Answer:
Elastic strength is the ability of a muscle to absorb, store, and release energy. The more energy the muscle releases, the faster and more powerful the movement. The fact that the heart pumps 2,500 gallons (9,450 liters) of blood daily makes it the muscle with the greatest elastic strength.
Explanation:
Which inherited characteristic will this toucan pass on to its offspring?
I am really bad at bio and brainly has helped me a lot!!!!!
Answer:
B. Black fur
Explanation:
The last two options are normal to a bird.
Answer:
A colorful beak
Explanation:
got it right on my quiz
hope this helped now I peace out ✌
Which of the following type of forest is likely to have the most nutrient-rich soil?
Responses...
A. tropical rain forest
B. coniferous forest
C. tropical dry forest
D. deciduous forest
Answer
ATropical rain ️ forestAnswer: The correct answer is D. deciduous forest
Explanation: This answer has been confirmed correct.
The temperate deciduous forests have the most nutrient-rich soil.
Science question ill give you brainly!
Answer:
last one
Explanation:
cell is the smallest
Answer:
d plz help me at https://brainly.com/question/23664340
Explanation:
After its kind means reproduction of new kinds of living things .
TrueFalse
Answer:
It is FALSE!!!
HOPES THIS HELPS YOU OUT
Explanation:
Please Answer Correctly As This Is For My Project.
1. What are the unique characteristics of the macromolecule subunit and macromolecule you explored?
2. Describe how the subunit you modelled chemically combines with other subunits to form a macromolecule.
3. What are the functions of the macromolecule you explored?
4. Summarize the relationship between the structure of your subunit and the function of the macromolecule it forms.
Answer:
1. Macromolecules are typically BIG molecules, and they truly are the building blocks of cells. Macromolecules are generally built by combining many single units, or monomers, into larger units, called polymers.
2.polymers which are long chains of subunits called monomers.
3.Gigantic molecules, called macromolecules, populate a cell and provide it with important functions for life. For example, macromolecules provide structural support, a source of stored fuel, the ability to store and retrieve genetic information, and the ability to speed biochemical reactions.
4.Polymers are macromolecules, but not all macromolecules are polymers. The main difference between a polymer and a macromolecule is that polymers contain repeating units that represent monomers whereas not all macromolecules have a monomer in their structure
Explanation:
Check all that are true of the following scenario.
An archer strings an arrow on a bow and draws the string back. Aiming the bow
upwards at a 45 degree angle, the archer pauses with arms locked into position and
then releases the string. The arrow flies upwards making an arc and then sticks into
the trunk of a tree with an audible thud.
At least four different types of energy are illustrated in this example.
The first energy transformation in the scenario is chemical energy to kinetic.
From the time the archer draws the bow until the thud us heard, entropy increases in
the universe.
The energy of the arrow at the end of the scenario is equal to the energy exerted by the
muscles of the archer.
When the arrow sticks into the tree the original energy has all been used up.
Statements 1 and 3 are true, while statements 2 and 4 are false.The first energy transformation in the scenario is chemical energy to kinetic. - True.
The archer converts chemical energy stored in their muscles into kinetic energy when they release the string and propel the arrow forward.From the time the archer draws the bow until the thud is heard, entropy increases in the universe. - False. Entropy is a measure of disorder or randomness in a system. In this scenario, the archer's actions do not necessarily lead to an increase in entropy.
The energy of the arrow at the end of the scenario is equal to the energy exerted by the muscles of the archer. - False. Energy is conserved in a closed system, but some energy is lost as heat and sound during the process. Therefore, the energy of the arrow at the end may be less than the energy exerted by the archer's muscles.
When the arrow sticks into the tree, the original energy has all been used up. - False. Energy is not created or destroyed but rather transformed from one form to another. Some of the initial energy from the archer's muscles is transferred to the arrow's kinetic energy, but it is not entirely used up.In summary, statements 1 and 3 are true, while statements 2 and 4 are false.
For more such questions on energy
https://brainly.com/question/30337295
#SPJ8
How are most traits inherited
identify the regulatory process.
What are the different stages of the regulatory process?
It is sectioned by the Cabinet-level department and independent agency. Agencies can then further divide into sub-agencies and place their actions into one of five stages: pre-rule, proposed rule, final rule, completed action, or long-term action.
Explanation:
The following chart lists taxonomy classifications for seven organisms. Some have just one classification, while others have a subclassification. Which four classifications best match the classifications of your fossils? Research the classifications if you don’t know their characteristics.
After doing the research, the correct answer was found to be, which is mentioned below.
