Answer:
Water molecules attract each other due to polarity. Polarity: Although the net charge of a water molecule is zero, water is polar because of its shape. The hydrogen ends of the molecule are positive and the oxygen end is negative. This causes water molecules to attract each other and other polar molecules.
Water dissolves everything because it is the “universal solvent." Water has the ability to dissolve many substances but the term “universal solvent" is misleading. Water is able to dissolve other polar molecules and ions, such as sugars and salts.
page 350 9.1. the myth of race identify the true and false statements about race. true statement(s) race is not real. press space to open race is by definition always about differences in physical appearance. press space to open race is a social construct. press space to open race is about bloodlines. press space to open false statement(s)
The following are the true statements about race:
Race is not real. Race is by definition always about differences in physical appearance. Race is a social construct.The following are the false statements about race:
Race is about bloodlines.What is a Race?Race is a widely debated topic that refers to the grouping of individuals based on differences in physical appearance, genetic inheritance, or shared ancestry. However, race is not based on scientific facts. Race is a social construct and not a biological concept.
The concept of race has been used in the past to discriminate against and marginalize certain groups of people based on their physical features or cultural practices. The primary factor that determines the color of an individual's skin is melanin pigment. The amount of melanin produced by the melanocytes determines whether an individual will have lighter or darker skin.
However, race is not a biological category but a social construct, as different societies have different criteria for grouping people into different races.
To know more about the difference between race and ethnicity, visit: https://brainly.com/question/30390828
#SPJ11
PLEASE PLEASE HELP I WILL GIVE BRAINALIST
Assignment: Determining Half-life Exploration
Data Table
Trial Amount Decayed Amount Left
1
50 50
2
26 24
3
12 12
4
6 6
5
3 3
6
3 0
Graph
Using the data from the table, make a graph of the number of atoms remaining after each trial.
Questions
1. How many trials did it take for half of the Virtualium atoms to decay?
1 trial
2. Suppose each trial equals 1,000 years. What is the half-life of Virtualium?
1000 years
3. Suppose each trial equals 1,000 years. After half (50) of the Virtualium cubes were removed from the box, about how long did it take for half of the rest of the cubes to decay?
5000 years
4. Imagine you have a radioactive sample containing both Virtualium and decayed atoms of Virtualium. After analysis, you find it contains 10 atoms of Virtualium and 40 decayed atoms. How old is your sample? (Hint: You must use the half-life of Virtualium determined earlier in the activity.)
It is 8000 years old.
Answer:
Ty<3
Explanation:
Select the part of the image where the most recent common ancestor would be for Reptiles and Rodents.
The most recent common ancestor is the most recent individual from which both species are descended. The points in which the branches meet shows us points in which there were important ancestor, and the characteristic that is written is the one that appears for the first time there. So, the point in which the branches for Reptiles and Rodents meet can be found where we can read the "Amniotic egg" characteristic, and that's where the most recent common ancestor would be for Reptiles and Rodents.
Consider the diagram of an internal feedback mechanism that the body uses to help maintain homeostasis.
The internal feedback mechanism is shown. Stimuli goes to the receptor to the coordinator to the effector to the response and then to feedback.
What is the role of the central nervous system in this model?
a) coordinator
b) effector
c) response
d) stimuli
The role of the central nervous system in this model is as coordinator (Option a).
What is the central nervous system?The central nervous system is a fundamental body system that acts by sending and receiving signals from the environment.
The central nervous system can act as a coordinator by modulating signals and thus maintaining the internal equilibrium (homeostasis).
In conclusion, the role of the central nervous system in this model is as coordinator (Option a).
Learn more about the central nervous system here:
https://brainly.com/question/2114466
#SPJ1
Can you have more than one producer in a food chain??
Answer:
Maybe as a producer can be a tree or grass
Explanation:
therefore i think there can be more than one
A mother has blood type A and her son has blood type 0. Which blood types are possible for the father?
o AB
оо
ОА
о в
Answer:
Blood types O, A, and B are possible for the father.
Explanation:
Since the mother has type A blood, there are two possible genotypes that she can have: AA or AO. Since her son has type O blood, he only has one genotype: OO.
For blood types,
Type A - AA or AO
Type AB - AB
Type B - BB or BO
Type O - OO
* A and B are dominant over O.
