which lists the jovian planets in order of increasing distance from the sun? (a) jupiter, saturn, uranus, pluto (b) saturn, jupiter, uranus, neptune (c) jupiter, saturn, uranus, neptune

Answers

Answer 1

Jovian planets in order of increasing distance from the sun are jupiter, saturn, uranus, neptune. (C)

What are the Jovian Planets

Based on the size and composition of the constituents, planets are grouped into terrestrial planets and Jovian planets. The Jovian planet is a planet that has a very large size and its constituent composition is the same as the Planet Jupiter.

The planets included in the Jovian planets are Jupiter, Saturn, Uranus and Neptune.

Planet Jupiter is the largest planet in the solar system. The diameter of this planet is 13,000 km with an average distance to the Sun of 778.3 million km.Planet Saturn is a Jovian planet that is easily distinguished from other planets. The reason, Saturn has a ring that is characteristic. Saturn's rings are chunks of meteorite ice with 402,000 km and about 15 km thick.Planet Uranus is a planet that was discovered by William Herschel in 1781. This planet is shrouded by a thick fog which mainly consists of methane gas. Uranus can reflect sunlight so well that it can easily appear blue.Planet Neptune has a shape similar to the Moon because there is a thin layer of silicate on its surface. The composition of the planet Neptune is iron and other heavy elements. The planet Neptune has 8 satellites, including Triton, Nereid, Larissa and Proteus.

Learn more about the jovian planets at : https://brainly.com/question/17009173

#SPJ4


Related Questions

If the angle of reflection is 82 and the light ray strikes a flat mirror, what will the angle
if incidence be?

Answers

Answer:

82

Explanation:

According to law of reflection, the angle of incidence = angle of reflection

Answer:

The angle of incidence will be equal to the reflection.

Explanation:

The law of reflection states that when a ray of light reflects off a surface, the angle of incidence is equal to the angle of reflection.

So 82 would be the answer.

Question 1 12.5 pts Describe and explain two components of how wind and air pressure fluence our weather. Indicate too, whether the rotation of the earth influences each of the components you are discussing

Answers

Atmospheric circulation: The uneven heating of the earth's surface leads to differences in air pressure, creating regions of high and low pressure. This pressure gradient drives the movement of air, creating atmospheric circulation.

The rotation of the earth influences atmospheric circulation through the Coriolis effect, which causes the air to deflect to the right in the Northern Hemisphere and to the left in the Southern Hemisphere. This deflection causes the formation of large-scale wind patterns, such as the trade winds and westerlies, which influence global weather patterns. Frontal systems: Fronts are the boundaries between air masses with different temperatures, humidities, and pressures. When these air masses meet, they can create weather disturbances such as thunderstorms, tornadoes, and hurricanes. The rotation of the earth influences frontal systems through the same Coriolis effect mentioned above. The deflection of the air masses causes the formation of curved fronts, which can intensify weather systems and create complex weather patterns.

In summary, the rotation of the earth influences both atmospheric circulation and frontal systems, which are two important components of how wind and air pressure influence our weather.

For more questions like weather visit the link below:

https://brainly.com/question/15087847

#SPJ11

If u is the distance between the object and the optical centre of the lens, v is the distance between the image and the optical centre of the lens and f is the focal length of the lens; then what is the relationship among u,v and f ?

Answers

Explanation:

The relationship among u, v, and f in the context of a lens can be described by the lens formula:

1/v - 1/u = 1/f

where:

- u is the object distance (distance between the object and the optical center of the lens),

- v is the image distance (distance between the image and the optical center of the lens), and

- f is the focal length of the lens.

According to the lens formula, the reciprocal of the image distance subtracted from the reciprocal of the object distance is equal to the reciprocal of the focal length.

The planet Jupiter of mass 2x10 kg revolves around the sun of mass 2x10
kg in a circular orbit of radius 7. 8x10 m; calculate the gravitational force between
them and the orbital speed of Jupiter

Answers

The gravitational force between them and the orbital speed of Jupiter is 4.385×10^23 N and 13.081 km/s.

