Answer:
C
Explanation:
c is the correct answer
explain the importance of all 3 biomolecules in general and for making ATP.
The three biomolecules that are used for making ATP are Lipids (fats) , Carbohydrates and Proteins
The biomolecules also known as biological molecules serve a wide range of activities and they vary in shape and their size . It is also considered essential to life because they help organisms develop, survive, and propagate. The biomolecules interact with one another which play a role in the development of organisms .
There are four types of biological molecules which are carbohydrates which is used as an energy source , lipids which is used for storage and support , proteins is used for supporting essential vital functions and amino acids are the developing elements that make up proteins and nucleic acids for storing genetic information .
To learn more about biomolecules
https://brainly.com/question/12299485
n your own words, describe the advantages and disadvantages of renewable energy resources.
Answer:
Some renewable resource advantages are they're replaced within our lifetime, they reduce environmental damage, produce cleaner energy, require less maintenance, and the use of local services increase. There are some disadvantages though, such as being more expensive than traditional energy sources, more unpredictable or inconsistent reliability, more difficult to generate large enough quantities, and timely to produce.
Explanation:
One advantage of renewable energy resoruces is they are eco- friendly and one disadvantage is, they are expensive to produce in large quantity.
Advantages of renewable energy resourcesRenewable energy resources have several advantages and some of them are;
They are eco- friendly (not harmful to the enviroment)They produce clean energy sourceDisadvantages of renewable energy resourcesRenewable energy has disdvantages as well, which is;
They are expensive to produce in large quantityThey are few devices to store them example, hydrogen fuel.Learn more about renewable energy here: https://brainly.com/question/79953
#SPJ2
why do scientists often use computers to run simulations
Answer:
These days, simulations are often run on computers. Scientists use simulations to answer questions, see how complex systems work, test ideas, and make predictions.
The rules that explain how the universe works, the laws of physics, have to be imported into the computer. This information is called a model.
Mark as barinliest if it helps u :)
What unique characteristic would the beetles shown below develop through biological adaptation if, over a period of
years, the bark on the trees shown became spotted?
Bark of tree
The beetles would become spotted.
The beetles would become plain.
About half the beetles would become spotted and half would not.
There would be no change.
Answer:
What unique characteristic would the beetles shown below develop through biological adaptation if, over a period of years, the bark on the trees shown became spotted The beetles would become spotted.
Hope that helps :)
Pituitary dwarfism results from a decreased secretion of.
, which in turn decreases the rate of cell division of
Answer:
Pituitary dwarfism results from destruction of the pituitary gland via a neoplastic, degenerative, or anomalous process. It may be associated with decreased production of other pituitary hormones, including thyroid-stimulating hormone (TSH), adrenocorticotropic hormone (ACTH), luteinizing hormone (LH), follicle-stimulating hormone (FSH), and GH.
Explanation:
Which statement best describes what causes an organism to change over time? Why does the sequoia tree have leaves and bark, why doesn't it look like a really big seed?
Cells gain new DNA as they grow, so as the DNA changes, it gets the new instructions it needs to build the complex tree
All the cells of the sequoia tree have the same DNA, but different genes on the DNA are expressed (or turned on), creating specialized cells
All the cells of the sequoia tree are unique and have different DNA, you have billions of cells, each with different instructions to turn into a complex organism
We have between 20-200 different types of cells each with its own DNA. Those different cells divide and spread their different DNA to various types of the body
Both A and D
The statement that best describes what causes an organism to change over time is Cells gain new DNA as they grow, so as the DNA changes, it gets the new instructions it needs to build the complex tree.
What is DNA?Deoxyribonucleic acid (DNA) is described as a polymer composed of two polynucleotide chains that coil around each other to form a double helix.
In a cell, we have between 20-200 different types of cells each with its own DNA. Those different cells divide and spread their different DNA to various types of the body.
