Which two features are present in a plant cell but not in an animal cell?
Distinguishing between Cell Types
A
В
D


Please help will give brainliest!!!!!!!
С

Which Two Features Are Present In A Plant Cell But Not In An Animal Cell?Distinguishing Between Cell

Answers

Answer 1

Answer:

B and C

Explanation:

B is the chloroplast where light is captured for photosynthesis. C is the cell wall which gives the plant support and structure. Animals don't do photosynthesis and we have skeletons for support so we don't need these structures.


Related Questions

I need 3 evidence and reasoning why more varieties of trees help the orangatans​

Answers

Having more varieties of trees in orangutan habitats benefits these primates in multiple ways. It provides increased food availability, ensures nutritional diversity, and contributes to the overall health and sustainability of orangutan populations.

1.Increased Food Availability: Having a greater variety of trees in orangutan habitats provides them with a wider range of food sources. Orangutans are primarily frugivorous, relying heavily on fruits for their diet. Different tree species produce fruits at varying times throughout the year, and having a diverse array of trees ensures a more consistent and reliable food supply. This variety also allows orangutans to adapt to seasonal fluctuations in fruit availability and prevents overexploitation of specific tree species, promoting long-term sustainability.

2.Enhanced Nutritional Diversity: Different tree species offer varying nutritional compositions, including variations in vitamins, minerals, and other essential nutrients. A greater diversity of trees provides orangutans with a broader range of nutrients, contributing to their overall health and well-being. A balanced diet derived from a variety of trees can help address specific dietary requirements and support optimal growth, reproduction, and immune function in orangutans.

3.Improved Habitat and Biodiversity: The presence of diverse tree species creates a more complex and ecologically rich habitat for orangutans. Trees provide important resources beyond just food, such as nesting sites, shelter from predators, and pathways for movement. A greater variety of trees promotes biodiversity by attracting a wider range of other plant and animal species, creating a balanced ecosystem. This biodiversity is crucial for the long-term survival of orangutans as it helps maintain ecosystem stability, resilience, and the availability of resources.

Furthermore, a diverse tree population creates a richer and more resilient habitat, supporting a variety of species and promoting a healthy ecosystem for orangutans to thrive in.

for more such questions on habitats

https://brainly.com/question/728057

#SPJ11

Which of the following types of organisms can sometimes produce antibiotics naturally?

Answers

Some antibiotics can be naturally produced by fungi

Answer:

There are 2

Explanation:

antibiotics are chemicals that kill or inhibit the growth of bacteria that are used to treat bacterial infections they produce in Naturally by soil bacteria and fungi

Matching
a) fiberfill
b) mantle
f) pollution
e) blowtorch the movie
i) greenhouse effect j) compost
c) lava
g) the "Big One"
k) fumaroles
d) plate
h) glacier
1) atmosphere

16. A material made from fibers that is used to create bulk.
17. Mixture of organic matter used to enrich the soil.
18. Melted rock.
19. Mass of ice that flows slowly over land.
20. Of a section the earth's crust.
21. Warming of the earth caused by an increase of carbon dioxide in the
22. The part of the earth between the crust and the core.
23. Tool that uses a mixture of gas and air under pressure, similar to a hot spot.
24. Poisoning or dirtying the environment.
25. Expected big earthquake in California due to the high pressure in the plates.

Answers

A mixture of organic matter that is used for enriching soil is known as compost. The correct matches are given as- 16-a ,17-j, 18-c, 19-h, 20-d, 21-i, 22-b, 23-e , 24-f ,25-k.

A mixture that is used as a plant fertilizer in order to improve the quality of soil is known as compost. The compost is prepared naturally from the decomposition of plants, food, and other organic materials.

Compost is added to the soil to provide nutrition to the plants. It is also rich in many soil microbes such as protozoa, bacteria, fungi, and nematodes. It can be used to fertilize the soils in gardens, agricultural fields, and in organic farming.

To learn more about compost, refer to the link:

https://brainly.com/question/32028016

#SPJ1

After the red giant stage, a smaller star will become

Answers

Answer:

hope help you stay happy

After the red giant stage, a smaller star will become

Why is mitosis important in living organisms

Answers

Answer:

La célula es la unidad anatómica y fisiológica de todos los seres vivos. Lleva un proceso de división celular denominado mitosis en donde a partir de una célula madre se generan dos células hijas exactamente iguales. ... La mitosis en seres pluricelulares tiene la función de crecimiento y reparación.

