Which two explanations are based on personal beliefs?
A. Observations made using telescopes can predict how a
constellation's shape will change.
B. People who are born under a certain astrological sign have a
tendency toward certain personality traits.
c. Satellite obserzlutions show that North America is moving at a
rate of a few millimeters per year.
D. Chemical data collected from rock formations show that Earth is
billions of years old.
E. The arrangements of stars into constellations happened as a
result of the actions of supernatural beings.

Answers

Answer 1
B and E, since not everyone believes in supernatural beings or the affects of astrological signs

Related Questions

What is a dichotomous key

Answers

Answer:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts"

Explanation:

distribution of chlorophyll, stomata, mesophyll cells and vascular bundles support photosynthesis

Answers

Yes, the distribution of chlorophyll, stomata, mesophyll cells, and vascular bundles supports photosynthesis.

Let us discuss each separately.

Chlorophyll: It absorbs light energy from the sun, which is essential for photosynthesis. The distribution of chlorophyll within the mesophyll cells ensures that it is positioned optimally to capture sunlight.Mesophyll cells: Mesophyll cells are the main site of photosynthesis in plant leaves. It contains chloroplasts and provides a spongy texture to the leafy surface.Stomata: Stomata are small openings on the surface of leaves that regulate gas exchange, including the uptake of carbon dioxide (CO2) required for photosynthesis and the release of oxygen (O2) produced during photosynthesis. Vascular bundles: Specialized tissues composed of xylem and phloem, responsible for transporting water, minerals, sugars, and other substrates throughout the plant body.

To know more, refer to;

https://brainly.com/question/29764662

(ix) Rh blood group system is encoded by three genes C, D and E which occupy----
tightly linked loci
(A) four
(B) three
(C) five
(D) two

Answers

Rh blood group system is encoded by three genes C, D and E which occupy 3 tightly linked loci. Option B

What should you know about Rh blood group system?

The Rh blood group system is typically considered to be encoded by three loci namely; one for RHD, and two for the RhCE (C and E) antigen variations.

The RHD locus is known to encode the D antigen, which is the most important Rh antigen.

The RhCE locus encodes the C and E antigens, which are less common than the D antigen.

The Rh blood group system is important for blood transfusions, as it determines whether or not a person's blood is compatible with another person's blood.

Find more exercises on Rh blood group system;

https://brainly.com/question/30668976

#SPJ1

Can you plz help you smart people I need you to help me 10 points

Can you plz help you smart people I need you to help me 10 points

Answers

B: situation 7 !

The mama bear fights and charges into the external stimuli

what is the function of brain hxhtojuqat​

Answers

Answer: buuu

Explanation:

The above figure gives the cost figures for Jones farm which produce es wheat and sells it in the competitive market for wheat. The quantity of wheat produces in the figure is in the thousands of bushels. At the market price of $10 for wheat Jones farm will reduce thousand bushels of wheat in the short run, and make a profit of

Answers

The above figure gives the cost figures for Jones Farm which producees wheat and sells it in the competitive market for wheat. The quantity of wheat produces in the figure is in the thousands of bushels.

At the market price of $10 for wheat Jones farm will reduce a thousand bushels of wheat in the short run, Jones farm will produce 4,000 bushels of wheat in the quick run and make earnings of $10,000.

To answer this question, you need to discover the income-maximizing output stage for Jones Farm, that is wherein the marginal revenue (MR) equals the marginal cost (MC). Since the market rate of wheat is $10 and Jones Farm is a fee-taker in an aggressive marketplace, the MR is likewise $10.

Looking at the discerning, you could see that the MC curve intersects the MR line at 4,000 bushels. This manner that Jones Farm will produce 4,000 bushels of wheat in the quick run to maximize its income.

To find the profit, you want to subtract the full value (TC) from the full revenue (TR). The TR is manufactured from the fee and the amount, which is $10 x 4,000 = $40,000.

The TC is given by the TC curve at 4000 bushels, which is $30,000. Therefore, the income is $40,000 - $30,000 = $10,000.

To know more about the market,

https://brainly.com/question/30188523

#SPJ1

The above question is;

"The above figure gives the cost figures for Jones farm which produce es wheat and sells it in the competitive market for wheat. The quantity of wheat produces in the figure is in the thousands of bushels. At the market price of $10 for wheat Jones farm will reduce thousand bushels of wheat in the short run, and make a profit of"

The above figure gives the cost figures for Jones farm which produce es wheat and sells it in the competitive

How would you explain the key concepts for the CWA in less than two minutes?

