can you help me with 1 - 4

Can You Help Me With 1 - 4

Answers

Answer 1

Me das mas información porfavor?


Related Questions

I need step by step answer to my question

Answers

Step-by-step explanation:

what is your questions

Answer:

The answer would be 13.5 pints

Step-by-step explanation:

when you do 2 gallons - 2 pints you get 1.75 gallons

then when you do 1.75 - 1 cup you get 13.5 pints

A town has a population of 70,230 in the year 2020, over the next five years 6556 people move into the town for work, about 4096 moved to other parts of the country, a baby boom sees the birth of 5225 babies but there are also 4978 deaths. what is the population of the town in 2025?

Answers

Step-by-step explanation:

To calculate the population of the town in 2025, we need to add the changes in population over the next five years to the population in 2020.

Starting population in 2020 = 70,230

Change in population over 5 years:

Net migration = 6556 - 4096 = 2460

Natural increase (births - deaths) = 5225 - 4978 = 247

Total change in population = 2460 + 247 = 2707

Population in 2025 = 70,230 + 2,707 = 72,937

Therefore, the population of the town in 2025 is 72,937.

PLEAAE HELP ITS EASY!!!! WORTH LOTS!!How many 1/8 are in 1 and 1/4
WRITE YOUR ANSWER AS A FRACTION NOT A MIXED NUMBER!!
PUt correct answer too please

Answers

Step-by-step explanation:

We need to find (1 1/4) / (1/8).

(1 1/4) / (1/8)

= (5/4) / (1/8)

= (5/4) * 8

= 40/4

= 10.

Answer:

10/8 if not, I am sorry...

In ΔEFG, f = 88 cm, g = 18 cm and ∠E=68°. Find the area of ΔEFG, to the nearest square centimeter.

Answers

The area of ΔEFG is approximately 916 square centimeters.

Given that,

In ΔEFG

f = 88 cm ,

g = 18 cm

∠E=68°

To find the area of ΔEFG,

Use the formula:

Area = (1/2)xfxgxsin(∠E)

First, we need to convert the angle from degrees to radians.

We can do this by multiplying by π/180.

∠E = 68° * π/180 ≈ 1.19 radians

Next, we can plug in the values we have:

Area = (1/2)x88x18xsin(1.19)

        ≈ 915.56 cm²

Rounding this to the nearest square centimeter,

we get,

Area ≈ 916 cm²

Learn more about the triangle visit;

brainly.com/question/1058720

#SPJ1

A model rocket is launched with an initial upward velocity of 195 ft/S the Rockets height H (in feet) after T seconds is given by the following. H= 195T -16 T^2 find all values for t for which the Rockets height is 87 feet. Round your answer to the nearest hundredth

Answers

The height, H (in ft), is related to time, T (in seconds), by the next equation:

\(H=-16T^2+195T\)

Substituting with H = 85 ft we get:

\(\begin{gathered} 85=-16T^2+195T \\ 0=-16T^2+195T-85 \end{gathered}\)

Applying the quadratic formula:

\(\begin{gathered} T_{1,2}=\frac{-b\pm\sqrt[]{b^2-4ac}}{2a} \\ T_{1,2}=\frac{-195\pm\sqrt[]{195^2-4\cdot(-16)\cdot(-85)}}{2\cdot(-16)} \\ T_{1,2}=\frac{-195\pm\sqrt[]{32585}}{-32} \\ T_1\approx\frac{-195+180.5}{-32}\approx0.45\text{ seconds} \\ T_2\approx\frac{-195-180.5}{-32}\approx11.73\text{ seconds} \end{gathered}\)

I need the answer fast pls

I need the answer fast pls

Answers

Answer:

C. is the correct answer

URGENT *EASY 10 POINTS* : Show steps to get the expression ln(sqrt(2) +1) - ln(1/sqrt(2)) equal to -ln(1-(1/sqrt2))

Answers

Answer:

Step-by-step explanation:

To show that the expression \(\ln(\sqrt{2} + 1) - \ln\left(\frac{1}{\sqrt{2}}\right)\) is equal to \(-\ln\left(1 - \frac{1}{\sqrt{2}}\right)\), we can simplify both sides of the equation using the properties of logarithms. Here are the steps:

Step 1: Simplify the expression on the left side:

