Which step of cellular respiration will not take place in the Absense of oxygen

Answers

Answer 1

In the absence of oxygen, the step of cellular respiration that will not take place is the electron transport chain (ETC). This occurs during the aerobic phase of cellular respiration, which requires oxygen as the final electron acceptor.

The step of cellular respiration that will not take place in the absence of oxygen is the electron transport chain. This is because oxygen serves as the final electron acceptor in this process, and without it, the chain cannot function properly. Without the electron transport chain, the energy stored in NADH and FADH2 cannot be fully extracted, leading to a buildup of these molecules and a decrease in ATP production. Therefore, in the absence of oxygen, cells must rely on alternative pathways such as fermentation to produce ATP. I hope this provides a thorough and long answer to your question.

To know more about respiration visit :-

https://brainly.com/question/18024346

#SPJ11


Related Questions

What does the y-axis show?
What does the red graph line represent?
After 20 years, how much plant biomass does a restored wetland contain?
After 55 years, how does the capacity of a restored wetland to absorb nutrients compare to that of a natural wetland?
Is the following statement supported or not supported by the data shown in the graph?
Most of the productivity of a wetland can be restored within 50 years, but it takes much longer to restore soil fertility.
Natural wetlands provide many ecosystem services. When a wetland is restored, which of the following ecosystem services returns most rapidly?
Is the following statement supported or not supported by the data shown in the graph?
The restoration of a wetland takes about 100 years

Answers

The graph below shows a comparison of the plant biomass and soil structure of restored wetlands to that of natural, undisturbed wetlands. This graph could be interpreted to answer the questions below:

The y-axis show: the percentage of recovery compared to natural wetlands.The red graph line represents: the plant biomass.After 20 years, the plant biomass restored wetland contains about: 80% of the biomass of a natural wetland.The capacity of a restored wetland to absorb nutrients compared to the natural wetland after 55 years is: about 40%.It takes longer to restore soil fertility, meanwhile most wetland productivity could be fixed in 50 years. This statement is relevant to data from the graph. Hence, the answer is: supported.When a wetland is restored, the ecosystem services that return most rapidly are to: provide food for fish and wildlife. “The restoration of a wetland takes about 100 years.” This statement is not relevant to the graph. Hence, it is not supported.

What is plant biomass?

The plant biomass (W) is a relation of the total weight of living plant material to its capacity of doing carbon assimilation. Biomass is the oldest source of energy, so it can be used as an energy source besides the sun. We can find those energies in any organic matter like wood, animal wastes, crops, seaweed, etc.

This question seems incomplete. The complete question is as follows:

“Scientists compared the plant biomass and soil structure of restored wetlands to that of natural, undisturbed wetlands. The graph shows their findings. Can you interpret the graph to answer these questions?”

Learn more about biomass energy here https://brainly.com/question/28793715

#SPJ4

What does the y-axis show?What does the red graph line represent?After 20 years, how much plant biomass

Which type of model is represented in the following image?

a

Computer simulation

b

Graph

с

Map

d

Small-scale object​

Which type of model is represented in the following image?aComputer simulationbGraphMapdSmall-scale object

Answers

Answer:

d

Explanation:

Its a map but showing the northern, southern, Eastern, and Western province of the earth.

A 15th century farmer finds a rock that looks exactly like a clamshell. What did he likely conclude about how the fossil got there?

Answers

Answer:

The land the farmer is on used to be filled with water and ocean and/or freshwater life

What was Friedrich Miescher's discovery?

Answers

Friedrich Miescher discovered DNA for the first time in 1869.

Miescher isolated the DNA. He was a swiss scientist and had a desire to study cell chemistry. He chose to start his study from white blood cells since it was readily available to him in the bandages from the hospitals. He was essentially trying to study the composition of lymphoid cells but discovered DNA. He isolated "nuclein," DNA with associated proteins, from cell nuclei and was the first to identify DNA as a distinct and novel molecule. Since he had isolated it from the nucleus of the cells he named it nuclein. This became a remarkable discovery in the past.