Mass of Jupiter, m = 2 × 10^27 kg

Mass of Sun, M = 2 × 10^30 kg

the radius of Jupiter's orbit, R = 7.8 × 10^11 m

=> distance b/w Sun and Jupiter = radius of the Jupiter's orbit = R

Gravitational force b/w them = GMm/(R^2)

= (6.67 × 10^-11)×(2 × 10^30)×( 2 × 10^27) / (7.8 × 10^11)^2

= 4.385×10^23 N

since, centripetal force = centrifugal force

=> F = GMm/(R^2) = (mv^2)/R

=> v = √(GM/R) = 13.081 km/s

Gravitational force is a fundamental force in physics that governs the interactions between massive objects. According to Newton's law of gravitation, every object in the universe exerts a gravitational force on every other object, with the strength of the force proportional to the product of their masses and inversely proportional to the square of the distance between them.

The gravitational force between two objects causes them to attract each other, with the direction of the force being along the line connecting the centers of the objects. The gravitational force is always attractive and never repulsive, and it is responsible for many phenomena in the universe, from the orbits of planets around the Sun to the motion of stars within galaxies.

To learn more about Gravitational force visit here:

brainly.com/question/11944606

#SPJ4

Complete Question:

The planet Jupiter of mass 2 x 1027Kg revolves around the sun of mass 2 x 10"kg in a circular orbit of radius 7.8 x 10''m. Calculate the gravitational force between them and the orbital speed of Jupiter.​

Aflywheel is rotating at 1200 revolution per minute and has a moment of incertia of 50 kg m² what is its angular velocity moment​

Answers

1507.96 radians per second is the required angular momentum of the flywheel

The angular velocity moment of an object

We can use the conservation of angular momentum to solve this problem:

Angular momentum = moment of inertia x angular velocity

Initially, the angular momentum is:

L1 = I1 * w1

where I1 is the initial moment of inertia and w1 is the initial angular velocity.

Finally, the angular momentum is:

L2 = I2 * w2

where I2 is the final moment of inertia (which is the same as the initial moment of inertia, since the flywheel is not changing shape) and w2 is the final angular velocity.

Since angular momentum is conserved, we can set L1 = L2:

I1 * w1 = I2 * w2

We can solve for w2:

w2 = (I1 * w1) / I2

Substituting the given values:

w2 = (50 kg m² * (1200 rev/min) * (2π rad/rev)) / (50 kg m²)

w2 ≈ 1507.96 rad/s

Therefore, the angular velocity of the flywheel is approximately 1507.96 radians per second.

Learn more on angular velocity moment here: https://brainly.com/question/30691557

#SPJ1

Phosphorus atoms are to be diffused into a silicon wafer using both predeposition and drive-in heat treatments; the background concentration of P in this silicon material is known to be 7.5 x 10^19 atoms/m^3. The predeposition treatment is to be conducted at 950 degree C for 50 minutes; the surface concentration of P is to be maintained at a constant level of 2.0 x 10^26 atoms/m^3. Drive-in diffusion will be carried out at 1200 degree C for a period of 3.0 h. For the diffusion of P in Si, values of Qd and D0 are 3.40 eV/atom and 1.1 x 10^4 m^2/s, respectively.

Required:

Determine the value of xj for the drive-in diffusion treatment.

Answers

The diffusion of phosphorus atoms into a silicon wafer involves a predeposition treatment at 950°C for 50 minutes, surface concentration of P at 2.0 x 10^26 atoms/m^3, followed by a drive-in diffusion at 1200°C for 3.0 hours.

To calculate the depth of diffusion (x) during the predeposition and drive-in treatments, we can use the equation:

x = sqrt((4 * D * t) / π)

where x is the depth of diffusion, D is the diffusion coefficient, and t is the time.

Predeposition Treatment:

Given:

Temperature (T) = 1223 K

Time (t) = 3000 seconds

Surface concentration (Cs) = 2.0 x 10^26 atoms/m^3

According to the diffusion coefficient (D)  formula:

D =( D0 * exp(-Q d / (k * T)))

where D0 is the pre-exponential factor, Qd is the activation energy, and k is the Boltzmann constant (8.617 x 10^-5 eV/K).

Substituting the values and calculating D:

D = (1.1 x 10^4 m^2/s) * exp(-3.40 eV / (8.617 x 10^-5 eV/K * 1223 K))

D ≈ 3.32 x 10^-4 m^2/s

Now, substitute the values into the depth of diffusion formula:

x = sqrt((4 * D * t) / π)

x = sqrt((4 * (3.32 x 10^-4 m^2/s) * 3000 s) / π)

x ≈ 0.029 m or 29 mm

Therefore, during the predeposition treatment, the depth of diffusion is approximately 29 mm.