Now we have to do crosses between the mother and the father:
AA mother with AB father: child with type AA or type AB blood
AO mother with AB father: child with type AA, AO, AB, or BO blood
AA mother with OO father: child with AO blood
AO mother with OO father: child with AO or OO blood
AA mother with AA father: child with type AA blood
AA mother with AO father: child with type AA or AO blood
AO mother with AA father: child with type AA or AO blood
AO mother with AO father: child with type AA, AO, or OO blood
AA mother with BB father: child with type AB blood
AA mother with BO father: child with AB or AO blood
AO mother with BB father: child with AB or BO blood
AO mother with BO father: child with AB, AO, BO, or OO blood
The father can have blood types O, A, or B.
Hope this helps.
The introduction of the nutria, a large rodent, has destroyed plant populations in many regions. Which two outcomes are likely consequences of this change?
A. An increase in the resiliency of the ecosystem due to an increase in the space available for new plants to sprout
B. A decrease in the resiliency of the ecosystem due to a decrease in plant biodiversity
c. A decrease in native primary consumers that depend on the destroyed plants for food
d. An increase in the biodiversity of the ecosystem due to an increase in the population of the nutria
Answer:
The two likely consequences of the introduction of the nutria, a large rodent, that has destroyed plant populations in many regions are:
B. A decrease in the resiliency of the ecosystem due to a decrease in plant biodiversity: Nutria feeds on a variety of plants and can cause a significant reduction in plant diversity in their habitat, which can lead to a decrease in the resiliency of the ecosystem. This is because fewer plant species mean less variety in the ecosystem, making it less able to respond to disturbances and less stable.
C. A decrease in native primary consumers that depend on the destroyed plants for food: The destruction of plant populations due to the introduction of nutria can lead to a decrease in food availability for native primary consumers that depend on these plants for their survival, such as certain species of insects, birds, and mammals. As a result, the populations of these native species may decline, leading to imbalances in the ecosystem.
how can a point mutation impact and organism
Answer:
it can be a hard like thing to get it from each
How many deciliters are there in one liter?
Answer:
I think its 10
Hope this helps but I might be wrong
how is the woody xylem in tilia different than monocots and dicots
Answer:
Herbaceous stems lack woody tissue and growth rings unlike woody xylem. Wood is a composite of cellulose fibers which require the the process of phloem in the bark to contain nutrients unlike herbaceous stems that rely on xylem that contains vessel and vascular elements.
Explanation:
Natural selection occurs when organisms adapt to their environment and
Answer:
survive and produce more offspring
Explanation:
i took bioooooo :)
The minimum number of microorganisms necessary to enter the body and establish infection is termed the _______.
Answer:
it is term to the power of the White blood cells
Which of the following features of a pathogen is not considered to be a virulence factor when establishing infection within host?
A. Pigment production
B. Attachment fimbriae
C. Slime layer
D. Protein spikes
Pigment production is not considered a virulence factor for establishing infection within a host. Correct option is A.
Pathogens use a variety of virulence factors to establish and maintain infections within their host. These can include attachment fimbriae, slime layers, and protein spikes. Pigment production, however, is not typically considered a virulence factor. Pigments can serve various functions for the pathogen, such as protection against UV radiation or the absorption of nutrients.
However, they do not contribute to the pathogen's ability to establish an infection or evade host defenses. While some pathogens may produce pigments as a byproduct of their metabolic processes, this does not necessarily make them virulent. Ultimately, the virulence of a pathogen is determined by a complex interplay of factors, including its ability to adhere to host tissues, evade the immune system, and cause tissue damage.
Learn more about pathogen here:
https://brainly.com/question/13051879
#SPJ11
Suppose a species lived in an environment that changed very little over millions of years. Which theory about how fast evolution occurs would most likely explain the evolution of that species?
Gradualism is referred to the theory about how fast evolution occurs in this type of species.
What is Gradualism?This type of evolutionary changes occurs gradually and not in large steps or volume.
This however explains why the species had very little changes for a very long time as a result of the environment being best suited for them.
Read more about Gradualism here https://brainly.com/question/20463574
#SPJ1
which lipoprotein transports dietary fat to the cells in your body?
Chylomicron is a lipoprotein that transports dietary fat to the cells in the body.
Chylomicrons are extremely low-density, large lipoproteins that transport dietary lipids from the intestine to tissues.
Chylomicrons include triglycerides and other lipids absorbed by enterocytes to incorporate them into the body.
By being activated by the Apolipoprotein CII Protein, the body ensures that lipoprotein lipase only acts on mature lipoproteins.