Learn more about protein:

brainly.com/question/29776206

#SPJ4

What type of mutation leads to a frameshift in the reading of DNA?
a. All point mutations
b. Insertions only
c. Deletions only
d. Both insertions and deletions

Answers

Both insertions and deletions can lead to a frameshift mutation in the reading of DNA.

A frameshift mutation occurs when the addition or removal of nucleotides disrupts the correct reading frame during translation.

In a frameshift mutation, the reading frame of the genetic code is shifted, causing all subsequent codons to be read incorrectly. This results in a significant alteration of the amino acid sequence of the resulting protein.

Insertions occur when one or more nucleotides are added to the DNA sequence, shifting the reading frame. This causes all subsequent codons to be read differently from their original arrangement.

Deletions, on the other hand, involve the removal of one or more nucleotides from the DNA sequence. This also disrupts the reading frame, leading to incorrect interpretation of subsequent codons.

Therefore, both insertions and deletions can introduce a frameshift mutation, which can have profound effects on the resulting protein's structure and function.

To learn more about mutations, here

https://brainly.com/question/13923224

#SPJ4

Please help with this!

Please help with this!

Answers

Red, Red, White
If it has a capital letter anywhere in the genotype that means it will be the dominant trait. If it has two lower case it’s the recessive.

Which of the following best describes how the human nervous system and
the endocrine system work together?
O A. The nervous system signals the endocrine system to release
hormones in response to a stimulus.
O B. The nervous system responds to a stimulus, and the endocrine
system returns the body to a relaxed state.
O C. The endocrine system signals the nervous system to send out
nerve impulses in response to a stimulus.
D. The endocrine system responds to a stimulus, and the nervous
system returns the body to a relaxed state.

Answers

The nervous system usually signals the endocrine system to release hormones in response to a stimulus. The correct option is A.

What is endocrine system?

The endocrine system, which is made up of all of the body's different hormones, regulates all physiological processes in the body from gestation through adulthood and to old age.

This regulation also include brain and nervous system development, reproductive system growth and function, metabolism, and blood sugar level.

The endocrine system and the nervous system collaborate to influence many aspects of human behavior, together with growth, reproduction, and metabolism. And the endocrine system is crucial in the regulation of emotions.

In response to a stimulus, the nervous system basically signals the endocrine system to release hormones.

Thus, A is the correct option.

For more details regarding endocrine system, visit:

https://brainly.com/question/3534540

#SPJ5

discuss the anatomical differences between strepsirhine and haplorhine primates. how do these anatomical differences influence behavior and socialization among the respective primate groups?

Answers

Strepsirhine and haplorhine primates are two suborders of primates that have several anatomical differences that influence their behavior and socialization.

Strepsirhines are considered the more primitive of the two suborders, and they have several distinct anatomical features that set them apart from haplorhines. One of the most significant differences is the presence of a moist rhinarium, which is a moist, hairless area around the nostrils that is used for olfactory communication.

Strepsirhines also have a dental comb, a specialized set of lower incisors and canines that are used for grooming and obtaining food. Additionally, they have a tapetum lucidum, a layer of reflective cells in the eye that enhances night vision.

Haplorhines, on the other hand, lack a moist rhinarium and dental comb, and they have a more forward-facing placement of their eyes. They also lack a tapetum lucidum, which suggests that they are more diurnal than strepsirhines.

These anatomical differences have significant implications for the behavior and socialization of these primates. Strepsirhines tend to be more solitary and less social than haplorhines, and they rely heavily on olfactory communication for social interactions. The presence of the dental comb suggests that grooming is a crucial part of their social behavior. The tapetum lucidum enhances their night vision, allowing them to be more active at night, which may influence their behavior and socialization patterns.

Haplorhines, on the other hand, tend to be more social and less reliant on olfactory communication. They have a more forward-facing placement of their eyes, which enhances their depth perception and color vision, allowing them to be more diurnal and visually oriented. The lack of a dental comb suggests that grooming is less important in their social behavior, and they may rely more on other forms of social bonding, such as vocalizations and physical contact.

learn more about haplorhine primates here:

https://brainly.com/question/29736185

#SPJ11

What are ways that a young plant differs from a parent plant

Answers

Answer:

their size

Explanation:

The most distinct difference between a baby plant and an adult plant is their size. They look very similar but baby plants are much smaller, like a miniature version.