Answers

Answer:

Explanation:

vPoint Source - a source of water discharged to surface water through a discrete point - generally through a pipe, ditch, or channel.

Nonpoint Source - Nonpoint sources, such as parking lots or athletic fields, discharge runoff water to groundwater or surface water; runoff does not come from  a pipe, ditch, or channel. These sources may contain pollutants such as pesticides, motor oil, and soaps.

Navigable Waters of the United States  For the purposes of the Clean Water Act, the term "navigable waters" includes:

all waters used in commerce, including groundwater;

all interstate waters including wetlands, mudflats, and sand-flats; and

all other waters such as lakes, rivers, streams, wetlands and sloughs.

EPA policy states, "The majority of facilities in the U.S. have the potential to discharge to navigable waters."  The Supreme Court decision in (2006) requires the Army Corps of Engineers and the EPA to determine whether there is a "significant nexus" between a navigable waterway and an area a spill might affect.  In June of 2007, EPA and the Army Corps of Engineers released provisional interpretive guidance regarding the "significant nexus” question. According to this guidance, the agencies will assert jurisdiction over traditional navigable waters, wetlands adjacent thereto, and relatively permanent tributaries thereof. The agencies will generally not assert jurisdiction over swales and ditches that lack routine water flow. Finally, the agencies will apply the "significant nexus" requirement and make a case-by-case, fact-specific analysis on impermanent tributaries and other wetlands.

Additional executive orders were issued 2015 in 2019.  Under the 2019 proposal, traditional navigable waters, tributaries to those waters, certain ditches, certain lakes and ponds, impoundments of jurisdictional waters, and wetlands adjacent to jurisdictional waters would be federally regulated. It also details what are not "waters of the United States," such as features that only contain water during or in response to rainfall (e.g., ephemeral features); groundwater; many ditches, including most roadside or farm ditches; prior converted cropland; stormwater control features; and waste treatment systems.

Could the requirement for one or more NPDES Discharge Permit apply to my campus?

If your campus discharges pollutants directly to navigable waters of the United States through a point source, you must obtain an NPDES permit or redirect the flow of the waste.

Stormwater releases from certain activities require an NPDES permit. The most common activities on college campuses requiring NPDES permits for stormwater are construction activities disturbing more than 1 acre, hazardous waste storage areas operating under the Resource Conservation and Recovery Act permit system, steam-generating power plants, and airports. See Stormwater section below.

Regulations issued by local water authorities, or Publicly Owned Treatment Works (POTWs), not NPDES permits, govern discharges into sanitary sewer systems. See Sewer Use (POTW) section below for more information about requirements for using POTWs for commercial or industrial waste disposal.

What do I have to do related to NPDES Discharge Permits?

Determine where wastewater flows from buildings and processes on your campus. Any industrial or commercial operation (e.g., ice rink melt pits, floor drains, and vehicle wash stations) that discharge into a water of the United States may require an NPDES permit. If required, you must obtain such a permit from the appropriate regulatory agency, probably your state environmental agency.

French drains, dry wells, and septic system leach fields are different from point source discharges because they do not immediately affect surface water. Some state and federal environmental agencies manage these systems under the Underground Injection Control program, part of the Safe Drinking Water Act. See Safe Drinking Water Act for more information.

Details of NPDES

A baby with type AB blood is born into a family where the mother has type B blood and the

father has type O blood.

(i) Determine whether the husband is the biological father of the baby.

(ii) Explain your answer in (i) above.​

Answers

Explanation:

as we know a man who has type AB blood could not father a child with type O blood, because he would pass on either the A or the B allele to all of his offspring. Despite their usefulness in this regard, ABO blood groups cannot be used to confirm whether a man is indeed a child's father.

thus, the husband isnt the biological father of the baby.

Bases on your data, which area on the South American continent would have the greatest risk of a
volcanic eruption? How could people living in this area be prepared in the event of a sudden and
violent volcanic eruption?

Answers

The most hazardous volcanoes are mainly concentrated in the northern (Ecuador, Costa Rica, Guatemala, México and El Salvador) and southern (Chile-Argentina).

Take cover from the volcanic ash temporarily where you are. Ventilation holes should be sealed, and doors should be covered. Do not drive through dense ash. Keep the windows up and avoid using the air conditioning if you must drive.

What is eruption in a volcano?When lava and gas are released from a volcano, often explosively, this is known as an eruption. A "glowing avalanche," which occurs when recently erupted lava slides down the flanks of a volcano, is the most hazardous type of eruption.Because of how hot it is deep below the Earth, some rocks slowly melt and turn into lava, a viscous fluid. Since magma is lighter than the surrounding solid rock, it rises and gathers in magma chambers. Some of the magma eventually surges through fissures and vents to the Earth's surface.

