Answer:
Explanation:
The correct answer is (B) Helicase creates the replication fork; single-strand binding proteins keep the single strands from reuniting. The replication fork is established by the enzyme DNA helicase, which separates the two complementary strands of a DNA molecule
The protein that is crucial for creating and maintaining DNA replication forks is DNA helicase, which is in option A. Helicases are enzymes that unwind and separate the DNA double helix, creating the replication fork.
DNA helicase use energy from ATP hydrolysis to break the hydrogen bonds between the DNA strands, allowing for the replication process to proceed. DNA polymerases are a group of enzymes responsible for synthesizing new DNA strands during replication. They add nucleotides to the growing DNA chain, following the template provided by the parental DNA strands. DNA polymerases catalyze the formation of phosphodiester bonds between the nucleotides, resulting in the elongation of the new DNA strands. SSBs bind to single-stranded DNA exposed at the replication fork and stabilize the unwound DNA strands. They prevent the separated DNA strands from re-annealing or forming secondary structures, ensuring that the DNA template remains accessible for replication.
Learn more about DNA synthesis here.
https://brainly.com/question/30627201
#SPJ2
below is the complete question
What proteins are crucial for creating and maintaining DNA replication forks? Choose the best explanation.
a. DNA helicase
b, bacteria
c, fungi replisome
The organism has one trait that is shared with bats but not birds. Which group should he choose for the new organism and why?
The group which should be chosen is Birds because of the homologous structures, the trait shared only with bats is derived.
These are the physical structures which common ancestors share but however have different functions.
In the case of a Bird which has a common homologous with the organism depicts that the traits shared with bat is derived because it is analogous and aren't similar in structure thereby making it the correct choice.
Read more about Homologous structure here https://brainly.com/question/7904813
#SPJ1
The correct question is:
A scientist finds a new organism that may be either a bird or a bat, but it is not clear which group it belongs to. He is pretty sure that the organism has analogous structures with bats and homologous structures with birds, as suggested by genomic data. The organism has one trait that is shared with bats but not birds which group should he choose for the new organism and why?
Two genomic sequences and one mRNA sequence is available for
analysis. One gonomic sequence is the gene sequence and the other
is the promoter sequence for the gene. They have cloned and
sequenced thi
Genome sequencing is the process of arranging the nucleotide's bases- adenine, guanine, cytosine, and thymine in a DNA molecule or the genome of an organism.
The genomic sequence is the complete DNA sequence of an organism's genome. It includes both coding and non-coding regions. A single-stranded RNA called mRNA is created in the cell nucleus through transcription from DNA. From DNA, it transports genetic data to ribosomes, where it acts as a blueprint for protein production.
In your case, you have two genomic sequences and one mRNA sequence available for analysis. One genomic sequence is the gene sequence and the other is the promoter sequence for the gene. They have cloned and sequenced this.
To know more about DNA sequencing, refer:
https://brainly.com/question/28547800
#SPJ4
Complete question:
Two genomic sequences and one mRNA sequence is available for analysis. One genomic sequence is the gene sequence and the other is the promoter sequence for the gene. You have cloned and sequenced this novel (never sequenced or identified before) gene and promoter from human mammary tissue. You have also characterized the mRNA of the gene by identifying the exon/intron boundaries. After some initial database searches, you think that the gene is derived by exon shuffling between several different genes. Your job is to identify and characterize the promoter, gene, mRNA, and protein and decide if your exon shuffling theory is correct.
(c) Oxygen passes from the alveolus into the blood.
Name the part of the blood that carries the most oxygen.
Answer:
Undoubtedly, Red Blood Cells are the ones carrying the most oxygen.
16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe
The phenotype is affected by mutations 1 and 2 because in the first, the complete protein is altered, and in the second, the new amino acid may cause the protein to have altered or no function.
What is Mutation?
Mutations can happen naturally or as a result of UV rays, congenital conditions, ionic radiations, or specific free radicals.
Even with the point mutation, there is no alteration to the amino acid sequence, hence the protein will not be affected.
In mutation 1, a new nucleotide is added at codon 9, changing the whole sequence of amino acids and codons in the process, mutation frameshift.
Because a new codon was created as a result of the substitution of one nucleotide by another in mutation 2, produced a new amino acid, so Point mutation.
Therefore, in mutation 3, one nucleotide is swapped out for another, and the resulting codon codes the same amino acid as the one before it, so point mutation.