Approximately 45 percent of the human genome is derived from transposable elements, such as LINES and SINES.
(i) What are LINES and SINES?
1. (ii) How do LINES differ from SINES?
(iii) How is survival possible with this high a percentage of transposable elements in the human genome?

Answers

LINES (Long Interspersed Nuclear Elements) and SINES (Short Interspersed Nuclear Elements)are types of transposable elements in the human genome.

(i) LINES and SINES are both DNA sequences that can change their positions within the genome, leading to genetic variations.

(ii) LINES differ from SINES primarily in their length and mode of transposition. LINES are longer (usually 6-7 kb) and encode a reverse transcriptase enzyme. SINES are shorter (100-300 bp) and do not encode a reverse transcriptase enzyme.

(iii) Survival is possible with a high percentage of transposable elements in the human genome because not all of these elements are harmful. In some cases, they may provide beneficial genetic variations or be neutral in their effect.

Additionally, the human genome has evolved mechanisms to suppress the harmful effects of these elements, such as DNA repair systems and epigenetic modifications that can silence transposable elements.

Learn more about the human genome here:

https://brainly.com/question/10551438

#SPJ11

To raise an arm upward, the muscle on one side of it contracts.

What happens to the muscle on the opposite side of the arm?

a
contracts
b
relaxes
c
both contracts and relaxes
d
neither contracts nor relaxes

Answers

Answer is option B. Relaxes

Answer:

relaxes

Explanation:

when we lift our arm, muscle on the one side of the arm contracts while other side's muscle relaxes

Carbon, hydrogen, oxygen, nitrogen, and phosphorus atoms can combine to form a nucleotide. Many nucleotides can combine to form a nucleic acid. Which sentence is true?
A. Nucleotides are monomers, and nucleic acids are macromolecules.
B. Nucleotides are atoms, and nucleic acids are macromolecules.
C. Nucleotides are monomers, and nucleic acids are proteins.
D. Nucleotides are macromolecules, and nucleic acids are monomers.

which one is A. B. C. or D.​

Carbon, hydrogen, oxygen, nitrogen, and phosphorus atoms can combine to form a nucleotide. Many nucleotides

Answers

Answer:

A. Nucleotides are monomers, and nucleic acids are macromolecules.

Explanation:

A nucleotide is a small molecule consisting of a nitrogenous base, a five-carbon sugar (ribose or deoxyribose), and one or more phosphate groups. Nucleotides serve as the building blocks or monomers of nucleic acids, such as DNA and RNA.

Nucleic acids are macromolecules composed of long chains of nucleotides that are joined by covalent bonds between the sugar of one nucleotide and the phosphate group of another. These chains can be very long, with DNA molecules consisting of millions or billions of nucleotides.

Therefore, nucleotides are the monomers, or building blocks, of nucleic acids, which are macromolecules made up of many nucleotides joined together.

predict what will happen when the shaker is turned on if elephants communicate using only sound traveling through the air and not the ground.

Answers

Elephants do communicate using sounds that travel through both the air and the ground. They produce a variety of vocalizations, including trumpets, grunts, rumbles, and chirps, which can be heard by other elephants several kilometers away.

Assuming, however, that elephants communicated only through sound waves that travel through the air and not the ground, if a shaker were turned on in their vicinity, it is possible that the loud noise could interfere with their ability to communicate with one another. The noise might mask or distort their vocalizations, making it harder for them to communicate effectively.

However, it is important to note that elephants have evolved to communicate in a variety of ways, and they are likely to adapt to environmental challenges like loud noises. They may alter the frequency or volume of their vocalizations or use non-vocal means of communication, such as body language or tactile signals. Ultimately, it is difficult to predict with certainty how elephants would respond to a specific situation like this, as it would depend on a range of factors, including the context, the individual elephants involved, and their prior experiences.

Learn more about vocalizations  here: brainly.com/question/31182301

#SPJ11

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

Which plant response is affected by photoperiod?; Which of the following is the factor that initiates flowering in long day plants?; Is directional growth responses of plants to a unidirectional source of light?; How do plants respond to a decrease in environmental temperature?