Explanation:

4. Do you think a lahar would have preserved Pompeii the
same way that a pyroclastic flow did? Why or why not?

Answers

Yes. lahar preserved Pompeii which was buried under ash. For many centuries Pompeii slept beneath a blanket of ash and pumice which perfectly preserved the remains.

What is a lahar?

Lahars are volcanic mudflows, and they do not have to come directly from volcanic activity. They occur when huge amounts of volcanic ash mixed with water flow down the side of a mountain.

These are a hot or cold mixture of water and rock fragments that flows down the slopes of a volcano and enters a river valley.

What is a pyroclastic flow?

A pyroclastic flow is a hot chaotic mixture of rock fragments, gas, and ash that travels rapidly away from a volcanic vent or collapsing flow front. These are extremely destructive and deadly because of their high temperature and mobility.

Lahars and pyroclastic flows are the most destructive aspects of volcanoes. Hence lahar preserved Pompeii in the same way as the pyroclastic flow because savor helps filter junk lahars which are the most dangerous result of the eruption.

Learn more about lahars and pyroclastic flow from the link given below:

https://brainly.com/question/2222246?utm_source=android&utm_medium=share&utm_campaign=question

#SPJ13

What kind of claim type does this statement make? Abbey Road is a much better album than Let It Bleed.

Select one:
a.
value
b.
policy
c.
fact

Answers

A . Value because that’s your valued opinion

The kind of claim type does this statement is the value claim.

A claim of value refered to something as either good or bad, or that one thing is better than another thing.

Example of value: Abbey road album is better than let it bleed.

Conclusively we can therefore say that option A is the answer that best fit the statement above.

Learn more from

https://brainly.com/question/24197210

Can food
plants grow on Mars?

Answers

Answer:

i dont think so

Explanation:

the reason is that scientists have found little atmosphere and no water these are nessicary for plant survival

Three alleles control human blood type (A, B, and O). John's mom has type B blood& his Dad has Type O blood. What are the possible genotypes of John's Mom if shehas type B blood?

Three alleles control human blood type (A, B, and O). John's mom has type B blood& his Dad has Type

Answers

Human blood type is determined by codominant alleles. There are three different alleles:

\(\begin{gathered} I^A \\ I^B \\ i \end{gathered}\)

The I^A and I^B alleles are codominant, and the allele i is recessive.

The possible phenotypes are type A, type B, type AB, and type O

Type A and B can be homozygous or heterozygous, type AB is the result of the interaction between the codominant alleles, and type O individuals are homozygous recessive:

\(\begin{gathered} typeA\colon I^AI^AorI^Ai \\ typeB\colon I^BI^BorI^Bi \\ typeAB\colon I^AI^B \\ typeO\colon ii \end{gathered}\)

If John's mom has type B blood, then she can be either homozygous or heterozygous:

\(I^{B^{}}I^BorI^Bi\)

The correct option is the third one.

The blood group of John's mom is B type. The possible genotypes of blood group B are I(B)I(B) or I(B)i⁰. I(B) is dominant over i⁰. Thus, the correct option is C.

What is a Blood type?

A blood type is a classification of blood, based up on the presence or absence of antibodies and the inherited antigenic substances on the surface of red blood cells present in blood.  

There are 4 main blood groups that are defined by the ABO system. These are blood group A, containing A antigens on the red blood cells with anti-B antibodies in the plasma. Blood group B, has B antigens with anti-A antibodies in the plasma. Blood group O, having no antigens, but both anti-A and anti-B antibodies in the plasma. And, blood group AB, with both the antigens A and B and no antibodies in the plasma.

Therefore, the correct option is C.

Learn more about Blood group here:

https://brainly.com/question/17052766

#SPJ2

Amylase, albumin, hemoglobin, keratin, and collagen are all
O carbohydrates
Onucleic acids
Oproteins
Olipids

Answers

Amylase, albumin, hemoglobin, keratin, and collagen are all option(c) i.e, proteins.

