Answer:
D
Explanation:
There are spaces between neurons called synapses
What is metamorphisis
Answer:
Metamorphosis is a biological process by which an animal physically develops after birth or hatching, involving a conspicuous and relatively abrupt change in the animal's body structure through cell growth and differentiation.
Explanation:
⦁ Interpret the bottom half of the cross section below. Start with the Vishnu Schist and end with the Red wall Limestone.
⦁ Scoring:
Correct order (8 points):
⦁ Proper environmental changes (8 points):
⦁ Attention to detail and completeness (4 points):
Answer:
Type your answer here.
(Score for Question 2: ___ of 5 points)
⦁ There is one of each type of unconformity in this diagram. Name at least one of each of them by indicating the layers that they are between.
⦁ Nonconformity:
Answer:
Type your answer here.
⦁ Angular unconformity:
Answer:
Type your answer here.
⦁ Disconformity:
Answer:
Type your answer here.
Symbol Name Environment
Sandstone Beach or nearshore environment
Limestone Forms in warm shallow seas
Shale Deep sea
Igneous Rock (Granite) Formed when rocks melt and then recrystalize
Metamorphic Rock (Schist) Formed when rocks are severely deformed without melting; in this cross section, the Vishnu Schist represents the original surface in the area
Igneous intrusion Magma melting and rising from deeper levels
Hint: How can you tell the difference between an intrusion and rocks melting in place? Rocks melting in place usually appear as a large mass, whereas intrusions seem to have risen up from a source.
answer:The vishnu schist is oldest that is 1.7 billion years old and the redwall schist is youngest. Explanation: The Vishnu schist is the uncovered rocks of the grand canyon vicinity they're formed on the basement location that underlines the bottom limestone. Which are accompanied by way of the Zoroaster granite which is an igneous-plutonic rocks intrusion and became later metamorphosed
Explanation:
How do ribosomes and the Golgi apparatus interact to maintain homeostasis? A. Ribosomes transport proteins and enzymes that are synthesized by the Golgi apparatus. B. Ribosomes store liquids and other waste products that are created by the Golgi apparatus. C. Ribosomes synthesize proteins that are sorted and packaged by the Golgi apparatus. D. Ribosomes store molecules that are converted into usable energy by the Golgi apparatus.
The proteins that are generated by the ribosomes are stored in the Golgi apparatus.
What is the Golgi apparatus?
Golgi apparatus is also called the Golgi complex or Golgi body. It is a membrane-bound organelle present in eukaryotic cells. It is made from a network of flattened stacked structures called cisternae.
The Golgi apparatus is responsible for the transportation, modification, and packaging of the proteins and lipids molecules into small vesicles. These vesicles are delivered to their destinations.
This organelle is embedded in the cytoplasm right after the endoplasmic reticulum. It is located near the cell nucleus. These are present in hundreds of plant cells.
They help in the transport of secretory proteins, cell membrane proteins, lysosomal proteins, glycoproteins etc. They also help transport some glycolipids. Much of the material for the cell wall passes through the Golgi apparatus.
Therefore, the Golgi apparatus helps in protein packaging.
Read more about the Golgi apparatus, here
https://brainly.com/question/12233980
#SPJ2
A 3-column table with 3 rows. The first column labeled sample has entries A, B, C. The second column labeled taste has entries sour, bitter, sweet. The third column labeled texture has entries sticky, slippery, sticky.
Abdul has mislabeled three baking containers. They hold baking soda (a base), cream of tartar (an acid), and powdered sugar (neither acid nor base), but he doesn’t know which is which. Help him identify each sample based on the observations he has noted in the table.
Sample A is the
.
Sample B is the
.
Sample C is the
.
(cream of tartar) (powdered sugar) (baking soda)
Answer:
Explanation:
To begin with, we need to understand the basic characteristics of the three types of substances: acids, bases, and neutral substances. Acids typically taste sour, while bases have a bitter taste. Neutral substances, on the other hand, have no distinct taste. In terms of texture, acids tend to be sticky, while bases are slippery.