What are fossils?These are preserved remains of the plants and the animals whose bodies were buried deep inside the earths surface or either sediment.It takes millions and trillions of years to form fossils. Their age can be determined by carbon dating.
The correct options are given below, and the completed table is attached below.
Organism 1- Brachiopoda- Fossil D- They both look alike
Organism 2- Mollusca, Gastropoda-Fossil A
Organism 3- Arthropoda, Trilobita- Fossil C
Organism 4- Chordata, Actinopterygii -None
Organism 5- Pteridophyta- Fossil B- As it is in the plant kingdom and it is flowerless
Organism 6- Nematoda- None
Organism 7- Ascomycota-None
For more details regarding fossils, visit:
https://brainly.com/question/14960162
#SPJ9
The question is incomplete, but most probably the complete question is,
The following chart lists taxonomy classifications for seven organisms. Some have just one classification, while others have a subclassification. Which four classifications best match the classifications of your fossils? Research the classifications if you don’t know their characteristics.
Classification
Organism 1 Brachiopoda
Organism 2 Mollusca, Gastropoda
Organism 3 Arthropoda, Trilobite
Organism 4 Chordata, Actinopterygii
Organism 5 Pteridophyta
Organism 6 Nematoda
Organism 7 Ascomycota
Now complete the following table to explain your reasoning for the classification of your fossils.
In the Galapagos Island finches, the variation in the beak shape correspond to which finch characteristic?
Answer:
Their diet
Explanation:
Over time, all of the finches adapted to their food source. This caused the evolution of their beaks to begin.
Dr. Berry, who employs the ecological approach to human development, is studying the relationship between the quality of parent-child interactions in the home and the success of children in school. Dr. Berry is studying development at the _________ level of environmental influence.
A) microsystem
B) mesosystem
C) exosystem
D) macrosystem
Dr. Berry was studying development in context of the mesosystem level of environmental influence.
What environment means?the totality of one's surroundings, situations, or influences; milieu. The environment that an organism is in at any particular time, including the air, water, minerals, creatures, and all other external variables.Who should protect the environment?As per the Article 51-A (g) of the Indian Constitution, "It shall be the duty of every citizen of India to protect and improve the natural environment, including forests, lakes, rivers, and wildlife and to have compassion for living... ", environmental protection has been made a fundamental responsibility of every citizen of India.
To know more about environmental visit
brainly.com/question/516941
#SPJ4
What are steps of sexual reproduction?
Answer:What are steps of sexual reproduction?
Sexual reproduction consists of a set of events. We can divide it into three stages: Pre-fertilization, Fertilization, and Post-fertilization.
Explanation:
Please mark me as brailiest.Thank so much
Describe an investigation using flashlights that are all the same?
One investigation using flashlights that are all the same is the Flashlight Investigation which is part of the Light and Shadow Workshop.
This workshop was developed using basic tools such as mirrors, lenses, and flashlights as the basis for explorations that can help build an intuitive understanding of how light works.
The activities are divided into five sessions, although the investigations can be extended well beyond this format. The first session, Flashlight Investigation is outlined here, the other sessions are outlined in separate Instructables.
learn more about flashlights
https://brainly.com/question/20481109
What type of succession is shown in the picture?
Answer:
secondary succession
Explanation:
intermediate species
Answer:
Primary succession
Explanation:
Primary succession is one of two types of biological and ecological succession of plant life, occurring in an environment in which new substrate devoid of vegetation and other organisms usually lacking soil, such as a lava flow or area left from retreated glacier, is deposited. In other words, it is the gradual growth of an ecosystem over a longer period of time.
Definition: The time in an age-structure diagram where the population is reproducing.
Answer:Reproductive
Explanation: just took the test
What causes pollution? How can we stop it?
Answer: Reduce or eliminate fireplace and wood stove use. by avoiding burning leaves, trash, and other materials. the cause of pollution is gas in factories which cause harm to animals and humans
Explanation:
I tried my best
Answer:
marry me ill tell ya
have a nice day
Which of these is a density-independent factor. Fire, space, water, food
Answer:
fire
Explanation:
What are pens and corrals used
for with beef cattle?
A. long-term breeding and display
B. short-term display and feeding
C. short-term sorting and restraining
D. long-term housing and storage
Pens and corrals with beef cattle are used of short-term sorting and restraining which is option C.
Pens and corrals explained.
Pens and corrals are used in beef cattle operations for short term sorting and restraining of the animals. These structures are designed to safely confine and manage the movement of cattle for various purposes, such as sorting them based on characteristics like age, size or health or for a performing specific tasks like vaccinations, treatments, or tagging.