Answers

The flowering, setting of winter buds, and vegetative growth of plant response are affected by photoperiod.

The timing and length of day and night trigger a biological reaction known as photoperiodism. It regulates the development of winter buds, vegetative growth, and flowering. Detection of seasonal variations is vital to plant life.

The majority of plants are sensitive to photoperiod in many different ways, including seed germination, leaf formation rate, leaf blade length and width expansion, dry matter generation, and partitioning, in addition to its effects on generative growth.

The reaction to variations in day length that enables plants to adjust to seasonal changes in their environment is called photoperiodism.

To learn more about Photoperiod visit: https://brainly.com/question/13161605

#SPJ4

Question 1 of 5
Joaquin is doing an experiment with a ramp and a ball. He
wants to know how the slope of a ramp will affect the
speed of the ball when it reaches the end of the ramp.
Which step allows Joaquin to use his imagination in this experiment?
A. Identify the variables in the experiment.
B. Accurately record the results in a data table.
C. Decide which type of ball to use.
O D. Measure the angle between the ramp and the floor.

Answers

Answer:

Explanation:

The answe is c

The step that allows Joaquin to use his imagination in this experiment is to decide which type of ball to use. The correct option is C.

What is an experiment?

An experiment is a process of constructing a result by using variables. The variables are manipulated and the effect of manipulation is observed in the result. Controls are frequently used in experimental designs to monitor system variability and look for error sources.

Joaquin is testing a ramp and a ball in his experiment. He is curious about how a ramp's slope will impact the ball's speed as it approaches the ramp's conclusion. Deciding first which type of ball should be used can help in imaging the effect of slope on the ball.

Thus, the correct option is C. Decide which type of ball to use.

To learn more about an experiment, refer to the below link:

https://brainly.com/question/11256472

#SPJ2

A scientific idea tested by multiple scientists and supported by multiple lines of tested
factual evidence is a...

Answers

Answer:

Theory

Explanation:

A well tested scientific idea, supported by multiple lines of tested factual evidence is a theory.

An abnormally low production of gonadotropin produces a condition called __________.a. Eicosanoidsb. Hypogonadismc. Dietary iodided. Addison disease and Cushing disease

Answers

An abnormally low production of gonadotropin produces a condition called hypogonadism (option b).

Hypogonadism refers to a decreased or inadequate production of gonadotropins, which are hormones released by the pituitary gland that stimulate the gonads (testes in males, ovaries in females).

This hormonal deficiency can result in impaired development and function of the gonads, leading to reduced or absent production of sex hormones (such as testosterone in males and estrogen in females) and subsequent effects on sexual development and fertility.

Hypogonadism can be either primary, originating in the gonads themselves, or secondary, caused by a dysfunction in the pituitary gland or hypothalamus, which regulate gonadotropin production.

Therefore, the correct option is b. hypogonadism.

Learn more about hypogonadism here: https://brainly.com/question/18319243

#SPJ11

If a DNA molecule is made up of 14% Thymine, theoretically, what percentage would be made up of Guanine?

Answers

Answer:

I expect to find

Explanation:

A=30% C= 20% T = 36% G=14%

the effects of a poison on actively respiring mitochondria are being studied to determine its mode of action. when the poison is added, every component of the electron transport chain is found to be in its reduced form based on spectroscopic analysis, and atp production ceases entirely. it is reasoned that the poison is either blocking the final transfer of electrons to oxygen or is blocking the atp synthase. which of the following experiments will help unravel this dilemma? a) add a second blocking agent to interfere with either complex i or complex ii along with the poison. b) add an artificial electron donor along with the poison. c) add an uncoupling agent along with the poison. d) any of the above would allow differentiation between these two possibilities. e) none of the above will help distinguish between these two possibilities.

Answers

The most suitable experiment to unravel the dilemma regarding the mode of action of the poison on actively respiring mitochondria would be option D. Any of the above would allow differentiation between these two possibilities.