Learn more about mutation, here:
https://brainly.com/question/17130462
#SPJ4
Bones contain a soft tissue called __________ that produces red blood cells.
Bones contain a soft tissue called bone marrow that produces red blood cells. Bone marrow is a delicate tissue inside the bones that produces blood cells.
Bone marrow comprises a fatty and hematopoietic (blood-forming) layer.The bone marrow's cells are divided into two types. Red blood cells (erythrocytes), white blood cells (leukocytes), and platelets (thrombocytes) are all made up of hematopoietic cells (thrombocytes).
The second kind of cell is stromal cells, which are responsible for making and keeping the bone marrow's supporting framework. The bone marrow also houses the undifferentiated pluripotent cells that can develop into either red or white blood cells.
To know more about bone marrow visit :
https://brainly.com/question/30754540
#SPJ11
You use a cotton swab to collect bacteria from the bottom of your shoe for an experiment. Why do you need to discard the swab in a biohazard bag when finished with it? a. The cotton swab came into contact with a media plate b. Everything used in a microbiology lab goes in biohazard regardless of the luzard it presents c. The swab is now contaminated with microbes from the environment and should not be discarded with normal trash d. The swab contains a culture medium that could facilitate bacterial growth
The correct answer is c.
The swab is now contaminated with microbes from the environment and should not be discarded with normal trash. When collecting bacteria from the bottom of a shoe, the cotton swab comes into contact with various microorganisms that may be harmful to human health. Therefore, it is important to dispose of the swab properly in a biohazard bag to prevent any potential contamination of the environment. Even if the swab did not come into contact with a media plate or contain a culture medium, it still should be treated as a biohazard due to the possibility of carrying harmful bacteria.
Learn more about microbes here-
https://brainly.com/question/14571536
#SPJ11
In a process of vegetative reproduction, a plant can use its body parts to reproduce offspring EXCEPT. Stem Leaves Root Seed
Explanation:
seed: they are used in sexual reproduction .
hope this will be helpful to you. if you find it useful plz mark my answer as brainlist plzzzz.
In the process of vegetative reproduction, a plant can use its own body parts to reproduce offspring except seeds. So, the correct option is (D).
What is Vegetative reproduction?
Vegetative reproduction is defined as any type of asexual reproduction in plants in which a new plant grows from a piece or cutting of the parent plant or specialized reproductive structures, which is called vegetative propagules.
New plants are obtained without seeds in asexual reproduction which is a type of asexual reproduction in which new plants are produced from roots, stems, leaves and buds. Since reproduction occurs through vegetative parts of the plant, it is known as vegetative propagation.
Seeds are not used by the plants for vegetative propagation as it is used in sexual method of reproduction.
Thus, in the process of vegetative reproduction, a plant can use its own body parts to reproduce offspring except seeds. So, the correct option is (D).
Learn more about Vegetative reproduction, here:
https://brainly.com/question/1213600
#SPJ5
Mutations, often causing conditions like leukemia and lymphoma, are the result of a certain change in non-homologous chromosomes. This type of change is referred to as.
Translocation is the name given to this kind of change. Translocation is the transport of substances within the plant from leaves to other tissues.
When two non-homologous chromosomes exchange genetic material, what kind of mutation happens?The most frequent sort of translocations, reciprocal translocations take place when chromosomal fragments are switched between two non-homologous chromosomes. A chromosomal segment is transferred one way from one chromosome to another in a non-reciprocal translocation.
What conditions are chromosomal translocation-related?One of the most frequent types of genomic rearrangements, chromosomal translocations serve as molecular markers for a variety of malignancies. They are regarded as the main factors in the development of malignancies, particularly lymphoma and leukemia.
To know more about Translocation visit:-
https://brainly.com/question/14633219
#SPJ4
What caused the formation of the moons layer
Answer:
when an object smashed into early Earth. .Explanation: no explanation just the answer
What would happen to the size of the mountain
lion population if the deer population increased?
Answer:They will be like neon shadow
Explanation:
by mistake you set the pcr program to 17 cycles instead of the 35 cycles recommended in the manual. how will this affect your final dna concentration?
a. No effect the reaction was complete
b. Half as much DNA product as expected since half as may cycles were completed
c. Reduced DNA product by the factor os missing cycles
Reduced DNA product by the factor of missing cycles - This will be the effect in the final DNA concentration. The correct option is c.
PCR, or polymerase chain reaction, is a method of amplifying DNA by creating copies of a specific DNA segment. Each cycle of PCR doubles the amount of DNA, so if the recommended number of cycles is not completed, the final DNA concentration will be reduced.