An incredibly complex, naturally occurring molecule known as a protein is made up of amino acid residues connected by peptide bonds. All living things contain proteins, which are the building blocks of numerous vital biological substances like enzymes, hormones, and antibodies.

The three basic classes of proteins—globular, fibrous, and membrane—that correspond to typical tertiary structures can be arbitrarily grouped into three groups. Plant-based foods (fruits, vegetables, grains, nuts, and seeds) frequently lack one or more essential amino acids, but animal-based foods (meat, chicken, fish, eggs, and dairy products) are frequently good sources of complete protein.

The body uses protein for a variety of purposes. It promotes metabolic reactions, supports tissue growth and repair, and synchronizes biological processes. Proteins give your body a structural foundation while also ensuring optimal pH and fluid balance.

To know more about Proteins refer to:  https://brainly.com/question/17095120

#SPJ9

RNA polymerase is an enzyme that copies (1 point)
o DNA into DNA.
O RNA into mRNA
O mRNA into tRNA.
DNA into RNA

Answers

Answer:Copies DNA into RNA

Explanation:

There are multiple lines of evidence that provide support for common ancestry and evolution. Write 3-4 paragraphs describing at least three of them in detail. Provide at least one example for each line of evidence.

(I need the full three to four paragraphs ASAP please please please)

Answers

Answer: Determining a substance's physical or chemical identity. What are the two main requirements for identification? The adoption of testing procedures that give characteristic results for specific standard materials and the number and type of tests needed to identify a substance to exclude all other substances.

scientists have increasingly been developing transgenic crops, which have a number of desirable traits. identify ways that transgenic plants can benefit society.
A. graft part of one plant onto another to combine their traits B. engineer plants that can produce therapeutic proteins C. add traits that slow ripening so that fruit lasts longer D. generate plants that can resist insect pests

Answers

Option A is Correct. Transgenic crops, which contain a lot of desirable features, are being created by scientists at an increasing rate. Transgenic plants have the ability to mix features by grafting a portion of one plant onto another.

New genes that code for features society beneficial to humans are inserted into transgenic crops through genetic modification. Transgenic plants may produce more food, taste better, withstand drought, tolerate saline soil, and fight insect pests, to name just a few of their many desirable qualities.

Transgenic plants have been created recently that express a range of unique features, including insect resistance, immunity, herbicide tolerance, hybrid production, enhanced soil quality, etc.

Learn more about society Visit: brainly.com/question/24131981

#SPJ4

What is the Adam’s apple directly part of?

Answers

The Adam's apple is the bulge on the front of the thyroid cartilage. Your thyroid gland is located at the base of your neck. It's responsible for metabolic functions throughout your body.

A poison placed on the tips of darts by natives of the Amazon rainforest paralyzes prey such as small mammals. Which of the prey's cells are most likely affected by the poison?
muscle cells
epithelial cells
red blood cells
white blood cells

Answers

Answer: Muscle cells

Explanation: this would cause them to be unable to move as effectively, which would lead to paralyzation.

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

Term
1.
2.
3.
countrationer
5.
6.
7.
8.
9.
10.
11.
12.
Definition
high to low movement of molecules; uses transport protein; no energy required
a solution that has the same concentration of solute as the cells it surrounds
water-loving
a difference in the concentration of molecules from one location to another
structure that identifies the cell
having less solute molecules than the cytoplasm of a cell
allows certain molecules to pass through; keeps some molecules out
the amount of molecules in a specified area
use of vesicles to move large molecules out of the cell
the substance that is dissolved in a solution
movement of molecules from a low to high concentration; uses transport protein;
requires energy
movement of water from an area of high concentration to an area of low
concentration through a cell membrane; no energy required
mixture created when one substance is dissolved in another
movement of molecules from an area of high concentration to an area of low
concentration; no energy required
use of vesicles to move large molecules into the cell
a solution that has a higher concentration of solute molecules than the cytoplasm
of the cell it surrounds; will cause cells to shrink
phospholipid and protein covering of every cell that controls what goes into and
out of each cell
the liquid that dissolves the solute in a solution
water-fearing
a solution that has a lower concentration of solute molecules than the cytoplasm
of the cell it surrounds; will cause cells to swell and burst
a structure that helps to move molecules across the cell membrane
current model that describes membrane structure in which a phospholipid sea is
embedded with a wide variety (mosaic) of protein molecules
13
14.
A diffusion
15.
16.
17
18.
19.
20.
21.
22.