With this information in mind, we can start to identify each sample based on its taste and texture. Sample A is noted as having a sour taste and a sticky texture. Based on the characteristics we just discussed, it is likely that Sample A is an acid. The only acid in the list of substances provided is cream of tartar, so we can conclude that Sample A is cream of tartar.Sample B is noted as having a bitter taste and a slippery texture. Based on the characteristics we just discussed, it is likely that Sample B is a base. The only base in the list of substances provided is baking soda, so we can conclude that Sample B is baking soda.
Sample C is noted as having a sweet taste and a sticky texture. Based on the characteristics we just discussed, it is likely that Sample C is a neutral substance. The only neutral substance in the list of substances provided is powdered sugar, so we can conclude that Sample C is powdered sugar.
To know more about acids visit :-
https://brainly.com/question/14072179
#SPJ11
If a baby is born prematurely before type II cells produce sufficient pulmonary surfactant, which of the following might you expect? a. difficulty expressing fluid b. difficulty inflating the lungs c. difficulty with pulmonary capillary flow d. no difficulty as type I cells can provide enough surfactant for normal breathing
Premature birth causes pulmonary inflation difficulties because type II cells are unable to create enough pulmonary surfactant.
What use does pulmonary surfactant serve?It is known that pulmonary surfactant lowers surface tension in the alveoli at the air-water interface, limiting the collapse of these structures at end-expiration. Surfactant lessens the effort required for breathing in this way.
How can surfactant stop the collapse of the lungs?The lung cells exude surfactant, which distributes throughout the alveolar tissue. This chemical reduces surface tension, which facilitates easy breathing by preventing the collapse of the alveoli following exhalation. A complex mixture of proteins and phospholipids called pulmonary surfactant works to lower surface tension at the alveolar-air interface, preventing atelectasis.
To know more about pulmonary inflation visit:-
https://brainly.com/question/13252446
#SPJ4
After doing an endospore staining procedure on an unknown bacteria, you looked at it under the microscope and saw the picture below. What can you conclude?Vegetative cells are present, but no endosporesEndospores are present, but no vegetative cellsBoth endospores and vegetative cells are presentThe bacilli in the photo are acid fast
From the photo, it can be concluded that there are both endospores and vegetative cells present. The endospores can be seen as smaller cells staind in blue, while vegetative celles are staind in red.
TRUE or FALSE
1- Lambda transitions are exactly the same as other non determinism.
2- Non determinism only applies in the direction of the transition, just because an 'a' forces you to be in two states does not mean you cannot be in just one of the two alone via some other path.
3- If two states S1 and S2 both have lambda transitions to each other, they MUST be the same state.
1. The statement "Lambda transitions are exactly the same as other non determinism" is false because lambda transitions introduce additional choices
2. The statement "Non determinism only applies in the direction of the transition, just because an 'a' forces you to be in two states does not mean you cannot be in just one of the two alone via some other path" is false because non determinism affects overall paths.
3. The statement "If two states S1 and S2 both have lambda transitions to each other, they MUST be the same state" is false because lambda transitions allow non-equivalence.
1. Lambda transitions, also known as epsilon transitions, allow a state in a finite automaton to move to another state without consuming any input symbol. They provide additional flexibility and expressiveness to the automaton. Other non-deterministic transitions, on the other hand, are based on input symbols and determine the next state based on the current state and the input symbol.
2. Non-determinism in automata allows for multiple possible paths and states to coexist simultaneously. When an input symbol is encountered, the automaton can transition to multiple states at the same time, representing different possible outcomes. This means that even if an input symbol "a" forces the automaton to be in two states, it does not exclude the possibility of being in just one of the two states alone through some other path.
3. Lambda transitions can establish connections between different states in a finite automaton. If two states, S1 and S2, both have lambda transitions to each other, it means there is a circular dependency between them. However, this does not imply that S1 and S2 must be the same state. It is possible for distinct states to have lambda transitions that create a loop or cycle between them, allowing for non-trivial behavior within the automaton.