In this case, only 17 cycles were completed instead of the recommended 35 cycles. This means that there will be a reduced amount of DNA product in the final reaction. The reduction will be by the factor of the missing cycles, which is 35-17=18. So the final DNA concentration will be reduced by a factor of 18.
Thus, c is the correct option here.
For more such questions on DNA.
https://brainly.com/question/14315652#
#SPJ11
what part of an animal cell does the outer shell membrane represent
The outer shell membrane in an animal cell represents the cell membrane.
The cell membrane, also called the plasma membrane,
The plasma membrane is a vital component that surrounds the cell, acting as a protective barrier and controlling the movement of substances into and out of the cell. It consists of a phospholipid bilayer embedded with various proteins that serve essential functions.
The phospholipid bilayer provides the foundation of the plasma membrane, with its hydrophilic heads facing the watery extracellular and intracellular environments, and the hydrophobic tails oriented towards the interior of the membrane. This structure creates a selectively permeable barrier that regulates the passage of molecules and ions.
The proteins embedded in the plasma membrane play diverse roles. Some proteins serve as transporters or channels, facilitating the movement of specific substances across the membrane.
Others act as receptors, allowing the cell to receive and respond to external signals. Additionally, there are proteins involved in cell adhesion, cell signaling, and enzymatic activities.
The plasma membrane is essential for maintaining the cell's internal environment and integrity. It regulates the exchange of nutrients, waste products, and signaling molecules, while preventing the loss of vital cellular components.
Moreover, the plasma membrane plays a crucial role in cell recognition and communication, enabling interactions with neighboring cells and the surrounding environment.
Overall, the outer shell membrane, or plasma membrane, is a dynamic structure that is fundamental to the proper functioning and survival of animal cells.
Its selective permeability and various protein components contribute to a range of cellular processes, making it a key player in maintaining cellular homeostasis and facilitating interactions with the external environment.
To know more about Shell membrane here: brainly.com/question/1768729
#SPJ11
The medial malleolus is an anatomical landmark located on the fibula.A. True B. False
The statement "The medial malleolus is an anatomical landmark located on the fibula" is False. The medial malleolus is actually an anatomical landmark located on the tibia, not the fibula.
Anatomical landmarks are defined as biologically meaningful loci that can be unambiguously defined and repeatedly located with a high degree of accuracy and precision. The relative location of landmarks provides a spatial map of the relative location of the features that the landmarks represent.
There are three body views (front, back, and side) that can help you to identify a specific body area. The labels show areas of the body which are identified either by anatomical or by common names. For example, the back of the knee is called the “popliteal fossa,” while the “flank” is an area on the side of the body.
To learn more about anatomical land marks https://brainly.com/question/10885543
#SPJ11
The medial malleolus is not located on the fibula as stated in the question but is found on the distal tibia. The lateral malleolus is located at the distal end of the fibula.
Explanation:The statement mentioned in the question is, in fact, false. The medial malleolus is not located on the fibula. It is anatomically located on the distal tibia, which is the larger, weight-bearing bone on the medial side of the leg. It forms a large bony bump found on the medial side of the ankle region. The lateral side of the distal tibia has a fibular notch that articulates with the distal end of the fibula, forming the distal tibiofibular joint. On the contrary, the lateral malleolus is actually located at the distal end of the fibula and forms a palpable bump on the lateral side of the ankle.
Learn more about Medial Malleolus here:https://brainly.com/question/32254090
#SPJ11
A human has 46 chromosomes in each body cell. How many chromosomes would be found in its daughter cells after mitosis
Answer:
Each daughter cell will have half of the original 46 chromosomes, or 23 chromosomes. Each chromosome consists of 2 sister chromatids. The daughter cells now move in to the third and final phase of meiosis: meiosis II. At the end of meiosis I there are two haploid cells.
what is a turgid cell
Answer:
turgid refers to cells or tissues that are swollen from water uptake. Many cell types in many different organisms can become turgid due to water uptake. Some cells will lyse, or split open if they become too turgid.
Answer:
Explanation: turgid refers to cells or tissues that are swollen from water uptake. Many cell types in many different organisms can become turgid due to water uptake. Some cells will lyse, or split open if they become too turgid.
2 factors that affect digestibility coefficient of oat hay
Social support ,Stress ,Sleep ,Exercise are the factors affecting digestion. Oat protein is 90% digestible, which is comparable to the percentages for rice and corn (National Research Council 1989).