Drive-In Diffusion:

Given:

Temperature (T) = 1200°C = 1473 K

Time (t) = 3.0 hours = 3.0 * 60 * 60 = 10800 seconds

Using the same diffusion coefficient (D) calculated earlier, we can calculate the depth of diffusion (x) during the drive-in treatment:

x = sqrt((4 * D * t) / π)

x = sqrt((4 * (3.32 x 10^-4 m^2/s) * 10800 s) / π)

x ≈ 0.135 m or 135 mm

Therefore, during the drive-in diffusion, the depth of diffusion is approximately 135 mm.

During the predeposition treatment, the depth of diffusion of phosphorus (P) atoms into the silicon (Si) wafer is approximately 29 mm. During the drive-in diffusion, the depth of diffusion is approximately 135 mm. These calculations are based on the given diffusion parameters and treatment conditions.

To know more about treatment, visit:

https://brainly.in/question/11692543

#SPJ11

Which type of thermal energy transfer does a wrapping of cotton or plastic reduce the most? O A. Radiation O B. Conduction O C. Convection O D. Translation​

Answers

Answer: Translation

Explanation:

Apex

Thanks

Answer:

RADIATION

Explanation:

JUST TOOK IT ON APEX

A hiker tries to prepare a hard-boiled egg on the high slopes of Mount Everest. The base camp is located 5,300 meters above sea level. The hiker observes that the water begins to boil at 82⁰C, much lower than the 100⁰C needed to cook the raw egg. He hopes that just leaving the egg in the boiling water longer will let the egg cook. Will he have hard-boiled eggs for breakfast?

Answers

Answer: :’)

Explanation:

What are energy transformations that occur from time skydriver

Answers

When a skydiver dives from an airplane, He/she from a certain height reaches the ground with a certain velocity. Thus, the conversion is from potential energy to kinetic energy

.- ¿Por qué se da ese incremento tan grande de energía de ionización requerida para retirar el segundo electrón de un átomo de sodio en contraste con el primer electrón?

Answers

Answer:

ver explicacion

Explanation:

El sodio tiene configuración electrónica 2,8,1.

Esto implica que el sodio tiene solo un electrón en su capa más externa. Como tal, cuando ese electrón se pierde, el siguiente electrón debería perderse de una capa interna llena.

Se requiere mucha más energía para perder un electrón de una capa interna llena de la que se requiere para perder un electrón de la capa más externa.

Por lo tanto, existe una brecha muy grande entre la primera y la segunda energía de ionización del sodio porque se requiere una cantidad de energía mucho mayor para eliminar un electrón de una capa interna que de una capa más externa.

give in one word answer :
combination of cell in series​

Answers

Answer:

The combination of cells in which the negative terminal of a first cell is connected with the positive terminal of second cell and the negative terminal of a second cell is connected to the positive terminal of a third cell and so on is known as series combination of cells.

Explanation:

hope this helps to u

Answer:

Battery.

Hope it is helpful....

Calculate velocity of a plane flying 1800 miles North East in 4.5 hours

Answers

Answer:

400

Explanation:

We divide time (4.5 hours) and speed (1800 miles)

1800÷45=400

If Steve throws a football 40 m and it travels for 3 seconds, what was the balls velocity?​

Answers

Answer:

13.4 m/s^2

Explanation:

40 divided by 3 equals 13.3 repeating.

If the mass of a watermelon seed is 0.1 grams, what would you estimate the mass of the avocado seed to be?

Answers

Answer:0.1

Explanation:

Seeds typically weigh the same.

Final answer:

The mass of an avocado seed can't directly be estimated based on the mass of a watermelon seed. Generally, an avocado seed is larger and heavier than a watermelon seed, often weighing around 15 grams.

Explanation:

The estimated mass of the avocado seed can't be directly determined based on the mass of a watermelon seed. The mass of a seed depends on the size, type, and species of the fruit, which varies considerably between a watermelon and an avocado. For example, an avocado seed typically weighs around 15 grams, which is significantly heavier than a watermelon seed.

However, if you are trying to compare or learn about the relative sizes and masses of different seeds, it might be helpful to know that an avocado seed is generally larger and heavier than a watermelon seed due to the size and nature of the fruit.