To understand the effects of the poison on the electron transport chain and ATP production, conducting additional experiments is necessary. Adding a second blocking agent to interfere with either complex I or complex II along with the poison would help differentiate between the two possibilities.

If the poison's effect is still observed despite the additional blocking agent, it suggests that the poison is not blocking the specific complex targeted by the second agent, supporting the hypothesis that the poison is blocking ATP synthase.

Adding an artificial electron donor along with the poison would help determine if the poison is blocking the final transfer of electrons to oxygen. If ATP production resumes when an external electron donor is provided, it indicates that the poison is indeed blocking the transfer of electrons to oxygen.

Adding an uncoupling agent along with the poison can provide valuable insights. An uncoupling agent disrupts the coupling between electron transport and ATP synthesis. If ATP production is restored when the uncoupling agent is added, it suggests that the poison is blocking ATP synthase rather than the transfer of electrons to oxygen. Therefore, the correct answer is option D.

know more about ATP production here:

https://brainly.com/question/893601

#SPJ8

How do basaltic rocks differ from granitic rocks?

Basaltic rocks are more dense and cool more quickly than granitic rocks.
Basaltic rocks are less dense and cool more quickly than granitic rocks.
Granitic rocks are more dense and cool more quickly.
Granitic rocks and basaltic rocks both are very dense and cool quickly.

Answers

Answer:

a Basaltic rocks are more dense and cool more quickly than granitic rocks.

Identify the correct order of organization of genetic material from largest to smallest.AChromosome, Genome, Nucleotide, Gene.BChromosome, Gene, Genome, Nucleotide.CGenome, Chromosome, Nucleotide, Gene.DGenome, Chromosome, Gene, Nucleotide.

Answers

The right hierarchy for organizing genetic material is genome, chromosome, gene, and nucleotide, from largest to smallest.

What does genetic material mean in plain English?

The fact that carries hereditary data makes inherited material the material. All the hereditary material of the cell is situated in the core as chromatin. The core is the regulator of the cell which controls every one of the exercises of the cell.

What makes up a human's genetic makeup?

An individual's hereditary cosmetics is known as a genotype. People commonly have 23 sets of chromosomes, or 46 chromosomes altogether. Chromosomes are comprised of long strands of DNA, which contain every one of the body's qualities.

To know more about genetic material visit:

brainly.com/question/14530382

#SPJ4

phenotypic and genetic characterization of chilean isolates of botrytis cinerea with different levels of sensitivity to fenhexamid

Answers

The study aimed to characterize phenotypic and genetic variations among Chilean isolates of Botrytis cinerea, a fungal pathogen causing gray mold in various crops. The focus was on examining the sensitivity levels of these isolates to fenhexamid, a fungicide commonly used for gray mold control.

Phenotypic characterization involved assessing the sensitivity of different isolates to fenhexamid through laboratory assays. Isolates with varying degrees of sensitivity to the fungicide were identified and classified accordingly.

Genetic characterization aimed to understand the genetic basis underlying the different sensitivity levels. Molecular techniques, such as DNA sequencing and genetic analysis, were used to examine specific genes or genetic regions associated with fungicide sensitivity. By comparing the genetic profiles of different isolates, researchers could identify potential genetic markers or mutations linked to fenhexamid sensitivity.

The combined phenotypic and genetic characterization provided valuable insights into the diversity and mechanisms of fenhexamid sensitivity in B. cinerea isolates from Chile. This information can aid in the development of effective disease management strategies, including the optimization of fungicide use and the identification of alternative control methods.

To know more about phenotypic click here:

https://brainly.com/question/28474179

#SPJ11

Human eye color is an example of a phenotype that results from the ________ multiple gene products (enzymes and proteins).

Answers

Human eye color is an example of a phenotype that results from the interaction of multiple gene products.

Is eye color determined by genetics?A person’s eye color results from the pigmentation of a structure called the iris, which surrounds the tiny black hole which is located in the center of the eye (the pupil) and helps control the intensity of the light that enters the eye.The color range of the iris is from very light blue to dark brown. Brown is the most frequent eye color worldwide.Eye color is decided by variations in a person’s genes.Most of the genes related to eye color are involved in the production, transport, or storage of a pigment called melanin.Eye color is directly associated with the amount of melanin in the front layers of the iris. People with brown eyes have an outsized amount of melanin in the iris, while people with blue eyes have much less of this pigment.