Pens and corrals typically consist fenced enclosures with gates and alleys that allow for the controlled movement of cattle. They provide a safe environment for handlers and facilitate efficient handling and the management of animals.
Learn more about pens and corrals below.
https://brainly.com/question/32385070
#SPJ1
Why do most multicellular organisms require more than just diffusion to facilitate gas exchange? What is the other process called? Name all the places in our body where these two different processes occur (i.e. where do we get diffusion and where do we get the other process).
Answer:
The description including its problem is described throughout the segment below on explanation.
Explanation:
Surface layer influences combustion efficiency, the larger the surface region, the more and more fuel traded. Hence, gills as well as lungs become established in the organism's purpose of providing an enormous surface area for both the necessary currency value of gas towards the outer atmosphere.
The ranges among gas exchanger as well as shallow tissues become ideal through dissemination to fulfill the necessity so a range of respiratory substances is required. Respiratory interfaces are coated with epithelial cells to allow exchanging of gases.The oxygen through both the respiratory system would be transferred into the bloodstream, as well as the RBC collect the CO2 from the cells it to the lungs for oxygenation. Exterior ventilation, oxygen absorption from capillaries to CO2 absorption from capillary to alveoli. Inner ventilation happens at the surface including its body cells.Define transcription
Answer:
Transcription, as related to genomics, is the process of making an RNA copy of a gene's DNA sequence. This copy, called messenger RNA (mRNA), carries the gene's protein information encoded in DNA.
Explanation:
The uterine cycle describes the cyclic changes of thickening and degeneration that the endometrium goes through in a month. What is the order of events in one uterine cycle
Answer:
During the uterine month there are different phases through which the uterus passes, these phases are regulated by hormones and are responsible for producing the cycle necessary for fertilization.
Phase where menstruation occurs: This phase only happens if the woman was not fertilized and did not develop the diploid cell together with a sperm, since not being fertilized, all the uterine preparation that had been planned in the body for fertilization will be released as that we know "menstruation", in this phase estrogens and progesterone are low. The inner walls of the unfertilized uterus are released.
Follicular phase, in the follicular phase the ovaries prepare to release an egg and estrogen begins to rise. (From the first day of the period until ovulation)
Proliferative phase, in the proliferative phase, new vessels proliferate and the outermost layer of the uterus prepares itself for possible fertilization, is where spiral arterioles can begin to form again in the external cut of the myometrium.
Ovulation, here is where the mature ovum is called Graff's follicle, at this time estrogen reaches its peak and then descends.
Luteal phase, in the luteal phase the production of the luteal body is generated, at this stage progesterone takes center stage, and it is the range between ovulation and menstruation (if not fertilized)
Last phase, secret phase, in this phase there are two possible ends, if the woman is fertilized, the egg cell implants and begins the development of the embryo and if it is not fertilized, the entire external cut of the myometrium is prepared to be secreted.
Explanation:
A very important fact to clarify is that women are born with a quantity of ovules that at the end of this uterine cycle ceases to exist, this process is what we know as menopause.
That is to say that women have a quantity of ovules that will one day run out, and the body releases them from the menarche or the first menstruation, generating that in each released ovule a uterine cycle is completed, the day they end the woman will have reached menopause and would have no chance of being fertilized or completing the uterine cycle.
superficial layer of the endometrium is shed
basal layer of endometrium grows, forms gland and blood vessels
enriched endometrial blood supply
endometrial glands secrete nutrients into uterus
What is the name of the special type of protein that helps reactions occur?
Some proteins lowers the activation energy of a reaction, making it more likely to proceed. The reaction will occur thousands or millions of times faster. The name of this special type of protein is enzyme.
Which of the following is a method of seed dispersal used by plants
a.water
b.animal
c.wind
d.explosion
Carlos states that planets that are closer to the sun have a higher surface temperature than those that are further from the sun. Why do you think Carlos is correct or incorrect?
Answer:
Yes Carlos is correct.
Explanation:
The further away an object is from the heat source, the less heat it absorbs.
Answer:
Carlos is correct
Explanation:
He is correct because when the planets are closer to the sun they get a higher tempurture
Practice Classify each of the following examples as toxic, sediment, nutrient, and/or bacterial pollution.
Explain your classifications.
A Logging removes trees from a hill, leaving a barren landscape.
Classification:
Explanation:
Answer:
Sediment pollution
Explanation:
There is no more vegetation on the hill to prevent sediment from being carried away
Logging removes trees from a hill, leaving a barren landscape is sediment pollution.