To learn more about transitions follow the link:
https://brainly.com/question/14274301
#SPJ4
The ______ regulates the amount of glucose circulating in the blood by either synthesizing glycogen or breaking down glycogen.
Answer:
Glucagon
Explanation:
It is a peptide hormone secreted by the pancreas, raises blood glucose levels
Glucagon stimulates glycolysis, the breakdown of glycogen and the export of glucose into the circulation
Describe each of the following:
Sickle Cell Anemia
Diabetes
Acne
HELP!!
Answer:
1. Sickle cell anemia is an inherited red blood cell disorder in which there aren't enough healthy red blood cells to carry oxygen throughout your body. Normally, the flexible, round red blood cells move easily through blood vessels. In sickle cell anemia, the red blood are shaped like sickles or crescent moons.
Treatments: Blood transfusion
Symptoms: Pain
2. Diabetes is the condition in which the body does not properly process food for use as energy. Most of the food we eat is turned into glucose, or sugar, for our bodies to use for energy. The pancreas, an organ that lies near the stomach, makes a hormone called insulin to help glucose get into the cells of our bodies.
3. Acne is a skin condition that occurs when your hair follicles become plugged with oil and dead skin cells. It causes whiteheads, blackheads or pimples. Acne is most common among teenagers, though it affects people of all ages.
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
Increasing the I concentrations of carbon dioxide available to aquatic plants will increase the rate of photosynthesis as measured by the bubbles produced find the independent and dependent variable in the hypothesis
Answer:
The correct answer is -
Independent variable - change in the concentration of carbon dioxide
Dependent variable - bubbles produced
Explanation:
The independent variable of an experiment or study is a variable that is subject to change or being manipulated during the study to find the response on the dependent variable. The concentration of carbon dioxide is here manipulated to find the change in the amount of bubble produced.
The dependent variable is a response that is carried out by the change or manipulation of the independent factor. In this case amount of bubbles is the dependent variable.
Thus, the correct answer is -
Independent variable - change in the concentration of carbon dioxide
Dependent variable - bubbles produced
What is the average charge for a one-hour massage?
$75
$60
$50
$85
Answer:
The national average cost of a massage is $100 per session, but prices can range anywhere from $65 to $180. On an hourly basis, average massage prices range from $40 to $145 per hour.
Dynamically regulated actin polymerization is central to the changes in?
a. axonal transport
b. cell motility in amebae.
c. shape of macrophages and cell motility in amebae.
d. flagella movement in bacteria.
e. shape of macrophages and cell motility in amebae.
Dynamically regulated actin polymerization is central to the changes in c. shape of macrophages and cell motility in amebae.
Actin is a globular protein that forms microfilaments, which are essential components of the cytoskeleton in eukaryotic cells. Polymerization is the process of monomers, like actin, joining together to form a polymer. In the context of actin, polymerization results in the formation of actin filaments. These filaments play a crucial role in cell motility, shape, and the maintenance of cellular integrity.
In macrophages and amebae, actin polymerization allows for changes in cell shape and motility by driving the formation and retraction of cellular protrusions, such as pseudopodia and lamellipodia. When actin monomers polymerize at the leading edge of the cell, they push the cell membrane outward, resulting in the extension of these protrusions. Conversely, depolymerization of actin filaments at the cell's trailing edge facilitates retraction.
Overall, the dynamic regulation of actin polymerization and depolymerization allows macrophages and amebae to efficiently change their shape and move through their environments in response to various stimuli, such as chemotaxis, which is the process of following chemical gradients to find food or escape from harmful substances.
Learn more about actin polymerization at: https://brainly.com/question/22784523
#SPJ11
. For each phenotype, give the genotypes that are possible for Patrick.
A tall head (T) is dominant to short (t).
Pink body color (P) is dominant to yellow (p).
The genotypes listed for each phenotype assume that Patrick's parents are both heterozygous for both traits (i.e., TtPp x TtPp). Other possible parent genotypes could result in different combinations of phenotypes in their offspring.