This enzyme hydrolyzes the triglycerides that form the monolayer of the chylomicron, allowing the uptake of lipids by the muscle or connective cells that will use those lipids.
Therefore, we can conclude that chylomicrons are responsible for mobilizing the lipids that are ingested in the diet by the body.
Learn more here: https://brainly.com/question/1305679
pls pls pls pls pls pls pls pls
I would give you brainlist
Explanation:
Is The Hill (thehill.com) a trusted news website or does it have a strong bias?
From what I’ve seen, The Hill’s news reporting is pretty even handed and accurate, although the site is considered to be slightly right leaning.
However, they also employ John Solomon as their executive VP of digital video and as a columnist. With a strong background in investigative journalism, his work of late has descended into promoting baseless conspiracy theories, like the widely discredited Uranium One. I’ve seen stories of his promoted by the right-wing media in the past couple of years that have fallen apart under scrutiny.
UPDATE (5–23–2020): Someone a couple of revisions that I rejected. Nothing about spelling or grammar. This answer was accurate when it was written, although The Hill has since parted with Solomon. Brendan Delaney’s second edit suggestion was not only inaccurate, but would have made the answer his own. Better that he simply answer the question himself or make his points in a comment. But then again if you do think about it Well…John Solomon was their chief editor for a long time and he’s a hard-right, loony conspiracy theorist nutbar. The site is also owned by Jerry Finkelstein, who is good friends with Trump. Furthermore, The Hill does gives face time to a lot of hard-right opinion pieces.
On the flipside, they ARE a good aggregator of political news and publish stories you won’t find elsewhere, which balances things out somewhat.
Solomon left a few months ago Fox News and The Hill seems to be making an honest effort to balance their editorial more. Jury is still out on whether they’ll be successful or not.
Drug Dosages. Thomas Young has 5 iggested the followiLe rule for caiculating the dosage of medicine for chidren 1 to 12 yr ofd. If a denctes the aduit. dosage (in midigrams) and if t is the child's ago (in years), then the child's dosage is given by the following function.
D(t)= at/t+12 Suppose the adult dosage of a substance is 280mg. Find an expression that gives the rate (in mg/year) of change of a child's cosage with respect to the child's age. D′(t)= What is the rate of change (in mg/year) of a child's dosage with respect to his or her age for a 3 -yr-old child? A 12 -yr-old child? (flound your answer to three decimal placesi) 3-yr-old _____ mg/year 12-yriold _____ mg/year
Given data: Adult dosage of a substance is 280mg. Rule for calculating dosage for children between 1 to 12 years of age is given by the function, D(t) = a * t / t + 12. To find the rate of change of this function with respect to the child's age, we need to differentiate the function with respect to t.
Let's differentiate this function with respect to t. d/dt [ D(t) ]= d/dt [ a * t / t + 12 ]
Using quotient rule,= [ a * (t + 12) - a * t ] / ( t + 12 )²= a / ( t + 12 )²
Thus, the rate of change of child's dosage with respect to child's age is given by D'(t) = a / ( t + 12 )².
Hence, the required expression is D'(t) = 280 / ( t + 12 )².
Now, substituting t = 3,
we get, D'(3) = 280 / (3 + 12)²
= 280 / 225
= 1.244 mg/year
Substituting t = 12,
we get, D'(12) = 280 / (12 + 12)²
= 280 / 576
= 0.486 mg/year
Therefore, the rate of change of a child's dosage with respect to his or her age for a 3-yr-old child is 1.244 mg/year and for a 12-yr-old child is 0.486 mg/year. We are given the formula, D(t) = a * t / t + 12, which represents the dosage for a child as a function of their age, t. To find the rate of change of this function with respect to the child's age, we need to differentiate the function with respect to t.
To know more about dosage visit:
https://brainly.com/question/12720845
#SPJ11
What kind of cells are the ‘strings’ in celery stalks
Answer:
Collenchyma cells are elongated and filled with water. The pressure of the water against the cell walls creates a stiffness that gives celery its crunch. These are the strings in celery.
Scientists examined the folded structure of a purified protein resuspended in water and found that amino acids with nonpolar R groups were primarily buried in the middle of the protein, whereas amino acids with polar R groups were primarily on the surface of the protein. Which of the following best explains the location of the amino acids in the folded protein?
a. Polar R groups on the surface of the protein can form ionic bonds with the charged ends of the water molecules.
b. Polar R groups are too bulky to fit in the middle of the protein and are pushed towards the protein's surface.
c. Nonpolar R groups that cannot form hydrogen bonds with water are pushed into the middle of the protein.
d. Nonpolar R groups from different parts of the protein form covalent bonds with each other to maintain the protein's structure.