Learn more about DNA at: https://brainly.com/question/16099437
#SPJ1
I will give brainliest
Convoluta worms hatch in early spring. They crawl about in the mud feeding on algae, which find their way into the skin of the worms. There they prosper as they worms feed on the sun-warmed surface mud.
The worms become greener and greener as they mature. Gradually their mouths seal shut, leaving only an internal garden of algae to provide them with food. As winter approaches, their food supply is exhausted, and the worms grow pale again. They lay their eggs in the mud just before they starve to death.
How do you think both worms and algae benefit from this relationship? WHY??
Answer:
can u give brainliest?? :))
Explanation:
Answer:
xfhgfff
Explanation:
How would you explain the key concepts for the CWA in less than two minutes?
Answer:
Explanation:
vPoint Source - a source of water discharged to surface water through a discrete point - generally through a pipe, ditch, or channel.
Nonpoint Source - Nonpoint sources, such as parking lots or athletic fields, discharge runoff water to groundwater or surface water; runoff does not come from a pipe, ditch, or channel. These sources may contain pollutants such as pesticides, motor oil, and soaps.
Navigable Waters of the United States For the purposes of the Clean Water Act, the term "navigable waters" includes:
all waters used in commerce, including groundwater;
all interstate waters including wetlands, mudflats, and sand-flats; and
all other waters such as lakes, rivers, streams, wetlands and sloughs.
EPA policy states, "The majority of facilities in the U.S. have the potential to discharge to navigable waters." The Supreme Court decision in (2006) requires the Army Corps of Engineers and the EPA to determine whether there is a "significant nexus" between a navigable waterway and an area a spill might affect. In June of 2007, EPA and the Army Corps of Engineers released provisional interpretive guidance regarding the "significant nexus” question. According to this guidance, the agencies will assert jurisdiction over traditional navigable waters, wetlands adjacent thereto, and relatively permanent tributaries thereof. The agencies will generally not assert jurisdiction over swales and ditches that lack routine water flow. Finally, the agencies will apply the "significant nexus" requirement and make a case-by-case, fact-specific analysis on impermanent tributaries and other wetlands.
Additional executive orders were issued 2015 in 2019. Under the 2019 proposal, traditional navigable waters, tributaries to those waters, certain ditches, certain lakes and ponds, impoundments of jurisdictional waters, and wetlands adjacent to jurisdictional waters would be federally regulated. It also details what are not "waters of the United States," such as features that only contain water during or in response to rainfall (e.g., ephemeral features); groundwater; many ditches, including most roadside or farm ditches; prior converted cropland; stormwater control features; and waste treatment systems.
Could the requirement for one or more NPDES Discharge Permit apply to my campus?
If your campus discharges pollutants directly to navigable waters of the United States through a point source, you must obtain an NPDES permit or redirect the flow of the waste.
Stormwater releases from certain activities require an NPDES permit. The most common activities on college campuses requiring NPDES permits for stormwater are construction activities disturbing more than 1 acre, hazardous waste storage areas operating under the Resource Conservation and Recovery Act permit system, steam-generating power plants, and airports. See Stormwater section below.
Regulations issued by local water authorities, or Publicly Owned Treatment Works (POTWs), not NPDES permits, govern discharges into sanitary sewer systems. See Sewer Use (POTW) section below for more information about requirements for using POTWs for commercial or industrial waste disposal.
What do I have to do related to NPDES Discharge Permits?
Determine where wastewater flows from buildings and processes on your campus. Any industrial or commercial operation (e.g., ice rink melt pits, floor drains, and vehicle wash stations) that discharge into a water of the United States may require an NPDES permit. If required, you must obtain such a permit from the appropriate regulatory agency, probably your state environmental agency.
French drains, dry wells, and septic system leach fields are different from point source discharges because they do not immediately affect surface water. Some state and federal environmental agencies manage these systems under the Underground Injection Control program, part of the Safe Drinking Water Act. See Safe Drinking Water Act for more information.