Learn more about seed mass here:

https://brainly.com/question/32372118

#SPJ2

Select the best option to explain why the moon is described as a time capsule for Earth’s history?

Question 4 options:

The Apollo astronauts placed a time capsule on the moon’s surface.


The moon has not experienced any changes since its formation.


The moon does not have weather to erode the evidence of asteroid impacts.

Answers

Answer:

The moon does not have weather to erode the evidence of asteroid impacts.

find the horizontal distance the skier travels before coming to rest if the incline also has a coefficient of kinetic friction equal to 0.229. assume that = 20.0°.

Answers

The horizontal distance the skier travels before coming to rest if the incline also has a coefficient of kinetic friction equal to 0.229 and assuming that 20.0° is 43.1 m.

To find the horizontal distance the skier travels before coming to rest, we first need to calculate the skier's initial velocity. We can use the formula:

v = √(2gh)

where v is the initial velocity, g is the acceleration due to gravity (9.81 m/s²), and h is the height of the incline. Plugging in the given values, we get:

v = √(2 × 9.81 m/s² × sin(20.0°) × 100 m)

v ≈ 22.0 m/s

Next, we can use the formula for distance traveled with constant acceleration:

d = v² / (2μg)

where d is the horizontal distance traveled, μ is the coefficient of kinetic friction, and g is the acceleration due to gravity. Plugging in the given values, we get:

d = (22.0 m/s)² / (2 × 0.229 × 9.81 m/s²)

d ≈ 43.1 m

Therefore, the skier travels approximately 43.1 meters horizontally before coming to rest.

Learn more about kinetic friction: https://brainly.com/question/30886698

#SPJ11

Which of the following is an example of an unbalanced force?
1.A stroller being pushed
2.A chair leaning on the wall
3.A ball on the grass
4.A book sitting on a table

Answers

Answer:

4.A book sitting on a table

Explanation:

I think it D I took the test last year

when the balloon hits the ground, it rebounds slightly. what is the source of the energy for this rebound?

Answers

When the balloon hits the ground, the rubber envelope stretches, storing elastic potential energy; this elastic potential energy is transfigured to the gravitational potential. It is a correct answer.

What is potential energy?

Stored energy that depends upon the relative stand of different parts of a system is called potential energy. A spring has more potential energy when it is stretched.

What is gravitational potential?

A position is equal to the work per unit mass that would be needed to move an item to that position from a fixed reference position is called gravitational potential.

When the balloon hits the ground, the rubber envelope stretches, storing elastic potential energy; this elastic potential energy is transfigured to the gravitational potential. It is a correct answer.

To know more about potential energy, visit:-

https://brainly.com/question/13454730

#SPJ4

how far will it go, given that the coefficient of kinetic friction is 0.17 and the push imparts an initial speed of 3.7 m/s ?

Answers

When the box is placed on a horizontal surface, it experiences a force even if it is at rest. The forces that a box encounters are gravity, frictional force, and weight.

The weight is how much?

Weight is the gravitational attraction of the Earth's centre on items. Gravity is the resultant force that draws a mass towards Earth. This only happens on Earth and a mass, as opposed to gravitational pull, which happens whenever two masses are in contact.

What is a mass?

In physics, mass is a way to measure inertia, a fundamental property of all matter. Basically, it describes the opposition a body or piece of matter offers to a change in velocity or location.

To know more about  weight visit :

brainly.com/question/10069252

#SPJ4

Light of wavelength 600 nm in air goes into a medium where the index of refraction is 1.73. What is the frequency of this light in the medium?
I need it with the given,unknowns ans equation and solution
ASAP

Answers

Answer:

5.00 × 10^14 Hz

Explanation:

The wavelength of the light in the medium can be calculated by using the formula:

λ = v / f

Where;

λ = wavelength (m)

v = speed of light

f = frequency (Hz)

From the provided information, λ = 600 nm (600 × 10^-9m), v = 3 × 10^8m/s.

λ = v / f

λ = 3 × 10^8/600 × 10^-9

λ = 0.005 × 10^(8+9)

λ = 0.005 × 10^17

λ = 5.00 × 10^14 Hz

The frequency of the light in the medium is 5.00 × 10^14 Hz

An observer notices that the sun is directly overhead at midday during the summer solstice. what is this observer's latitude upon the earth?