To learn more about : eruption in a volcano

Ref : https://brainly.com/question/824390

#SPJ9

I have this segment of DNA for one strand: 5' ATGCATTGA3'. Predict the sequence of the next strand.

Answers

Answer:

5' TACGTAACT 3'

Explanation:

Complementary strands.

5’ TACGTAACT 3’ would be correct because that is the complementary strand

How is editing the genetic code?; Is genetic modification artificial selection?; How is artificial selection different from genetic engineering ?; How does genetic engineering differ from selective breeding?

Answers

Humans can change a species' members through genetic engineering and artificial selection to make them better suited to human needs.

However, the method for change is different. Artificial selection selects for existing qualities in a species, whereas genetic engineering develops new traits.

Scientists use artificial selection to breed only individuals with desirable features. For example, for many generations, scientists may breed (cross pollinate) only the highest yielding crops with one another.

The outcome is a population of plants that all generate a larger yield (e.g., copious fruit output) than other members of the species. Scientists can modify the qualities of a population through selective breeding. Evolution has taken place.

Learn more about to genetic engineering  visit here;

https://brainly.com/question/13491558

#SPJ4

Who tried to help Canadian rebellions?

Americans
Intuits
French
British

Answers

Answer: Americans

Explanation: With the help of American volunteers, a second rebellion was launched in November 1838. However, it too was poorly organized and was quickly put down. It was followed by further looting and devastation in the countryside. The two uprisings left 325 people dead, all of them rebels except for 27 British soldiers. Nearly 100 rebels were captured. After the second uprising failed, Papineau left the US for exile in Paris.

British is the correct answer

As the temperature of a sample of gas decreases, the kinetic energy of the


increases

Decreases

Stays the same

Answers

It’s increase I believe

Explain which of the two plants in the following scenario would most likely grow taller, and why.

One oak tree is growing by itself on a lawn. A second oak tree is growing in a forest surrounded by other oak trees.

Answers

Answer:

The oak tree in the lawn will grow faster because it doesn't have to compete with the other oak trees to gain sunlight because it is out in the open. So therefore it will grow taller because it has access to more sunlight.

Explanation:

Hope this helped

6. In a non-competitive environment what is the result of a catastrophic disturbance? I

Answers

Answer:Ecologists generally distinguish between relatively small, frequent disturbances and large, infrequent, so-called "catastrophic" disturbances. ... Examples of the large, infrequent disturbances include volcanic eruptions, hurricanes, and major wildfires

Explanation:

Answer:

They typically cause a sudden decrease in population size, and in some cases may eliminate entire subpopulations

Explanation:

George bought a pair of jeans from an online
store. When they arrived, he found that they
were too small to wear. What could George do
in order to fit into the jeans?
A. George could lose mass and, therefore, weight.
B. George could fit into the jeans easier on the Moon.
C. George could increase his volume to better fit into the jeans.
D. George could increase the amount of his mass by eating more.

Answers

Answer:

A, If I made the multiple choice I would add "check your SIZE before buying!!"

Explanation:

A) lose Max’s and therefore weight

What is the first branch of the evolutionary tree

Answers

The first branch of the evolutionary tree is believed to be the separation between prokaryotes (organisms lacking a cell nucleus) and eukaryotes (organisms with a cell nucleus).

The evolutionary tree, also known as the tree of life or phylogenetic tree, represents the evolutionary relationships between all living organisms on Earth. It illustrates the diversification of life over time, showing how different species are related to one another through common ancestors.

1. The first step in understanding the first branch of the evolutionary tree is to recognize that all life on Earth can be classified into three main domains: Bacteria, Archaea, and Eukarya.

2. Among these domains, Bacteria and Archaea are considered prokaryotes, which are single-celled organisms lacking a membrane-bound nucleus. They are believed to have diverged from a common ancestor.

3. Eukarya, on the other hand, comprises organisms with eukaryotic cells, which possess a nucleus surrounded by a membrane. This domain includes all complex organisms such as plants, animals, fungi, and protists.

4. The separation between prokaryotes and eukaryotes is considered the first major branch in the evolutionary tree. It represents a fundamental divergence in cellular structure and complexity.

5. While the exact details and timing of this divergence are still the subject of scientific investigation, it is generally believed to have occurred billions of years ago, early in the history of life on Earth.