Details of NPDES
The unit discusses the problems with deforestation. What other problems could the extreme environmental damage caused by the kind of mining done in the Appalachians create?
I'm not sure if anyone can help me with this one, but if you can that'd be great! I have to write in the answer but I'm just looking for an idea. Thank you!
Answer:
Mining in the Appalachians has caused debris and harmful chemicals to land in the local waterways. The large amount of waste and dirt has also changed the course of the canals.
Explanation:
I took a majority of the information from a quiz prior to this assignment. I know that this is several days after you requested help but I hope that this helps you and other students!
A group of researchers are studying stem length inheritance in the garden pea plant (Pisum sativum). They obtain a tall pea plant of unknown ancestry, allow it to self-pollinate, and collect 80 of its seeds. After planting the seeds, they observe the growth of 61 tall plants and 19 dwarf plants. Which of the following best explains the stem lengths seen in the offspring?
A. Stem length is inherited through incomplete dominance.
B. Dwarf stem length is a recessive trait.
C. Stem length is a sex-linked trait.
D. The tall plants likely received more nutrition than the dwarf plants.
Answer:
The answer is B
Explanation:
just cause lol
The study of a living being is called biology.
The correct answer is B.
The characters in the plant are controlled by the genes which are present on the chromosome. The genes are always present in pairs and a single gene is known as an allele. The alleles are as follows:-
DominantRecessive.According to the question, most of the offspring are tall in height due to the dominant allele while the number of the dwarf plant is less as this character is shown by the recessive genes.
The dominant plant suppresses the character of a recessive gene and hence the number of the dominant plant is always more.
Hence, the correct answer is B. Dwarf stem length is a recessive trait.
For more information, refer to the link:-
https://brainly.com/question/14698383
(L1) The plasma membrane of a cell is selectively permeable (or semi-permeable), which means it
A.controls all cellular activities.
B.is responsible for asexual reproduction.
C.allows some materials to pass.
D.has a carbohydrate foundation,
Answer:
C. Allows some materials to pass.
Explanation:
Answer:
c
Explanation:
Being selectively permeable means that it selects what comes in and what goes out.
Which rock sample would be older, one with
75% parent isotopes or one with 30% parent
isotope?Why?
The rock sample with 75% parent isotopes would be older than the one with 30% parent isotopes because it has had more time for the radioactive decay to occur that is mentioned in Option A.
What is radioactive decay?Radioactive decay is the process by which the nucleus of an unstable atom spontaneously transforms into a more stable nucleus by emitting particles and/or energy. This transformation changes the number of protons and/or neutrons in the nucleus, creating a different element or isotope, and when a rock is formed, it contains a certain amount of parent isotopes but no daughter isotopes. As time passes, the parent isotopes decay into daughter isotopes, and the ratio of parent to daughter isotopes changes.
Hence, the rock sample with 75% parent isotopes would be older than the one with 30% parent isotopes that is mentioned in Option A.
Learn more about radioactive decay here.
https://brainly.com/question/1770619
#SPJ9
question is incomplete, complete question is below
Which rock sample would be older, one with
75% parent isotopes or one with 30% parent
isotope?Why?
A)sample with 75% parent isotopes would be older, has had more time for the radioactive decay
B)as time lacks
which of the following is the place where proteins are made
May I have help on This question please I’ll give you brainliest no links or I will report you
Option B. Pour the drinks into the plain paper cups as blind trials.
A sort of scientific trial wherein neither the contributors nor the researcher is aware of which remedy or intervention participants are receiving till the clinical trial is over. This makes the consequences of the study much less probably to be biased. The blind trials is a test of belief and verbal exchange. a group is blindfolded and then led around the path beneath the instruction of one or more people.
A blind trial examination is one in which neither the individuals nor the experimenters recognize who's receiving a particular treatment. This manner is applied to prevent bias in studies results. Double-blind research is especially beneficial for stopping bias because of the call for traits or the placebo impact.