Answers

Answer:

structure that identifies the cell / recognizes stuff around the cell. hypotonic. having less solute molecules than cytoplasm of a cell / having a lower ... movement of molecules from low to high; uses transport protein; requires energy ... movement of molecules from high concentration to low concentration; no energy required.

Explanation:

1) Research biotechnology that currently exists describing the engineering design that made it possible.

2) Evaluate the design listed in problem 1 paying particular attention to benefits and risks.

Answers

The field of biotechnology combines biological and technological ideas. The main advantage that biotechnology can offer is advancement in engineering.


Benefits of biotechnology include the ability to simultaneously increase health and decrease hunger. It makes the food chain more flexible. It provides chances for medicinal advancement. We can conserve resources because of it. It assists us in reducing or eliminating waste. It may lower the prevalence of infectious diseases. Among biotechnology's drawbacks, this area of study has a lot of unanswered questions. It results in an all-or-nothing strategy. Croplands could be destroyed. It makes the value of human life a commodity. It is capable of being destroyed.
All the advantages that biotechnology can offer could be utilized to create a weapon of mass devastation. Unchecked biotechnology might potentially give rise to a social stratum that exists solely for scientific purposes.


To learn more about biotechnology please visit -
https://brainly.com/question/12871062
#SPJ1

Which of the following would increase the speed of the rock cycle?

O Increased rainfall
O Decreased sunlight
O Decreased Earth temperature.​

Answers

A because that would speed the process of weathering leading to the increase of the rock cycle

The location on earth surface above the point where an earthquake start is

Answers

Answer:

The location below the earth's surface where the earthquake starts is called the hypocenter, and the location directly above it on the surface of the earth is called the epicenter.

Explanation:

Answer:

The location below the earth's surface where the earthquake starts is called the hypocenter, and the location directly above it on the surface of the earth is called the epicenter.

hope this helps

which of the following is not a way in which dna is different from rna? all are the ways in which they differ the kind of sugar in the sugar-phosphate backbone the number of strands the nitrogenous bases

Answers

All are the ways in which DNA does not differ with RNA.

All living cells comprise of ribonucleic acid (abbreviated RNA), a nucleic acid with properties that are comparable and different to those of DNA. However, RNA is often single-stranded, unlike DNA. Instead of the deoxyribose present in DNA, the backbone of an RNA molecule is made up of alternate phosphate groups and the sugar ribose.

A single-stranded molecule called RNA has a shorter nucleotide chain than other molecules. DNA is self-replicating; it reproduces itself. RNA cannot duplicate itself. In the same way that DNA damage causes checkpoints that lead to apoptosis, damaged RNA may merely interfere with a cell's normal functions or it may cause apoptosis.

LSM1 of budding yeast is an additional gene with a putative function in RNA damage control. Resistance to UV light results from the deletion of LSM1.

Learn more about the differences between RNA and DNA here:

https://brainly.com/question/858798

#SPJ4

the substitute teacher walked into the classroom and i immediately knew that i wouldn’t like her because of the way she dressed. ___

Answers

The statement implies bias based on the substitute teacher's appearance, a form of prejudice or preconceptions about character or abilities.

What is the dressing?

The speaker judged the substitute teacher negatively based on her clothes, which is prejudiced. Clothing should not reflect someone's ability.

Prejudice is making assumptions without proper knowledge of an individual or group. The speaker judged the substitute teacher's likability based on appearance, disregarding teaching skills, personality, and qualifications. Don't judge people by their appearance.

Learn more about teacher   from

https://brainly.com/question/13812142

#SPJ1

What do you think the following statements represent?

Ex. Cathy doesn't like Brian because he has red hair. -Prejudice

1. The substitute teacher walked into the room and I immediately knew that I wouldn't like her

because of the way she was dressed.______

What does autotroph mean?
A. self-feeder
B. sun catcher
C. life-bringer

Answers

Answer: i belive its A but i may be wrong sorry if i am

Explanation:

Answer:

A. self-feeder

Explanation:

First of all," Auto = Self " So, that a giveaway.