If a tall head (T) is dominant to short (t), and pink body color (P) is dominant to yellow (p), then the possible genotypes for Patrick are:
Tall head, pink body color: TTPP, TtPP, TTpP, TtpP
Tall head, yellow body color: TTpp, Ttpp
Short head, pink body color: ttPP, ttPp
Short head, yellow body color: ttpP, ttpp
Note that the genotypes listed for each phenotype assume that Patrick's parents are both heterozygous for both traits (i.e., TtPp x TtPp). Other possible parent genotypes could result in different combinations of phenotypes in their offspring.
Learn more about genotypes Visit: brainly.com/question/30460326
#SPJ4
Help please I will give you the brainliest I need help with 3
Answer: c) A High-Pressure System
Explanation: A high pressure system is a whirling mass of cool, dry air that generally brings fair weather and light winds.
4 Identify What are the functions of proteins in
organisms?
Some functions of proteins are:
Serve as enzymesStructural SupportTransport and StorageHormonesImmunityWhat are proteins?Proteins are expansive, complex atoms that are basic to the structure, work, and direction of cells and living beings. They are made up of chains of littler units called amino acids. Amino acids are connected together through chemical bonds known as peptide bonds to create polypeptide chains, which at that point overlap into particular three-dimensional structures.
The grouping of amino acids in a protein is decided by the hereditary code put away in an organism's DNA. This hereditary data is deciphered into flag-bearer RNA (mRNA) atoms, which are at that point interpreted by cellular apparatus called ribosomes to synthesize proteins.
Learn about proteins here https://brainly.com/question/10058019
#SPJ1
when Mendel crossed a tall plant a short plant, the what generation that resulted were all tall.
Answer:
F1
Explanation:
The tall plant (genotype AA) and the short plant (genotype aa), when crossed, can only make heterozygous Aa offspring, which will all be tall because the allele for tallness is dominant over the allele for shortness.
There are 22 different amino acids. What part of each amino acid is differnt from the others
Answer:
Amino acids are units or building blocks of protein. These are crystalline solid without any colour and are soluble in water and insoluble in the organic solvent. All amino acids have five basic parts. These are a central carbon (C) atom, hydrogen(H) atom, an amino group (NH2) with one nitrogen atom and two hydrogen atoms, a carboxyl group (COOH) having one carbon atom, two oxygen atoms, and one hydrogen atom and an R-group or side chain. There are 22 different types of amino acids. They are different due to the different side chain or R-group. For example, if the side chain is H, the amino acid is Glycine and if side chain is CH3, the amino acid is Alanine
Explanation:
What does the phosphorylation of Cdc25 by M-Cdk do? Question 4 options: It inactivates Cdc25, which promotes activation of more M-Cdk. It activates Cdc25, allowing the cell to exit mitosis. It activates Cdc25, which inactivates M-Cdk. It inactivates Cdc25, preventing further activation of M-Cdk. It activates Cdc25, which in turn activates more M-Cdk.
Answer:
It activates Cdc25, which in turn activates more M-Cdk
Explanation:
Cyclin are enzymes that regulate cell cycle progression by the activation of cyclin-dependent kinases (CDKs). These cyclins have no enzymatic activity on their own but they can activate Cdks by binding and phosphorylating them. CDKs can be activated by phosphorylation of activating sites and/or dephosphorylation of inactivation sites. Moreover, M-phase cyclins are cyclins that form M-CDK complexes in order to modulate the cell's entry into mitosis. Cdc25 is a phosphatase involved in the eukaryotic cell cycle which is well-known to regulate the entry into and progression during S (DNA Synthesis) phase and mitosis. In this regard, it has been shown that mitotic phosphorylation of Cdc25 by M-Cdks increases its intrinsic phosphatase activity, thereby Cdc25 is able to remove inhibitory phosphates from M-Cdk and, consequently, activate more M-Cdks.
define the following words a: biology
b:biotechnology
Answer:Biotechnology is a broad area of biology, involving the use of living systems and organisms to develop or make products. Depending on the tools and applications, it often overlaps with related scientific fields
biology the laws and phenomena relating to an organism or group
Biology: The study of living organisms is called biology
Biotechnology: Application of technologies in the field of biology.