Learn more about the blind trials here:-https://brainly.com/question/9292513
#SPJ1
How does the current affect plankton and nekton life?
Answer:
Advection by ocean currents modifies phytoplankton size structure at small scales (1–10 cm) by aggregating cells in different regions of the flow depending on their size. This effect is caused by the inertia of the cells relative to the displaced fluid
which compound is produced during regeneration
Answer:
RuBP
Explanation:
Ribulose 1,5-bisphosphate (RuBP) is an organic substance that is involved in photosynthesis. It is a colourless anion, a double phosphate ester of the ketopentose (ketone-containing sugar with five carbon atoms) called ribulose. Salts of RuBP can be isolated, but its crucial biological function happens in solution.
3. In the diagram below, which cells are involved in the process of reproduction?
cells 1 and 2
O cell 3, only
Ocells 2 and 3
Ocell 1, only
O
A Linear+Equations.pdf
Lineart Equations
1
2
3
Human reproduction depends heavily on the development of sex cells: A sperm cell and an egg cell mate during fertilization. Reproductive cells or gametes are other names for these sex cells. Male testicles and female ovaries both generate sperm and egg cells, respectively.
How are sex cells made (meiosis)?Human reproduction depends heavily on the development of sex cells: A sperm cell and an egg cell mate during fertilization. Reproductive cells or gametes are other names for these sex cells. Male testicles and female ovaries both generate sperm and egg cells, respectively. Sex cells are unique from other cells because, to put it simply, they only contain half of the genetic information that exists in the human genome. A complete set of genetic information is once again transferred when a sperm cell fertilizes an egg cell.Meiosis, a specific type of cell division, is the process through which sex cells are created. The original (parent) cell's genetic material is divided up twice, in contrast to the way that cells normally divide (mitosis).To Learn more About sex cells Refer To:
https://brainly.com/question/1470865
#SPJ1
What is the role of ATP in transport across a cell membrane?O ATP is an energy molecule that helps with active transport.O ATP is an enzyme that speeds up chemical reactions in the cell.O ATP is an amino acid that is used to build transport proteins.O ATP is a carrier protein that transports substances across the cell membrane.
The correct option is the first one "ATP is an energy molecule that helps with active transport." ATP refers to "Adenosine Tri-Phosphate" which is a pretty useful molecule in every physiolocal issue of every cell. Therefore, it is very important with active transport. When ATP losses one of its phosphates (remember it has three) -it becomes ADP- it releases a high amount of energy which is useful for several processes, among them, active transport.
Help needed!
The virus cannot pass through the cell wall, so in order to infect The cells, the viruses have to be smaller than a
A. Pore
B. Vacuole
C. Nucleus
D. Ribosome
Answer:
i would say its C
Explanation:
hope it helps sorry if im wrong
The cost of environmental regulations is often passed on to the consumer or taxpayer. True or False
Answer:
false
Explanation:
it is the goverment's job not consumer of taxpayer
Mark this and return
How is energy related to the change of state
represented by the model?
O Atoms gain energy as a gas changes to a solid.
Atoms gain energy as a gas changes to a liquid.
Atoms lose energy as a gas changes to a solid.
Atoms lose energy as a gas changes to a liquid.
The energy is related to the change of state represented by the model by: D. Atoms lose energy as a gas changes to a liquid.
What is Atoms?A model of the transition from a gas to a liquid is shown in the accompanying image. It demonstrates how atoms or molecules change from being widely scattered as in a gas to being concentrated as in a liquid.
The atoms in this process move from a higher-energy state to a lower-energy state releasing or losing energy in the process. The most common kind of energy loss is heat.
Therefore the correct option is d.
Learn more about Atoms here:https://brainly.com/question/17545314
#SPJ1
What happens to the products of the Krebs cycle?
Answer:
pyruvate is broken down in a series of reactions to form CO2
Explanation:
what is the historical evidence on file for fossils
Answer:
Fossils are crucial evidence for evolution because they demonstrate how life on Earth used to be different from how it is now. Paleontologists can use radiometric dating to estimate the age of fossils and categorize them to discover the evolutionary connections between creatures.
Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.
Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.
Methionine can be abbreviated as Met.
The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.
We can use the codon chart to determine the amino acid sequence.
The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.
Each codon codes for a different amino acid.
For example, the codon AUG codes for the amino acid methionine.
To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).
Then we write down the amino acid sequence for the codons we read, using the codon chart.
Here, the sequence starts with AUG, which codes for methionine.
After that, the next codon is UAA which is a stop codon, so we can stop.
The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).
For more such questions on Methionine
https://brainly.com/question/29481268
#SPJ8
1: Can The environment determines all physical features on plants?
2: Can The environment can affect physical features on plants?
No links!!!
Answer: When said that he was the one
Explanation: the first sentence is the nice loot
In humans, the presence of freckles is a dominant inheritance, and their absence is a recurrent trait. The shape of the eyebrows is also a hereditary characteristic, the separate eyebrows being a dominant characteristic, and the joined eyebrows being a recurring character. In a couple, the woman has freckles and separate eyebrows, and she is heterozygous for both characters. The man does not have freckles, but he has eyebrows closed. How likely is their child to have freckles and separate eyebrows? Use a tree diagram or a Punnett square to justify your answer.
When crossing a woman -who is heter0zyg0us for freckles and shape of eyebrows- with a man -who is h0m0zyg0us recessive for both traits-, the likelihood of their child to have freckles and separate eyebrows is 1/4 = 25%.
-------------------------------------------
Available data:
Two diallelic genes ⇒ One of them codes for freckles and the other one for the shape of the eyebrows.Freckles ⇒ Dominant allele F ⇒ Codes for freckles.⇒ Recessive allele f ⇒ No freckles.
Eyebrows shape ⇒ Dominant allele E⇒Codes for separate eyebrows.⇒ Recessive allele e ⇒ Codes for joined eyebrows.
Woman ⇒ Heter0zyg0us for both genes. She has freckles and separate eyebrows.Man ⇒ H0m0zyg0us recessive for both traits. He does not have freckles, but he has eyebrows closed.Cross: The woman with the man
Parentals) FfEe x ffee
Gametes) FE, Fe, fE, fe ⇒ woman
fe, fe, fe, fe ⇒ man
Punnett Square) FE Fe fE fe
fe FfEe Ffee ffEe ffee
fe FfEe Ffee ffEe ffee
fe FfEe Ffee ffEe ffee
fe FfEe Ffee ffEe ffee
F1) Genotype:
4/16 = 1/4 = 25% of the progeny will be heter0zyg0us for both traits, FfEe4/16 = 1/4 = 25% of the progeny will be heter0zyg0us for freckles, but h0m0zyg0us recessive for eyebrow trait, Ffee4/16 = 1/4 = 25% of the progeny will be heter0zyg0us for eyebrow trait, but h0m0zyg0us recessive for freckles trait, ffEe 4/16 = 1/4 = 25% of the progeny will be h0m0zyg0us recessive for both traits, ffee.
Phenotype:
4/16 = 1/4 = 25% of the progeny will have freckles AND separate eyebrows, FfEe4/16 = 1/4 = 25% of the progeny will have freckles AND closed eyebrows, Ffee4/16 = 1/4 = 25% of the progeny will not have freckles AND will have separate eyebrows, ffEe4/16 = 1/4 = 25% of the progeny will not have freckles AND will have closed eyebrows, ffee-----------------------------------------------
Related link: https://brainly.com/question/24675464?referrer=searchResults
You will pretend you are a cell looking for a job in the human body. You will wrtite a resume, to advertise all of your skills, you must adress the functions of the organelles listed below for either the plant or animal cell.
The question wants the elaboration of a "curriculum" for a spefic cell highlighting the function of each organelle that the cell have.
The chosen cell was Animal Cell.