Autotrophs are self-feeders, and they get their energy from non-living sources such as the sun and carbon dioxide. Autotrophs are called producers because they provide energy and food sources for all heterotrophic organisms.

7. Describe the structure of the lungs. Use the words bronchi, bronchioles, alveoli, and capillaries in your description.​

Answers

Answer:

The lungs are pair of spongy, air -filled organs located on either side of the chest (thorax). The trachea (windpipe)conducts inhaled air into the lungs through its tubular branches, called bronchi. The bronchi then divide, into smaller and smaller branches (bronchioles) ,finally becoming microscopic.

In your lungs, the main airways (bronchi) branch off into smaller and smaller passageways-the smallest, called bronchioles, lead to tiny air sacs(alveoli)

features of intensive system in farm management

Answers

Answer:

I will anwer the question.

Explanation:

Pasture Intensification. ...

Rotational Grazing. ...

Concentrated Animal Feeding Operations (CAFOs) ...

Crop Irrigation. ...

Genetically Modified Organism (GMO) Seeds. ...

Use of Agrochemicals. ...

Livestock. ...

Aquaculture.

how is biomagnification similar to bioaccumulation

Answers

Briefly-

Bioaccumulation is the process by which toxins enter the food web by building up in individual organisms, while biomagnification is the process by which toxins are passed from one trophic level to the next (and thereby increase in concentration) within a food web.

Which are electromagnetic waves? Check all that apply.

Answers

Electromagnetic waves include the following:

Radio Waves: Radio waves have the longest wavelength and lowest frequency among the electromagnetic spectrum. They are commonly used for communication, including broadcasting radio and television signals.Microwaves: Microwaves have shorter wavelengths and higher frequencies compared to radio waves. They are used for various purposes, such as cooking food in microwave ovens and in telecommunicationsVisible Light: Visible light is the portion of the electromagnetic spectrum that is visible to the human eye. It consists of different colors with varying wavelengths, from red (longest wavelength) to violet (shortest wavelength).Ultraviolet Waves: Ultraviolet waves have shorter wavelengths than visible light. They are commonly known for their effects on the skin and are responsible for causing sunburns. UV waves are also used in various applications, such as sterilization and fluorescent lighting.X-Rays: X-rays have shorter wavelengths and higher frequencies than ultraviolet waves. They are commonly used in medical imaging to visualize bones and tissues.Gamma Rays: Gamma rays have the shortest wavelengths and highest frequencies among the electromagnetic spectrum. They are highly energetic and are often associated with nuclear reactions and radioactive materials.

for similar questions on electromagnetic waves.

https://brainly.com/question/3871471

#SPJ8

Answer:

infrared

radio

ultraviolet

Explanation:

Based on the data in the figure, a student claimed that since 2007, the carrying capacity of wolves in Yellowstone National Park has been 100 wolves, and the maximum annual per capita growth rate of gray wolves is 0.6 wolves per wolf per year.

Answers

The calculated wolf population size in 2017 based on the data claimed by the student claim is 173, option D is correct.

Based on the student's claim, the carrying capacity of wolves in Yellowstone National Park has been 100 wolves since 2007, and the maximum annual per capita growth rate of gray wolves is 0.6 wolves per wolf per year. To calculate the wolf population size in 2017, we can use the formula for exponential population growth:

Population size = Initial population size × (1 + growth rate)^(number of years)

Using this formula, we can calculate the population size in 2017 based on the given data. Starting with an initial population size of 108 wolves in 2016, and assuming a constant maximum annual per capita growth rate of 0.6, we can calculate the population size in 2017 as follows:

Population size in 2017 = 108 × (1 + 0.6)⁽²⁰¹⁷ ⁻ ²⁰¹⁶⁾

= 108 × 1.6¹

= 172.8

= 173

Hence, option D is correct.

To learn more about population follow the link:

https://brainly.com/question/15992471

#SPJ1

The correct question is:

Based on the data in the figure, a student claimed that since 2007, the carrying capacity of wolves in Yellowstone National Park has been 100 wolves, and the maximum annual per capita growth rate of gray wolves is 0.6 wolves per wolf per year. Which of the following is closest to the calculated wolf population size in 2017 based on the student's claim?