Men and women digest food at different rates and in different amounts of time. It takes food between six and eight hours to move through your stomach and small intestine after you eat. After additional digestion, water absorption, and ultimately removal of undigested food, food next reaches your large intestine (colon).
What is the principal digestive process?The GI tract is moved through during digestion. Chewing triggers the start of digestion, which is completed in the small intestine. Large food molecules break down into smaller ones as they move through the GI tract and combine with digestive fluids.
Learn more about digestion.
https://brainly.com/question/29028558
#SPJ4
Full Question: What are the factors affecting digestion coefficient of oat hay?
the small bulge at the end of the axon that sends messages to other neurons are called by?
Terminal buttons are the tiny protrusions at the end of axons that communicate with neighboring neurons.
What is neuron and its function?The basic building blocks of the nervous system and brain are neurons (also known as neurones or nerve cells). Brain cells are the cells that receive sensory information from the outside world, give control signals to our muscles, and transform and relay electrical signals at each stage along the way.
What is the largest neuron?With a width of 1.1 mm, this R2 cell seems to be the biggest neuron ever captured on camera. When this cell is isolated, a record-breaking 1.965 g of total RNA was produced.
To know more about neuron visit:
brainly.com/question/6341311
#SPJ4
40 POINTS! FIRST TO ANSWER CORRECTLY GETS BRANLIEST! The image below shows a certain type of global wind: What best describes these winds? Polar easterlies caused due to sinking, cool air above the poles Polar easterlies caused due to rising, warm air above the poles Trade winds caused due to sinking, cool air above the equator Trade winds caused due to rising warm air above the equator
Answer:
Its b
Explanation:
Answer:
Polar easterlies caused due to rising, warm air above the poles
Explanation:
Got it right!
Okay gang....world's easiest assignment! CREATE YOUR OWN MED TERM! It should NOT to be a real condition. You need to use at least ONE WORD ROOT FROM CHAPTER 12. The prefixes and suffixes we know are universal. It has to have three parts! a a prefix, word root, and suffix. DEFINE EACH WORD PART (there should be a minimum of three-word parts), THEN USE THE WORD PARTS TO DEFINE THE WORD.
ONE WORD ONLY!!
BE SURE TO GIVE ME THE DEFINITION OF THE WORD PARTS, AND A DEFINITION OF THE WORD!
If you could please help me this with I don’t know barely anything about this class
Answer: please first explain the question
Explanation:
After doing an endospore staining procedure on an unknown bacteria, you looked at it under the microscope and saw the picture below. What can you conclude?Vegetative cells are present, but no endosporesEndospores are present, but no vegetative cellsBoth endospores and vegetative cells are presentThe bacilli in the photo are acid fast
From the photo, it can be concluded that there are both endospores and vegetative cells present. The endospores can be seen as smaller cells staind in blue, while vegetative celles are staind in red.
Discuss 3 ways in which building and sustaining good relationship nay impact positively on your emotional well being during lockdown
There are various ways in which building and sustaining relationships may impact positively on your emotional well-being during lockdown. Some of them are: Provides emotional support, Reduces isolation, Boosts self-esteem.
1. Provides emotional support: Building good relationships with friends, family, or peers can help you with emotional support. They can offer a listening ear, a shoulder to cry on, and words of encouragement when needed.
2. Reduces isolation: When you're locked down, you may feel isolated from the rest of the world. By staying connected with loved ones, you can reduce this feeling of isolation and feel more included.
3. Boosts self-esteem: Having strong relationships can make you feel valued, accepted, and loved, which can boost your self-esteem and self-worth.
Thus, building and sustaining good relationships can be an essential aspect of mental health and emotional well-being. It is vital to focus on strengthening relationships with loved ones during a lockdown.
For more such questions on relationships, click on:
https://brainly.com/question/28877004
#SPJ11
Economic and social changes during the Gilded Age caused
most workers to abandon labor unions.
people to stop working at many factories.
workers to seek training to get better jobs.
activists to work for a variety of reforms.
Answer:
ITS D
Explanation:
Economic and social changes during the Gilded Age caused activists to work for a variety of reforms.
What happens in Gilded age?The American Gilded Age was a period of immense economic change, great conflict between the old ways and brand new systems, and huge fortunes were made and lost.
The Gilded Age was a period of economic growth as the United States jumped to the lead in industrialization ahead of Britain. The nation was rapidly expanding its economy into new areas, especially heavy industry like factories, railroads, and coal mining.