Animal cells are eukaryotic, enclosed by a plama membrane and with nucleus and organelles in they structure. Unlike the eukaryotic cells of fungus and plants, these cells do not have a cell wall, being the size range quite variable, as the animal kingdom has individuals of various sizes and shapes. The animal cells have multiple organelles that are responsible for the cell function, below will be described the organelles and their functions for cell survival and work:
- Cell membrane: the cell membrane acts as a barrier between the extracellular and intracellular environment, it is selectively permeable membrane that controls the entry and exit of materials (nutrients, molecules, toxic elements, etc). All the parts of the cells are enclosed by the cell membrane;
- Cytoplasm: Is where all the organelles of the cell are, being the intrecellular environment. The functon of cytoplsm is to maintain the shape of the cell (cytoskeleton and cytosol, respectively the network of filaments that give the cell shape and the gel-like fluid whithin the cell);
-Nucleus: the nucleous is the "brain" of the cells, it directs whats heppens. The nucleous contains the genectic information (DNA) that provides information required for the makiing of proteins that controls cells activities, like growth and cells division;
-Nucleolus: Is the most conspicuous domain of the eukaryotic cell. The main function of this organelle is the synthesis of RNA and ribosome genesis;
-Nuclear Membrane: Is the membrane that separates the nuclear content from the cytoplasm, acting similar to the plasma membrane;
-Endoplasmatic Reticulum (smooth and rough): The ER is where the protains are made. It is a network of membranes within the cytoplasm and are divided in two (smooth and rough). The smooth ER is in charge of several process including the synthesis of lipids, production of steroids hormones, and getting rid of toxic products for the cells. The rough ER have in the structure of the organelle tubules, cisternae, and vesicles, playing a important role in the production and processing of proteins for the cell;
-Ribosomes: They take and translate the information from tRNA that is needed to the synthesis of proteins, the ribosomes can be found attached to the rough ER or floating around the cytoplasm;
-Golgi apparatus: The Golgi apparatus acts like a "mailroom" for the cell, taking the proteins and lipids molecules that are processed by the ER and placing them into vesicles to be distributed in the cell or to the extracellular environment;
-Mitochondria: The mitochondria acts like the energy supplier for the cell, the function of this organelle is to take nutrients and produce the enregy needed to power the biochemical reactions of the cell, the energy takes the form of ATP that is used as a "rechargeable battery" for the cell;
-Vesicles: that organelles can help transport materials in the cytoplasm from a point to another and can work like lysosomes for the transport of toxic elements and waste;
-Lysosomes: they are membrane-bound organelle that contains enzymes required for digesting and reciclying cell by-products, as also getting rid of cellullar waste;
-Centrioles: centrioles produce cillia during interphase and the aster and spindle for cell division, it is a cylindrical organelle mainly made of tubulin. Cintrioles are vary important part of in the organization of the cell estructure and division, they work in the producion of proteins that are responsible to the targeting of genetic material during the cell division making possible the equal distribution of chromosomes in the daughters cells.
Qualities of a good fertilizer
1) Easily spread which will ensure in even distribution patterns
2)Capatible in particle size whether it's smooth or hard particles
3)Free from additives and contaminants
4)Can be easily applied
EXPLAINATION;
Increases yield and ensures the right amount of nutrients the plant needs
What type of muscle is found in the circulatory system?
Answer:
The heart is the pump and the vessels are the delivery and return system for the blood. Every tissue in the body, directly or indirectly, receives oxygen and nutrients from blood supplied by the cardiovascular system. The heart is a muscle. The muscle is a modified form of skeletal muscle called cardiac muscle.
Explanation:
i hope itt help you
Answer:
blood muscles are found
HELP PLEASE DO NOT GIVE ME A LINK
Answer:
Hi, threre the answer is photic zone is the answer
Explanation:
the uppermost layer of a body of water that receives sunlight, allowing phytoplankton to perform photosynthesis.
Which means it has and goes through sunlight.
Hope this helps :)