Answer:
hello there
Explanation:
answer is c
The nonpolar R groups that cannot form hydrogen bonds with water are pushed into the middle of the protein. The correct option is c.
What is hydrogen bond?A hydrogen bond is an electrostatic force of attraction between a hydrogen atom that is covalently bound to a more electronegative "donor" atom or group and another electronegative atom with a single pair of electrons means the hydrogen bond acceptor.
Also because the electron is not shared evenly between such a hydrogen atom as well as a negatively charged atom, hydrogen bonding occurs.
Hydrogen in a bond still has one electron, whereas a steady electron pair requires two electrons.
Nonpolar R groups that cannot form hydrogen bonds with water have been pushed into the protein's core.
Thus, the correct option is c.
For more details regarding hydrogen bonds, visit:
https://brainly.com/question/10904296
#SPJ2
what enzymes are required to cleave α-1,6-glycosidic branches in glycogen?
The enzymes required to cleave α-1,6-glycosidic branches in glycogen are known as debranching enzymes.
Debranching enzymes are responsible for breaking down the glycogen molecule by removing branches from the chain. These enzymes consist of two subunits: an alpha-1,6-glucosidase and a transferase. The alpha-1,6-glucosidase cleaves the α-1,6-glycosidic bond at the branching points of the glycogen molecule, releasing a free glucose molecule. The transferase then moves the remaining branch to the end of another glycogen chain so that it can be further broken down by glycogen phosphorylase. The debranching enzymes play an essential role in glycogen metabolism, as they allow the body to release glucose from the stored glycogen in response to energy needs. Without these enzymes, the body would not be able to access this important energy source.
To learn more about glycogen phosphorylase, click here:
brainly.com/question/13776886
#SPJ11
Archaeologists study settlement patterns primarily to reveal what kinds of information about prehistoric communities?
Archaeologists study settlement patterns primarily to reveal population estimates and degrees of social complexity that is a kinds of information about prehistoric communities.
The Prehistoric Communities or Society is an international learned society which devoted to the study of the human past from the earliest times.
Population estimates can describe the size of the total population as well as demographical characteristics such as age, education level, or sex. Population estimates are completely dependent on the demographical components of change, i.e. migration, mortality and fertility.
Social complexity is a kind of conceptual framework which is mainly used in the analysis of society. Contemporary definitions of the complexity in the sciences are generally found in relation to systems theory where a phenomenon under study has multiple parts and multiple possible arrangements of the relationships between those.
Learn more about archaeologists here
brainly.com/question/28209452
#SPJ4
Help
Did you know that you can't just put "help" as your question?
scientist collected the following data, which show how the pressure of water vapor changes with temperature.Temperature (°C)Pressure (mm Hg)04.5109.62019.13033.24058.75095.6What would a scientist do to best communicate these data to other scientists in a presentation?Replace the table with text highlighting pressures.Change the unit of pressure to atm.Make a graph for better visual representation.Display only rows 1, 3, and 6 of the data to simplify results.
which one of the following is Not an organic compound
What would be the most likely outcome if the genetic code was not degenerate? Multiple Choice
O The mutation rate would remain the same.
O The number of stop codons would increase.
O The effect of some mutations would decrease
O The effect of some mutations would increase
Answer:
the effect of some mutations would increase.
Explanation:
The degeneracy of the genetic code refers to the redundancy in the coding of amino acids. Multiple codons can code for the same amino acid, allowing for some variation in the DNA sequence without changing the resulting protein. If the genetic code was not degenerate, meaning each codon coded for a unique amino acid, any mutation that changes a single nucleotide in the codon would likely result in a different amino acid being incorporated into the protein during translation. This would increase the likelihood of a mutation leading to a significant change in the protein structure and function, potentially having a greater effect on the organism.
what do type a positive and ab negative blood have in common?
Type A positive (A+) and AB negative (AB-) blood have the commonality of containing the A antigen on their red blood cells.
Both A+ and AB- blood types share the presence of the A antigen on the surface of their red blood cells. The A antigen is a molecule that triggers the immune response in individuals with other blood types when introduced into their bloodstream. In addition to the A antigen, AB- blood also carries the B antigen.
