation is insurance that provides wage replacement and medical benefits to injured employees in exchange for a mandatory waiver of the employee's right to sue their employer for negligence.

Compulsory Coverage Statutes require employers to provide workers' compensation coverage. The rules and regulations for compulsory coverage vary by state, but they generally mandate that employers either purchase workers' compensation insurance or self-insure to cover potential claims. Compulsory coverage statutes ensure that employees receive adequate protection and benefits in the event of work-related injuries or illnesses.

Benefit Statutes outline the benefits available to employees suffering work-related injuries or illnesses. Benefit statutes determine the types of benefits employees are eligible for, such as medical care, temporary and permanent disability benefits, vocational rehabilitation, and death benefits for dependents in case of a work-related fatality. These statutes also establish the duration and amount of benefits employees can receive, ensuring fair compensation for injured workers.

In summary, compulsory coverage statutes require employers to provide workers' compensation, while benefit statutes define the specific benefits and compensation available to injured employees.

To learn more about workers' compensation, visit: https://brainly.com/question/30193608

#SPJ11

Other Questions
Brant Corporation manufactures two products out of a joint process Scout and Andro. The joint costs incurred are $400,000 for a standard production run that generates 70,000 pounds of Scout and 30,000pounds of Andro. Scout sells for $9.00 per pound and Andro sells for $7.00 per pound. 1. If there are no additional processing costs incurred after the splitoff point, the amount of joint cost ofeach production run allocated to Scout on a physical-quantity basis is (rounded)a. $100.000.b. $120.000.c. $280.000.d. $300,000. 2. If additional processing costs beyond the splitoff point are $1.00 per pound for Scout and $2.333333 per pound for Andro, the amount of joint cost of each production run allocated to Andro on an net- realizable-value basis isa. $320.000.b. $175.000.c. $147,350.d. ($80,000. In the U.S. population over eighteen years of age in the mid-2010s, about 12% of people had less than a high school education. In prison, however, ______ had less than a high school education. Preposition the dog jumped ___ the wall Sustainability involves not overusing resources so they will:A. Be available B. Become scarceC. DisappearD. Run out A living room will be painted blue with white trim. The ratio of the surface area between the trim and the walls is 1:10. If 2 gallons of blue paint are used for the walls , how many pints of white pant do we need for the trim? (1 gallon = 8 pints). The bus depart by 8:30 because they want to start by 9:30. What time will the bus arrive at the beach if the bus ride takes 35 minutes? 1. Find the given derivative by finding the first few derivatives and observing the pattern that occurs. (d115/dx115(sin(x)). 2. For what values of x does the graph of f have a horizontal tangent? (Use n as your integer variable. Enter your answers as a comma- separated list.) f(x) = x + 2 sin(x). you have just purchased a new dell poweredge r820 rack server. the server is equipped with four xeon e5-4650 cpus, 128 gb of ram, four 1 tb sas hard drives, and two 750-watt power supplies. you have a 21-inch lcd monitor connected to your server. you want a ups to keep your server running for up to 20 minutes in the event of a power failure. you prefer a rackmounted solution. use the ups selector tool at apc's web site (a well-known ups vendor). the ups selector is at https://www.apc/shop/us/en/tools/ups selector/. determine which model of ups will work well for this server, and state your reasons. Given the definition of EER, find the EER of an 8000 Btu/hour air conditioner that requires a power input of 1500 W. Express your answer numerically in British thermal units per hour per watt. EER = __________(Btu/hour)/W Using microbes to detoxify a site contaminated with heavy metals is an example of ______.1. bioremediation2. biotechnology3. decomposition4. epidemiology5. immunology Select three ways in which digital marketing differs from conventional marketing techniques.A. It complicates the process of sharing information.B. It helps marketers identify new target markets more easily.C. It is more expensive than conventional marketing.D. It allows for faster, more interactive communication.E. It provides a way for marketers to utilize new ways to communicate with customers. TRUE OR FALSE a key difference between type-1 diabetes and type-2 diabetes is that with type-2, insulin replacement is not used. Using the information provided, analyze the effects of Lawlor lawn service transactions on the accounting equation.May 1. Received $1,700 and gave capital to Eric Lawlor.May 2. Purchased a mower on account, $1,440.May 5. Performed lawn services for client on account, $200.May 17. Paid $60 cash for gas used in mower.May 28. Eric Lawlor withdrew cash of $300. It costs $90 to rent a car if you drive 100 miles and $140 if you drive 200 miles. Let x be the number of miles driven and y the total cost of the rental. Use this equation to find how much it would cost if you drove 394 miles. The average cost per item to produce q items is given by a(q) = 0.019 -0.6q + 16, for q> 0. What is the total cost, C(q), of producing a goods? C(q) = What is the minimum marginal cost? Marvin lives in Stormwind City and works as an engineer in the city of Ironforge. In the morning, he has 333 transportation options (teleport, ride a dragon, or walk) to work, and in the evening he has the same 333 choices for his trip home.If Marvin randomly chooses his method of travel in the morning and in the evening, what is the probability that he teleports at least once per day? Hosts A and B have a TCP connection with neither side having any unacknowledged data. Cumulative ACKs are used. Now, host A sends five TCP segments back to back to host B. The first segment has sequence number 150, the second segment 180, the thrid 220, the fourth 240, and the fifth 260. Host B receives the first, third, fourth, and fifth segments but not the second segment. If B sends an ACK in response to each segment received, what is the response by A to each received ACK?Assume that A does not have any new data to be sent beyond what is sent in the fifth segment and that the timer has not expired. to maximize total contribution margin when a constrained resource exists, produce the products with the _____ consider a european put option on a non-dividend paying stock with a current stock price of $100 and 4 years until expiration. the strike price of the option is unknown you are given that: ape(s,t) as -05 determine a numerical value for: ape(s,t) da please round your numerical answer to the nearest integer. SHOW WORK. Let K(x) = 4x + 3x. Find the difference quotient for k(3+h)-k(3) h