A 100

B 103

C 113

D 173

How is the nitrogen cycle important to humans?
O It produces free nitrogen that humans can breathe.
O It converts nitrogen into a form that humans can obtain by eating other organisms.
o It produces nitrogen compounds that humang can breathe.
O It converts nitrogen into a form that humans can obtain by absorbing it through their skin.

Answers

Answer:

It converts nitrogen into a form that humans can obtain by eating other organisms.

diferencia celular y la activación y desactivación de genes

Answers

Answer:

nilla

Explanation:

extra nillaa

Other Questions
Choose the best answer below to complete this sentence: When you are doing research for a paper, good note-taking techniques will protect you from plagiarism ... Group of answer choices ... by ensuring you know the source of each fact in your notes and you can clearly distinguish between your own ideas versus points taken from your sources. ... by proving to your professor that you've done lots of reading. ... but only if you are taking notes by hand. ... by requiring you to copy out long passages exactly from the source. 2) Fill in the blanks with the following options.What was the environment of early earth like? Complete the statement below to answer the question.a)windb)elementsc)gasesd)inorganice)organicf)lightningg)primordial______seas absorbed______of the atmosphere, there was a heavy concentration of ultraviolet radiation from the sun, and frequent______strikes, and the environment was helpful in producing______molecules from______molecules. What is different about cellular respiration when compared to photosynthesis? You are at a circus and you see a stunt man climb up 29.4 meters into a cannon. He gets fired horizontally out of the cannon with a speed of 57.1 m/s. How long was stunt man in the air for? You purchase a Dodge Ram that has a sticker price of $20,650 at 4.5% interest rate for 4 years. Suppose Hailey is offered the following gamble: with probability 0.1 she will win $90, with probability 0.4 she will win $50, and with probability 0.5 she will lose $60. The expected value of this gamble is found by solving At oceanic hot spots (mantle plumes), mafic magma erupts at the surface and solidifies to form? CAN SOMEONE LS HELP WITHT THIS ASAP PLEASE any formal system of gesture and sounds, used or conceived as a means of communicating through is known as _________________. Which nations were included in CENTO? A ________ is an unsecured bond, and most of the bonds sold today in the United States are of this type.A) mortgage bondB) debentureC) senior bondD) bond indenture when the argon is released from the canister it expands to fill the wine bottle. how many 750.0- ml wine bottles can be purged with the argon in the canister at a pressure of 1.26 atm and a temperature of 297 k ? express your answer as an integer. At the beginning of the war, which advantage did the British have over thePatriots?OA. A larger armyB. Good supply and communication linesC. Motivation to fight and win the warD. Knowledge of the terrainSUBMIT when we seek out information that supports our stereotypes we are engaged in ________. How many moles of NH3 can be produced from 3.76 moles of nitrogenin the following reaction:N2 (g) + 3 H2 (g) 2 NH; (g) The population of California is approximately 38,040,000. The population of Texas is about 2.606 107. What is the approximate total population of these two states? your textbook states, "like organisms, ecosystems are open systems." which of the following provide a legitimate example to illustrate this statement?Select all that apply:- Earths atmosphere is bombarded by about 1022 joules of solar radiation each day.- Detritivores in soil consume nonliving organic matter and make the nutrients available to plants.- A population of reef fishes with a high reproductive rate in a mangrove ecosystem may be a source of recruits for a population in an adjacent coral reef ecosystem with a lower reproductive rate. The facilities department is experiencing some challenges and is undergoing reorganization. because of your familiarity with systems theory, you:______. ? x 8 = 7 8 *please help and explain how you got the answer :)* Albert stands on a frictionless turntable, holding a bike wheel. Both Albert and the wheel are initially stationary. Albert gives the bike wheel a good spin, and it begins rotating counterclockwise. If the bike wheel has a final angular momentum of one unit, counterclockwise, what is the final angular momentum had by the re of the system (i.e. Albert and the turntable)? one unit, counterclockwise zero units one unit, clockwise two units, counterclockwise two units, clockwise Albert flips the bike wheel upside down, so that it is now spinning the other way and has one unit of angular momentum in the clockwise direction. By how much does the angular momentum of Albert (plus turntable) change during the process of flipping the wheel? one unit, counterclockwise two units, clockwise zero units one unit, clockwise two units, counterclockwise