What is the difference between biology and biotechnology?Biotechnology is a subfield of biology, which is a science. Biotechnology is the use of biology for human benefit, whereas biology is the study of living things. Biotechnology uses a variety of methods, such as the genetic engineering of bacteria, to produce industrial goods.
The anatomy of living things is what distinguishes biology from biotechnology. The anatomy and physiology of living things are the main topics of biology. Contrarily, biotechnology is concerned with technology. It has nothing to do with the least important aspects of a living thing's anatomy and physiology.
Hence, this is a detailed explanation of biology and biotechnology.
Learn more about biology and biotechnology, here:
https://brainly.com/question/13322698
#SPJ2
A length of rope measures 3,000 millimeters. How long is it in meters?
Answer:
3 meters
Explanation:
3,000 divided by 1,000
=
3
Why 1,000? 1 meter is 1,00 milimeteres.
Read the excerpts about climate change. Article 1, found on the website of the Natural Resources Defense Council, a certified charitable organization, supports global warming. Global warming doesn't create hurricanes, but it does make them stronger and more dangerous. Because the ocean is getting warmer, tropical storms can pick up more energy and become more powerful. So global warming could turn, say, a category 3 storm into a much more dangerous category 4 storm. In fact, scientists have found that the destructive potential of hurricanes has greatly increased along with ocean temperature over the past 35 years. Article 2 was written by Michael Fumento, writer for the New York Post editorial blog, who does not support global warming. Back in 2005 I and others reviewed the entire hurricane record, which goes back over a century, and found no increase of any kind. Yes, we sometimes get bad storms—but no frequently now than in the past. The advocates simply ignored that evidence. Fact is, the earth was cooling and warming long before greenhouse gases could have been a factor. The [global warming supporters] have been proved wrong time and time again. Which best justifies the accuracy of the claim? Although Article 1 mentions evidence discovered by scientists, more research is needed about the data source to determine if the claim is scientific. Article 1 is a scientific claim because it says that global warming doesn’t create hurricanes. Although Article 2 mentions the study of a hurricane record, it is a scientific claim because the author himself reviewed it and is therefore an expert. Article 2 uses a scientific claim because the author says the Earth is in a cooling cycle.
(there's only 1 awanser not 2)
The accuracy of the claim is best justified by the statement:
Article 1 is a scientific claim because it says that global warming doesn’t create hurricanes; option B.What is global warming?Global warming or climate change describes long-term changes to weather patterns. These changes may be organic, but since the 1800s, human activity has been the primary cause of climate change.
The burning of fossil fuels, logging of forests, and raising livestock all have a rising impact on the climate and temperature of the earth.
Scientific claims indicate that the effect of global warming is seen in more adverse weather conditions such as droughts, rainfall, hurricanes, etc.
Learn more about global warming at: https://brainly.com/question/1789619
#SPJ1
Complete question:
Read the excerpts about climate change. Article 1, found on the website of the Natural Resources Defense Council, a certified charitable organization, supports global warming.
"Global warming doesn't create hurricanes, but it does make them stronger and more dangerous. Because the ocean is getting warmer, tropical storms can pick up more energy and become more powerful. So global warming could turn, say, a category 3 storm into a much more dangerous category 4 storm. In fact, scientists have found that the destructive potential of hurricanes has greatly increased along with ocean temperature over the past 35 years."
Article 2 was written by Michael Fumento, a writer for the New York Post editorial blog, who does not support global warming.
"Back in 2005 I and others reviewed the entire hurricane record, which goes back over a century, and found no increase of any kind. Yes, we sometimes get bad storms—but no more frequently now than in the past. The advocates simply ignored that evidence. Fact is, the earth was cooling and warming long before greenhouse gases could have been a factor. The [global warming supporters] have been proved wrong time and time again."