Therefore, human eye color is an example of a phenotype that results from the interaction of multiple gene products.

To learn more about eye color:

brainly.com/question/1218649

#SPJ4

frebel, h., richter, k. and oxenius, a., how chronic viral infections impact on antigen-specific t-cell responses. eur. j. immunol. 2010.

Answers

The ability of a cell or a body to fight against the infection is called immunity. The T cell and B cell helps the body to fight against the infection.

What are T cells?

T cell is also called as T lymphocyte, it is also a important part of immune system. T cell originate in the bone marrow and mature into the thymus.

There are three types of T cells:

T helper cellT killer cellsT cytotoxic cells.

Helper T cells secrete chemical messengers called cytokines. Regulatory T cells helps to control immune reactions. They are released into blood streams.

Therefore, The ability of a cell or a body to fight against the infection is called immunity. The T cell and B cell helps the body to fight against the infection.

To learn more about T cells, refer to the link:

https://brainly.com/question/1434048

#SPJ4

which of the following is an example of a secondary cause of lymphedema

milroys disease
meiges disease
inherited late-onset lymphedema
surgery, radiation, or cancer​

Answers

Milroys disease is an example of a secondary cause of lymphedema.

What does lymphedema's secondary cause entail?If your lymphatic system is harmed as a result of surgery, trauma, or radiation therapy, you might develop secondary lymphedema. The majority of persons with lymphedema have undergone treatment for breast cancer. Having said that, lymphedema may not always result from breast cancer therapy. Lymphedema in the lower legs and feet is often present at birth or develops throughout infancy in people with Milroy illness. Usually affecting both sides of the body, lymphedema can get worse with time. In addition to lymphedema, Milroy illness is linked to additional symptoms. Changes (mutations) in the genes in charge of the lymphatic system's development result in primary lymphoedema.

To learn more about lymphedema refer to:

https://brainly.com/question/2038216

#SPJ1

Consider this animal cell. The organelles in an animal cell are labeled. Part D are stacked tubular structures. Which organelles are labeled D, and what is one feature that distinguishes them from the other labeled organelles? chloroplasts; the only organelles that produce sugars from sunlight ribosomes; only found in animal and bacterial cells centrioles; found in animal cells but not plant cells mitochondria; the only energy-generating structures found in cells

Answers

Answer:

The image of the animal cell was not included in the question, the image has been added as an attachment.

The answer is centrioles; found in animal cells but not plant cells

Explanation:

According to the question, the image in the attachment section is an animal cell with labelled organnelles. An animal cell does not possess a Chloroplast, which is unique to only plant cells. Hence, organnelles D cannot be Chloroplast.

Ribosomes are organnelles made up of a complex of RNA and proteins. They are the site of protein synthesis, which occurs in all living cells. Hence, all cells including plant and animal cells contain Ribosome organnelles. Therefore, it is a wrong choice.

Centrioles are cylindrical tube-like structures made up of microtubules arranged in a specific pattern. Centrioles are present only in animal cells and play a major part in cell division, where they organize microtubules that separate chromosomes. As seen in the image, the two centrioles are perpendicular to one another, forming a CENTROSOME. A plant cell does not possess centrioles instead they contain microtubules organizing centres (MTOC).

Mitochondrion are present in both animal and plant cells as energy-generating organnelles but they are not stacked tubular structures as described in the question.

Consider this animal cell. The organelles in an animal cell are labeled. Part D are stacked tubular structures.

Answer:

its b on edge 2022

Explanation:

I WILL GIVE BRANLIEST
In which way will energy be used after it leaves the mitochondrion during cellular respiration?


A.repairing parts of damaged tissue

B.combining with carbon dioxide

C.building new oxygen molecules

D.starting the second stage of respiration

Answers

Answer:

A

I think the energy from the mitochondrion will be transferred to the broken tissue throughout the body.

how does the shape of a nerve cell help the nervous system send messages

Answers

Answer:

Why are nerve cells shaped the way they are? Nerve cells are shaped like long wires so they can carry messages form one end of the body to the other. Some nerve cells in the brain can keep their information and send out messages for a long time.