Answers

Answer:

At 23.5 deg north of the equator this person would see the sun directly overhead at the summer solstice at noon

723 grams to kilograms

Answers

Answer:

we know that 1 kg = 1000g

therefore ;

1g = 1/1000 kg

723g = 723/1000

= 0.723kg is answer

The answer is 0.723 kilo

If a car is traveling 27 meters in 3 seconds, what is its speed?

Answers

Answer:

9 m/s

Explanation:

speed = distance ÷ time

27÷3

=9

An air pistol fires a pellet forwards.
What is the motion of the air pistol?

A - The air pistol moves backwards with speed greater than the pellet.
B - The air pistol moves backwards with speed less than the pellet.
C - The air pistol moves forward with speed greater than the pellet.
D - The air pistol moves forward with speed less than the pellet.

Answers

The air pistol is moving backwards faster than the pellet. Subtract that stronger force's amplitude from the weaker department's magnitude to discover the centripetal acceleration.

What are a definition and an example of motion?

Motion can be characterized as a shift in an object's location with regard to time. Motion can be heard in a variety of sounds, such a book falling off a table, water running from a faucet, rattling windows, etc. There is motion even in the air we breathe!

What generates motion?

Motion is the result of forces You need to exert a push or a pull, which is by definition a force, in order to move something. The object will be static or continue going without accelerating in the absence of a force.

To know more about Motion visit:

https://brainly.com/question/22810476

#SPJ1

Please Help it is urgent! Thank you!
Study the scenario.

A person is standing on a bridge, attached to a bungee cord. The person steps off the bridge and falls down. The isolated system consists of the person, bridge, bungee cord, and the Earth, ignoring friction and air resistance. The amount of energy in the system is 18,000 J when the person is standing on the bridge. At some point during the fall, 6,000 J of energy has been transformed into kinetic energy because the person is moving. Additionally, 3,000 J of energy has been transformed into elastic potential energy because the bungee is stretching. (Air resistance is negligible.)
Which choice best describes the amount and form of the rest of the energy at this point?
Responses:
There are slightly more than 9,000 J of gravitational potential energy in the system because the person is at some position above the ground and the total energy must be slightly more than the initial energy because energy increases as it is transformed.
There are exactly 9,000 J of gravitational potential energy in the system because the person is at some position above the ground and the total energy must add up to 18,000 J because energy is always conserved.
There are exactly 9,000 J of thermal energy is the system because the person is heating up as he falls and the total energy must add up to 18,000 J because energy is always conserved.
There are slightly less than 9,000 J of gravitational potential energy in the system because the person is at some position above the ground and the total energy must be slightly less than the initial energy because energy is lost as it is transformed.

Answers

The correct response is: There are slightly less than 9,000 J of gravitational potential energy in the system because the person is at some position above the ground and the total energy must be slightly less than the initial energy because energy is lost as it is transformed.

This is because energy is always conserved in a closed system, meaning that the total amount of energy before and after any transformation must be the same. In this scenario, the initial energy in the system was 18,000 J, but only 6,000 J was transformed into kinetic energy and 3,000 J was transformed into elastic potential energy. The remaining energy must still be present in the system, but in a different form. The person is now at some position above the ground, which means that there is still some gravitational potential energy in the system. However, this energy must be slightly less than the initial energy because some energy has been lost as it was transformed into other forms. Specifically, some energy may have been lost as heat due to the stretching of the bungee cord, but this is not significant enough to account for a large portion of the energy loss. Therefore, there must be slightly less than 9,000 J of gravitational potential energy in the system.

There are slightly less than 9,000 J of gravitational potential energy in the system.

The total energy in an isolated system is always conserved. This means that the total energy at the beginning of the process must equal the total energy at the end of the process. The total energy at the beginning is 18,000 J. We know that 6,000 J of this energy has been transformed into kinetic energy and 3,000 J has been transformed into elastic potential energy. So, the remaining energy must be gravitational potential energy.

We can calculate the remaining energy as follows:

Total energy = Kinetic energy + Elastic potential energy + Gravitational potential energy

18,000 J = 6,000 J + 3,000 J + Gravitational potential energy

Gravitational potential energy =  11,000.

To know more about the Potential energy, here

https://brainly.com/question/28031336

#SPJ2


What causes the spectral shifts you observed?
• How can scientists use spectra analysis to support the Big
Bang Theory?