6. This initial split paved the way for the subsequent diversification of life, leading to the vast array of species and ecosystems we observe today.

7. It is important to note that the evolutionary tree is a constantly evolving representation of our understanding of the relationships between organisms. New discoveries and advances in scientific knowledge may lead to revisions and refinements of the tree over time.

For more such questions on organisms, click on:

https://brainly.com/question/17943188

#SPJ8

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

A specific location in America produces electricity from fossil fuels and geothermal energy. The table below shows the amount of carbon dioxide in the atmosphere of the location from 1960 to 2000.


Year 1960 1970 1980 1990 2000
Carbon dioxide concentration (in parts per million by volume) 317 325 339 318 328


Based on the table, which of these conclusions is most likely correct?
In 1990, electricity was generated only from fossil fuels.
In 1980, electricity was generated only from geothermal energy.
Between 1960 and 1970, there was an decrease in the use of geothermal energy.
Between 1980 and 1990, there was a decrease in the use of geothermal energy and an increase in the use of fossil fuels.

Answers

According to questions in the years 1960 and 1970, the amount of geothermal and fossil fuels decreased because there is low emission of carbon dioxide during these years, hence option C is correct.

What are fossil fuels?

Fossil fuels are a source of a nonrenewable form of energy generated by animals and plants which existed in the geological past.

The burning of fossil fuels generates carbon dioxide, so in the year between 1960 and 1970, there was a decrease in the use of geothermal energy.

Therefore, a low concentration of carbon dioxide indicates a decrease in the use of fossil fuels.

Learn more about fossil fuels, here:

https://brainly.com/question/29770775

#SPJ1

Answer:

Ya tu m'a arnaké

Explanation:

The primary vectors used in gene therapy are:a. fungib. virusesc. bacteriad. mosquitose. prescription drugs

Answers

The primary vectors are chosen because they can deliver material when they infect a cell. They are modified so the infection won't cause a disease. It is the viruses. Therefore, the correct answer is b.

If you were to weigh a car's sealed air bag before and after it inflates the weight would.

Answers

If you could weigh a sealed air bag before and after it inflates, the weight would increase and decrease. this is a property of a  matter.

what are the properties of a matter ?

A property is a structural characteristic of a system that is independent of the system's size or the volume of its constituent parts.

Volume and internal energy are extensive qualities while density, pressure, and temperature are intensive ones.

Temperature, T, refractive index, n, density, and object hardness are a few examples of intensive attributes, these are  all physical characteristics of matter fit within those categories.

learn more about matter, here

https://brainly.com/question/28200017

#SPJ1

A week bond between two hydrogen molecules;found between water molecules and nucleotides in DNA

Answers

Answer:The weak bond between two hydrogen atoms, which is commonly found between water molecules and nucleotides in DNA, is called a hydrogen bond.

Explanation:

Answer: Hydrogen Bond

Explanation:

2. What structure caused rotifers to be called wheel animals or wheel bearers?
1 the foot
2 the corona
3 the brain
4 the stomach

Answers

The structure that caused rotifers to be called wheel animals or wheel bearers is the corona.

Rotifers are also known as wheel animals or wheel bearers because of the corona structure around their mouth region.

Some rotifers are sessile and live inside tubes or gelatinous holdfasts that are attached to a substrate. Other rotifers migrate around a substrate through inch worming.

This is because when corona is seen in a sequential coordinated movement, it resembles the structure of a wheel, although it does not rotate in reality.

Therefore, we conclude that rotifers are called wheel animals or wheel bearers due to the presence of the corona structure.

Learn more about rotifers here: -

brainly.com/question/13746360

#SPJ1

The cactus plant and the camel can both live in the dessert. Water is very limited in the
dessert but yet, both animals can survive long periods of time without it. What is one
way that the cactus plant and the camel are similar?
A. They don't need water at all.

B.They go outside of the desert for water each day.
C.They receive water from the constant rainfall in the desert.


D.They have ways to store water for long periods of time.

Answers

It’s D since cactus collect water

Answer:

I think its D

Explanation:

Im sorry if you get it wrong, I think d is the answer

If you were creating an example of an ecosystem, which of the following would you exclude?
O different species of animals
O rocks and the nutrients they provide
O You would include all of these as part of an ecosystem.
O water and how it flows
O different species of plants

Answers

You would exclude rocks and the nutrients they provide if you were creating an example of an ecosystem. An ecosystem is a community of living organisms, such as plants and animals, and their physical environment. This includes the air, water, and soil, as well as the interactions between the different species and their habitats. Rocks and the nutrients they provide are not part of the living component of an ecosystem, and therefore would not be included in an example of an ecosystem. The correct answer is option B, rocks and the nutrients they provide.