Which best justifies the accuracy of the claim? (there's only 1 answer not 2)
Although Article 1 mentions evidence discovered by scientists, more research is needed about the data source to determine if the claim is scientific.Article 1 is a scientific claim because it says that global warming doesn’t create hurricanes.Although Article 2 mentions the study of a hurricane record, it is a scientific claim because the author himself reviewed it and is therefore an expert.Article 2 uses a scientific claim because the author says the Earth is in a cooling cycle.The original mice that you cross are called the
.The offspring from that cross are called the
The original mice that you cross are called the parent generation. The offspring from that cross are called the first Filial generation.
(8.9B) The picture below shows two plates colliding. Neither one can be subducted into the
mantle because they both have a density that is much lower than the mantle's density.
Folded mountains often form as a result. Which type of plate boundary would most likely
result in mountain formation?
A Convergent Boundary
B Divergent Boundary
C Transform Boundary
D None of the above
HELP ME PLEASE PLEASEE
B.divergent Boundry
i wish it will help you
Mitochondrion definition
Answer:
an organelle found in large numbers in most cells, in which the biochemical processes of respiration and energy production occur. It has a double membrane, the inner layer being folded inward to form layers (cristae).
Explanation:
If you lived during the times when demons were attributed to abnormal behavior, a typical treatment to rid you of your demons would have been:A. exorcism
B. psychiatrists
C. rush
D. dysfunction
If you lived during the times when demons were attributed to abnormal behavior, a typical treatment to rid you of your demons would have been A. exorcism.
Abnormal behavior is a behavior that is not in accordance with the general situation and tends to be different from the existing norm. During ancient times, abnormal behavior was often attributed to demonic possession and exorcism was a common practice used to rid an individual of their demons.
Exorcism is a religious or spiritual practice that involves casting out demons or other spiritual entities from a person or an area. It is typically performed by a religious leader or a trained exorcist. While modern medicine has largely replaced exorcism as a treatment for abnormal behavior, it is still practiced by some religious groups today.
Learn more about exorcism at:
https://brainly.com/question/14673574
#SPJ11
Write the organs involved in protein secretion in order from start to finish
Answer:
The organs involved in protein secretion are the liver, the pancreas, and the small intestine.
Explanation:
The liver produces enzymes that break down proteins into amino acids.
The pancreas produces enzymes that further break down the amino acids into peptides.
The small intestine absorbs the peptides and transports them to the bloodstream.
Which situation would deplete freshwater
Answer:
Water demand is greater than its renewal or recharge rate.
Explanation:
Que tipo de relacion simbiotica tienen los osos pandas
Pandas have a primarily mutualistic symbiotic relationship with bamboo, which serves as their primary food source. This relationship benefits both the panda and bamboo.
Pandas rely almost exclusively on bamboo for their diet, and their digestive system is adapted to efficiently process and extract nutrients from this fibrous plant. In turn, pandas play a role in seed dispersal for bamboo, as they consume bamboo shoots and leaves and then spread the undigested seeds in their feces. This aids in the regeneration and dispersal of bamboo plants, contributing to their reproductive success. Thus, pandas and bamboo have a mutually beneficial relationship that supports the survival and propagation of both species..
Learn more about Pandas
https://brainly.com/question/16863554
#SPJ4
Translated Question ;
What kind of symbiotic relationship do pandas have?
Los hidrocarburos se forman con la Unión de los elementos carbono e hidrógeno hay dos grandes grupos que son:
Answer:
Alcanos, alquenos y alquinos.
Explicación:
Los hidrocarburos se forman con la unión de los elementos carbono e hidrógeno, hay tres grandes grupos de hidrocarburos que son alcanos, alquenos y alquinos. Estos hidrocarburos se dividen en grupos según el tipo de enlace. Los alcanos son los hidrocarburos que contienen enlaces simples entre átomos de carbono, los alquenos tienen un doble enlace entre átomos de carbono, mientras que los alquinos contienen un triple enlace carbono-carbono.