Answers

Spectral shifts are caused by the movement of the spectrum to shorter wavelengths, while the Big Bang Theory is supported by spectra analyses because we can determine how spectra of electromagnetic radiation from stars changes depending on their relative position.

What is the Big Bang Theory?

The Big Bang Theory is a widely accepted model in physics about the boring of the Universe, which it is believed occurred though a big explosion, while light spectra refers to the observation of the electromagnetic radiation emitted by stars.

Therefore, with this data, we can see that the Big Bang Theory obtains supportive evidence from the emission of electromagnetic spectra of stars.

Learn more about the Big Bang Theory here:

https://brainly.com/question/10865002

#SPJ1



Which action will increase the gravitational force between two objects?

A. Moving the objects farther apart
B. Removing some mass from one of the objects
C. Removing half of each object
D. Moving the objects closer together

Answers

the answer is D have a nice day!

Answer:

D. Moving the objects closer together

Explanation:

A.P.E.X.

took the quiz

The slope of a distance vs. time graph is a measurement called
A. displacement
B. speed
C. correlation
D. velocity

Answers

Answer:

B. speed

Explanation:

im not sure hahahaha

Please help me with this. TY!

Please help me with this. TY!

Answers

Answer:

The Answer To This Question Is B

Explanation: Please Mark Brainliest!

How are mass and volume alike?

A.) They always stay the same

B.) The cease to exist when placed in a liquid

Answers

THE ANSWER IS B THE CEASE TO EXIST WHEN LAVED IN LIQUDI hope that helped
Other Questions
Where is the modern alphabet thought to have begun?Question 14 options:EgyptLatin AmericaChinaMesopotamia The type of fat that is found predominately in nuts, seeds, and most vegetable oils is called ____ fat, based on the double bonds found in the carbon chains of the fatty acids. I need help please 20 points Which of the following are true of western boundary currents?Choose all that apply.deep, as compared to eastern boundary currentsthey flow along the more gradual slope of the hill of waterwide, as compared to eastern boundary currentsweak, as compared to eastern boundary currentsfast, as compared to eastern boundary currents the ju/hoansi who live in the kalahari desert must move around in order to find the mongango nut which is their most valuable food source and are practicing this form of mobility. Which of the following is a central idea from the Age of Enlightenment?A. Reason is the only way to find truthB.education is the tool of the oppressorC.government should never be questioned D.objective truth is found through religion The fraction bar can be used to show the order of operations. True or false? In solving the equation 4(x-9)=24, the subtraction should be undone first by adding 9 to each side. true or false?To subtract x's, you subtract their coefficients. True or false? To solve an equation with x's on both sides, you have to move the x's to the same side first. True or false? whose culture has capital? Aa critical race theory B. discussion of communityC. cultural wealth FILL THE BLANK. piaget called children's self-directed utterances ________ speech, reflecting his belief that young children have difficulty taking the perspectives of others. Pls help!! i just need the last two thxxx Repacking her bag for her trip to New York was a slow process because Sherri's stuff was strewn over every inch of the floor.In this sentence, which word should be replaced with precise language? Her Stuff Every Trip Which of the following BEST defines a Political Action Committee (PAC)?A.a type of lobby that raises money for Congress members with similar viewsB.a type of political party that opposes both Republican and Democratic viewsC.groups whose sole focus is to represent minority views and opinionsD.a political alliance within the Senate known for stall tactics like filibustering Cuento de terror que cuente con planteamiento ,nudo, climax y descenlace pgina 72 de libro de espaol 6 grado pliss A local real estate company has 5 real estate agents. The number of houses that each agent sold last year is shown in the bar graph below. Use this bar graph to answer the questions. How do I set up the equations for these two problems so I can find X? Who proposed and experimentally found the first neutrino? onepage with citatons a(n) is comprised of an insular alliance of lawmakers, bureaucrats, and interest groups designed to allow them to dominate policymaking within a certain issue area. Write an equation of the line with the given slope, m and y intercept (0,b) m=-6, b =-1/2 plss Fill in the complementary DNA strand (template strand). Then transcribe \& translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are the non-template strands. 5'TCAATGGAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATTGACACT 3 ' 5GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTtAACCCCGGA 3 Do You Think matter can enter or escape in an open system or a closed system