The________ theory believed personality included three components: ego, superego, and Id.

Answers

Answer: freud's psychoanalytic theory

how do ships float in water​

Answers

The air that is inside a ship is much less dense than water. That's what keeps it floating! ... As a ship is set in water, it pushes down and displaces an amount of water equal to its weight

Define Human Immunodeficiency Virus(HIV) and Acquired immune deficiency syndrome(AIDS)

Answers

Human Immunodeficiency Virus (HIV) attacks the immune system, leaving the body vulnerable to infections and diseases. It is transmitted through the exchange of bodily fluids.

Acquired Immune Deficiency Syndrome (AIDS) occurs when HIV has severely damaged the immune system, causing opportunistic infections and other diseases to occur.

Once inside the body, the virus targets and destroys CD4 T cells, which are crucial for the proper functioning of the immune system. This weakens the immune system and makes it more difficult for the body to fight off infections and diseases.

AIDS is diagnosed when an individual's CD4 T cell count falls below a certain level and/or when they develop certain infections or cancers that are rare in people with healthy immune systems.

Although HIV is the virus that causes AIDS, not everyone who has HIV will develop AIDS. With proper medical care, people with HIV can control the virus and prevent the progression to AIDS. However, without treatment, HIV can progress to AIDS and can be fatal.

To learn more about Human Immunodeficiency Virus here

https://brainly.com/question/14725384

#SPJ1

Living things should not be viewed under a(n) _____ because the preparation process would kill them.

Answers

Answer:

Electron Microscope

Explanation:

In contrast to light microscopes, electron microscopes use a beam of electrons instead of a beam of light. Not only does this allow for higher magnification and, thus, more detail, it also provides higher resolving power. The method used to prepare the specimen for viewing with an electron microscope kills the specimen. Electrons have short wavelengths (shorter than photons) that move best in a vacuum, so living cells cannot be viewed with an electron microscope.

Answer:

Electron microscope

Explanation:

" Living things cannot be viewed with an electron microscope because the process to prepare them for viewing would kill them! " in the paragraph it says this , and i just took the unit 1 test . Its 100% electron microscope .

What is agriculture? anybody indian here?​

Answers

Answer:

the science or practice of farming, including cultivation of the soil for the growing of crops and the rearing of animals to provide food, wool, and other products.

Explanation:

i am from the Yamasee tribe  

Answer:

Agriculture is the preparation of plants and animals product for people to use and distribute to their market

Other Questions
Please select the word from the list that best fits the definitionFrance, West Germany, Italy, Belgium, the Netherlands, and LuxembourgAnswer: European Economic Community hello please help and i give you brainliest How Charles Darwin's Discoveries Affected our Views on Evolution today? What is the surface area of this figure? Enter your answer in the box. The square on the right is a scaled copy of the square on the left. Identify the scale factor. Express your answer in simplest form. What concern does Dilip Gaonkarraise regarding the rhetoric of science movement? one ounce of cheddar cheese contains 9 grams of fat. six of the grams of fat are saturated fats. find the ratio of saturated fats to total fat in an ounce of cheese. x =x=x, equals ^\circ To what extent did the French Revolution achieve its goals of liberty, equality, and fraternity for the French people? PLEASE ANSWER ASAP Does anyone know the answer to 0.038 ounces to mg? Please the line on the graph passes through points (0,6) and (3,0).a - what is the gradient of the line?b - what the gradient of the line perpendicular to this line?c - what is the equation for the line that passes through a and is perpendicular to ab? Subduction is much less likely tooccur when two continental platescollide becauseA. the plates are of equal density.B. continental plates are so old.C. continental plates are not subject to platetectonics.D. in order for subduction to occur a volcano mustform. one number is 5 times another number.their sum is 90.find the numbers. what prevents competing firms from choosing the monopoly price and quantity? Explain. -X - 8x + 7I forgot how to do this What is the value of y in the equation 5x + 2y = 20, when x = 0.3? Which is the graph of the linear inequality 2x - 3y < 12? Determine the lateral and total surface area of the pyramid. Please Help E Which structures contain digestive enzymes and are responsible for breaking down substances consumed by the cell? Peroxisomes B) Ribosomes Lysosomes 2 Points Mitochondria the term through-composed indicates that each line of text has a unique melody and no music is repeated. the term through-composed indicates that each line of text has a unique melody and no music is repeated. true false