As daunting as the political challenges were at the time, the Gilded Age came to an end with the reforms of the Progressive era and the New Deal. Those years saw countless changes in the rules of economic life as well as new taxes and social spending.
Learn more about Gilded age:
https://brainly.com/question/4419066
#SPJ6
Identify the approximate sucrose molarity of a Fuji apple.
Answer:
This is a good question....should be 0
Explanation:
Organic compounds are found only in nonliving organisms
Answer:
false
Explanation:
organic compounds can come only come from living
an individual named pat with prader-willi syndrome produced an offspring named lee with angelman syndrome. the other parent does not have either syndrome. how might this occur? what are the sexes of pat and lee?
The syndromes are caused by a small deletion in chromosome 15. The expression of the deletion is affected by genomic imprinting. If inherited from father, the offspring develops Prader-Willi syndrome. Therefore, here the person with Angelman syndrome must have been a male. And the offspring can be male or female.
Deletions are the chromosomal aberration sin which some part of the chromosome is deleted. This results in the loss of some genes causing the loss of certain traits or development of some disease.
Genomic imprinting is the phenomenon where the expression of genes depends of the fact if the gene has been inherited from the mother or the father.
To know more about deletions, here
brainly.com/question/14143212
#SPJ4
help me right a claim evidence reasoning (CER) ?
Answer:
from my opinion na ......
What if the SHH you are making needs to be accumulated in the cell so that it can be released all at once into the extracellular space at a specific time? How would you store the produced SHH? What would need to occur to release all of the SHH from storage into the extracellular space?
If SHH is to be accumulated and then released into cellular space at a specific time, it would be necessary to establish storage mechanisms and release mechanisms.
To store the produced SHH would require specialized cellular compartments.
To release all of the stored SHH, a signal or stimulus would need to trigger the release of SHH from storage into the extracellular space.
What steps would the SHH storage and release process take place?SHH production.Storage.Storage regulation.Production of the SHH release signal.SHH release.SHH is a protein that is stored within the cell and is released into the extracellular space in times of need. These processes need to work in a very regulated way in order to achieve their objectives. For this reason, well-regulated and optimized storage and release mechanisms are needed.
Learn more about extracellular space:
https://brainly.com/question/31674465
#SPJ1
Repeat the process again when one parent is heterozygous black and the other is
homozygous brown.
Genotypes:
% homozygous black fur (BB)
% heterozygous black fur (Bb)
% homozygous brown fur (bb)
Phenotypes:
% black fur
% brown fur
Answer:
genotypes:
0% homozygous black fur (BB)
50% heterozygous black fur (Bb)
50% homozygous brown fur (bb)
phenotypes:
50% black fur
50% brown fur
Explanation:
B b
b . Bb bb
b . Bb bb
which of the following hormones does not require a carrier protein for its transport in the blood? question 2 options: a) cortisol b) thyroxine (t4) c) triiodothyronine (t3) d) epinephrine e) none of the above are correct.
Option D is Correct. Epinephrine does not require a carrier protein for its transport in the blood.
A medication called epinephrine is used to treat extremely severe allergic responses (anaphylaxis) brought on by food, drug use, bug bites, or exposure to other substances.
Pharmacologically, alpha and beta-adrenergic receptors on the sympathetic nervous system are stimulated by epinephrine, also known as adrenaline. When given parenterally or intravenously, this medication acts quickly and wears off quickly.
Its quick onset (less than 5 minutes) and vasoconstriction caused by its action on alpha-1 receptors make it the medicine of choice when hypotension related to septic shock arises. The medication can help treat tightness, wheezing, and bronchospasm in anaphylaxis because its effect on beta receptors relaxes bronchial smooth muscles.
Learn more about Epinephrine here
https://brainly.com/question/30160747
#SPJ11
What operation is used when simplifying fractions and conversion units?
Answer:
cancellation
Explanation:
A factor in the numerator is cancelled by dividing it by the same factor in the denominator. The quotient is 1, the multiplicative identity element.
╭☞ What operation is used when simplifying fractions and conversion units?
ANSWER:╭☞ Cancellation
Explanation: Because factor in the numerator is canceled by dividing it by the same factor in the denominator. The quienty is 1, the multiplicative element of the identity.For More Information:
– https://brainly.com/question/17345029
– https://brainly.ph/question/10388269
– https://brainly.ph/question/5861352
– https://brainly.ph/question/2371595
______________
#BrainliestBunch