Pollution refers to any contamination of the natural environment with unwanted material or energy which renders the environment unfit for life. There are many kinds of pollution that affect various spheres of the environment such as land, air water etc.
When trees are logged from a hill in such a manner that the landscape is left barren, sediments can now easily be washed away by runoff into surrounding water bodies or other areas. This is an example of sediment pollution.
Learn more: https://brainly.com/question/24577840
Read the sentence. The girl wondered they were standing the grass was so tall. Select the relative adverbs in the correct order to fill in the blanks. where when which, where why, where
Below is a DNA template strand that serves as a gene used to create a specific protein. The DNA template is read from LEFT to RIGHT. Please determine the sequence of amino acids for the protein that is produced using this sequence of DNA.
AAATAAGTCGGTCACCTAGTC
To determine the sequence of amino acids for the protein produced using the given DNA template strand, we need to first transcribe the DNA into messenger RNA (mRNA), and then translate the mRNA into the sequence of amino acids using the genetic code.
Transcription involves copying the DNA template into a complementary sequence of mRNA, where thymine (T) is replaced by uracil (U). So, the mRNA sequence for the given DNA template strand would be:
UUAUUAGACCGAGUGGAUCAG
Using the genetic code, we can then translate the mRNA sequence into the sequence of amino acids that make up the protein. Each codon (a sequence of three nucleotides) in the mRNA sequence codes for a specific amino acid, as specified by the genetic code. The sequence of amino acids corresponding to the mRNA sequence would be:
Phenylalanine - Asparagine - Aspartic acid - Arginine - Valine - Serine
So, the sequence of amino acids for the protein that is produced using the given DNA template strand would be:
Phenylalanine - Asparagine - Aspartic acid - Arginine - Valine - Serine.
To know more about amino acids:
https://brainly.com/question/31442968
#SPJ1
Using water more efficiently _______.
a.
protects the environment
b.
causes the loss of natural pollution filters
c.
increases water contamination
d.
all of the above
Answer:
a. protects the environment.
Explanation:
Using water efficiently means using it wisely and not wasting it. When we use water more efficiently, we reduce the amount of water we consume, which helps to conserve water resources. This is important because water is a limited resource, and by using it efficiently, we can ensure enough water is available for future generations.
By using water more efficiently, we can also protect the environment. Water is essential for many ecosystems and habitats, and by conserving water, we can help maintain the balance of these ecosystems. Additionally, using water efficiently can reduce the need for energy-intensive water treatment and distribution processes, which can help reduce greenhouse gas emissions and mitigate climate change.
So, using water more efficiently helps protect the environment but also helps conserve water resources for the future.
One major criticism of globalization is that it can:
A. increase emissions that harm the environment.
B. prevent countries from trading with each other.
C. slow down advances in shipping technology.
D. limit communication between countries.
Answer:
B. Prevent countries from trading with each otherThere ya go buddy hope i helped youOne major criticism of globalization is that it can,
prevent countries from trading with each other.So, option B is correct one
What is globalization ?It is the process of interaction and integration among companies,people and country.It describes the growth of interdependence of the world's economics, culture and population.This brings by cross border trade in goods and services, technology and flow of investment, people and information.It is historic process because it spread since the 18th century.learn about globalization,
https://brainly.com/question/16499151
#SPJ2
the table shows data collected on pH level of an Adirondack lake from 1989 to 1996.
describe the the trend in pH level in lake over this 16 year period.
___________________________________________________________________________
Year pH level
1989. 6.7
1984. 6.3
1986. 6.4
1988. 6.2
1990. 5.9
1992. 5.6
1994. 5.4
1996. 5.1
The lake's pH has become acidic; in 1989, it was 6.7; by 1996, it had dropped to 5.1. This shows that the increase in the acidity which has several bad impacts on the lake water ecosystem and its community.
What happens when the freshwater becomes acidic?The freshwater ecosystem differs from the oceanic saltwater ecosystem in that freshwater contains phytoplankton, edible fish, and so on. The fresh water has a normal pH, but the pH decreases and induces acidity when the water is polluted with different chemicals, such as nitrogen oxide, sulfur dioxide, etc.
When acid rain happens due to man-made pollution, this further adds acidity to the fresh water, and as a result, the species that live in the lake are not able to live and breathe properly due to a lack of oxygen. The acidity in the table increased year after year from 1989 to 1996.
Hence, the acidity of the lake increased and the pH decreased in these years, from 1989 to 1996.
Learn more about the acidity, here
https://brainly.com/question/2066611
#SPJ1