The A antigen is inherited from one or both parents who have the A allele in their genetic makeup. Type A individuals have either two A alleles (AA) or one A allele and one O allele (AO). On the other hand, AB individuals have both the A and B alleles (AB).
The presence of the A antigen in both A+ and AB- blood types allows individuals with these blood types to receive blood transfusions from donors with compatible blood types, such as A+, A-, AB+, and AB-. However, AB- individuals can receive blood from any negative blood type, making them universal recipients for Rh-negative blood.
To know more about antigen, refer here:
https://brainly.com/question/24384193
#SPJ11
An investigator has a strand of chromosomal DNA whose sequence is shown. She wants to use polymerase chain reaction (PCR) to amplify and isolate the DNA fragment defined by the highlighted segment. Her first step is to design two PCR primers, each 20 nucleotides long, that can be used to amplify this DNA segment. The final PCR product generated from the primers should include no sequences outside of the highlighted segment. 5' --- AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG TTAGATTGATTGTTAGGTTCTTAGGTTTAGGTTCTGGTATT GGTTTAGGGTCTTTGATGCTATTAATTCTTTGGTTTTGATTT GGTCTTTATATGGTTTATGTTTTAAGCCGGGTTTTGTCTGG- GATGGTTCGTCTGATGTGCGCGTAGCGTGCGGCG ---3' What are the sequences of the investigator's forward and reverse primer? Enter them 5' to 3'. forward primer: reverse primer:
The forward primer would be: 5'-ATGCTGGTAACTTGGGGTAT-3' . The reverse primer would be: 5'-CCAGACAAAACCGGCTTAAA-3'
The method that uses a chain of reactions is called a polymerase chain reaction. In vitro procedures that polymerise or create more precise copies of the DNA from a tiny sample are carried out.
The DNA replication process, which includes DNA primers and a specific DNA polymerase enzyme called Taq polymerase, provides the basis for the PCR technique reverse primer.
Denaturation, annealing, and extension are the three steps of the PCR process. During denaturation, the DNA is broken down to release its hydrogen bonds, primers are added at both ends (called reverse and forward primers), DNA is synthesised, and the sample is cooled before extension.
Learn more about polymerase chain here
https://brainly.com/question/14227755
#SPJ11
what is the main difference in the influence of genes versus environment on the expression of discrete versus continuous traits
The main difference between the influence of genes versus environment on the expression of discrete versus continuous traits is that: genes are the units of hereditary information that determine the expression of traits, while environment influences how these traits are expressed.
Discrete traits are those that have distinct phenotypes, while continuous traits are those that are influenced by multiple factors and range along a spectrum. Genes are the primary influence on discrete traits, as they are usually responsible for a single trait and don't change over time.
Environmental influences, however, play a greater role in the expression of continuous traits, as they have a greater impact on how the trait is expressed. For example, a person’s height is a continuous trait and can be affected by environmental factors such as nutrition, exercise, and even the amount of time spent in the sun.
The interaction of genes and environment on the expression of discrete versus continuous traits is complex and varies from individual to individual. Genes play a major role in determining the range of possible phenotypes for a discrete trait, while the environment can modify the actual phenotype.
For continuous traits, the environment is more influential than genes in determining the actual phenotype. The interaction of these two factors has an effect on how a trait is expressed in an individual, and understanding these interactions can help us to better understand how traits are expressed and inherited.
To know more about genes refer here:
https://brainly.com/question/29367774#
#SPJ11
Which of the following is an example of a physical property? a Melting and boiling points b color c Ability to conduct electricity d All of the above
Answer:
all above.
Explanation:
I had the same question for k12.
which two parts of an mrna are necessary for it to be transported out of the nucleus? in general, what else does mrna have to have on it before it can actually leave the nucleus?
The two parts of an mRNA that are necessary for it to be transported out of the nucleus are the 5' cap and the 3' poly-A tail.
These structures provide stability to the mRNA and help in binding to the transport proteins for export.
In general, before mRNA can leave the nucleus, it must undergo several processing steps. These include capping, splicing, and polyadenylation.
The 5' cap is added to the 5' end of the mRNA during capping, and the poly-A tail is added to the 3' end during polyadenylation. Splicing removes introns and joins together exons to form a mature mRNA transcript.
Once these processing steps are complete, the mRNA can then bind to export proteins and exit the nucleus through nuclear pore complexes.
learn more about mRNA here:
https://brainly.com/question/29314591
#SPJ11