Explanation:

Which of the following pairs of molecules share the same chemical composition but differ in molecular structure?
A. starch and glycogen
B. glucose and fructose
C. DNA and RNA
D. lactose and sucrose

Answers

Lactose and sucrose are not the same in molecular structure, even though they share the same chemical composition.

Lactose and sucrose are both disaccharides, which means they are composed of two monosaccharide units. Lactose consists of galactose and glucose linked together, while sucrose is formed by a bond between glucose and fructose.

Although they have the same chemical composition (C12H22O11), the difference in molecular structure results from the type of monosaccharide units and the linkage between them. This structural difference leads to distinct properties and functions in biological systems. In conclusion, lactose and sucrose differ in molecular structure despite having the same chemical composition.

Know more about lactose and sucrose, here:

https://brainly.com/question/13154729

#SPJ11

Other Questions
Which of the following statements describes process costing system? A. Direct materials and direct labor are traced to each specific order. B. Costs flow directly from a single Work in Process Inventory account to Finished Goods Inventory. C. Costs flow through a sequence of Work in Process Inventory accounts and then into Finished Goods Inventory from the final Work in Process Inventory account. D. The subsidiary Work in Process Inventory accounts consist of separate records for each individual order, detailing the materials, labor, and overhead assigned to that order. What evidence of climate change on continents supports the theory of continental drift? If you spend $50 (including shipping) at an online store, you recieve a $10 gift card. You want to purchase CDs that cost $12 each. If shipping cost $5, write and solve an inequality to find the number of Cds you must to receive the giftcard. a therapist who uses client-centered therapy and endeavors to create a warm and caring environment, never disapproving of the client as a person, is engaging in sallyport 4/5 gallon of water into a bird by the next morning she finds 3/4 of water gone. What is the amount of water,in gallons, that is gone. A. 7\9 gallonsB. 3/5 gallonsC. 1/4 gallonsD. 1/5 gallons Scientists can use rock layers to determine which of the following? (3 points)a. The mass of Earthb. The size of Earthc. The age of Earthd. The amount of land on Earth A blue color appears if Cocaine is present in this spot test:A blue color appears if Cocaine is present in this spot test:a)Van Urkb)Dillie-Koppanyic)Scottd)Marquis Approximately what percent of the sunlight striking the earth is actually captured by the biosphere on any given day? brainloy An artificial satellite of mass 900kg Is launched at a speed of 11,000 m/s from its launching station. How much is the kinetic energy imparted to it? The use of bribes, which are illegal for U.S. companies, relate best to which of the following environmental forces Tuesdays With Morrie: Who or what is the saving grace that comes into Morrie's life? What does this "saving grace" bring into Morrie's life? Write out 5 (five people whoContributed in the development ofComputer Two different cars each depreciate to 60% of their respective original values. The first car depreciates at an annual rate of 10%. The second car depreciates at an annual rate of 15%. What is the approximate difference in the ages of the two cars? 1. 7 years 2. 0 years 3. 1 years 5. 0 years. Express each ratio as a fraction in simplest form.5 miles to 35 miles Harmony earns a $42,000 salary in the first year of her career. Each year, she gets a 4%, percent raise.Which expression gives the total amount Harmony has earned in her first n years of her career? Plz help me plz I am timed!! PPC(production possibility curve) shows the combination of 2 goods which can be produced using the given resources in a given period of time. It is concave to ... paraphilia in which persons have repeated sexually arousing urges or fantasies about exposing their genitals to another person; may act upon these urges.exhibitionism Consider the following reversible reaction. Upper H subscript 2 upper O (g) double-headed arrow 2 upper H subscript 2 (g) plus upper O subscript 2 (g). What is the equilibrium constant expression for the given system?. Part BApply the law of conservation of energy to solve the following problem to find velocity.A food packet is dropped from a helicopter during a flood-relief operation from a height of 750 meters. Assuming no drag (air friction), what will the velocity of the packet be when it reaches the ground?