\(\ln(\sqrt{2} + 1) - \ln\left(\frac{1}{\sqrt{2}}\right)\)

Step 2: Apply the logarithmic property \(\ln(a) - \ln(b) = \ln\left(\frac{a}{b}\right)\) to combine the logarithms:

\(\ln\left(\frac{\sqrt{2} + 1}{\frac{1}{\sqrt{2}}}\right)\)

Step 3: Simplify the expression within the logarithm:

\(\ln\left(\frac{(\sqrt{2} + 1)}{\left(\frac{1}{\sqrt{2}}\right)}\right)\)

Step 4: Simplify the denominator by multiplying by the reciprocal:

\(\ln\left(\frac{(\sqrt{2} + 1)}{\left(\frac{1}{\sqrt{2}}\right)} \cdot \sqrt{2}\right)\)

\(\ln\left(\frac{(\sqrt{2} + 1) \cdot \sqrt{2}}{\left(\frac{1}{\sqrt{2}}\right) \cdot \sqrt{2}}\right)\)

\(\ln\left(\frac{(\sqrt{2} + 1) \cdot \sqrt{2}}{1}\right)\)

Step 5: Simplify the numerator:

\(\ln\left(\frac{(\sqrt{2} + 1) \cdot \sqrt{2}}{1}\right)\)

\(\ln\left(\sqrt{2}(\sqrt{2} + 1)\right)\)

\(\ln\left(2 + \sqrt{2}\right)\)

Now, let's simplify the right side of the equation:

Step 1: Simplify the expression on the right side:

\(-\ln\left(1 - \frac{1}{\sqrt{2}}\right)\)

Step 2: Simplify the expression within the logarithm:

\(-\ln\left(\frac{\sqrt{2} - 1}{\sqrt{2}}\right)\)

Step 3: Apply the logarithmic property \(\ln\left(\frac{a}{b}\right) = -\ln\left(\frac{b}{a}\right)\) to switch the numerator and denominator:

\(-\ln\left(\frac{\sqrt{2}}{\sqrt{2} - 1}\right)\)

Step 4: Simplify the expression:

\(-\ln\left(\frac{\sqrt{2}}{\sqrt{2} - 1}\right)\)

\(-\ln\left(\frac{\sqrt{2}(\sqrt{2} + 1)}{1}\right)\)

\(-\ln\left(2 + \sqrt{2}\right)\)

As we can see, the expression \(\ln(\sqrt{2} + 1) - \ln\left(\frac{1}{\sqrt{2}}\right)\) simplifies to \(\ln(2 + \sqrt{2})\), which is equal to \(-\ln\left(1 - \frac{1}{\sqrt{2}}\right)\).

Imagine that you need to buy some chicken for dinner tonight. You found an ad showing that the store across town has chicken on sale for $1.59 a pound. Your usual neighborhood store sells the same chicken for $2.89 a pound. Is it worth the extra drive?

Look at the information below you’ll need to solve the problem.

How much chicken will you be buying? 3 pounds
How does the distance and the time it takes to get there, compare between the two stores? Your neighborhood store is 2.1 miles away, and takes about 8 minutes. The store across town is 8.6 miles away, and takes about 24 minutes.
What kind of mileage does your car get? It averages about 22 miles per gallon in the city.
How many gallons of fuel does your car hold? About 13 gallons
How much is gas? About $1.98/gallon right now.
Are there any other pieces of information you need to solve the problem? Which option would you choose? Is going to the further store cheaper? Or is going to the close store cheaper? How much money does the cheaper option save you? Give your answer to the nearest cent.

Answers

Answer:

Step-by-step explanation:

Considering the store in your neighborhood, price per pound of chicken is $2.89. The cost of 3 pounds is

3 × 2.89 = $8.67

Distance = 2.1 miles

The car averages about 22 miles per gallon in the city. It means that the number of gallons needed is

2.1/22 = 0.095 gallons

Cost of gas = $1.98/gallon

Cost of 0.095 gallons =

1.98 × 0.095 = $0.1881

Total cost = 8.67 + 0.1881 = $8.86

Considering the store across town, price per pound of chicken is $1.59. The cost of 3 pounds is

3 × 1.59 = $4.77

Distance = 8.6 miles

The car averages about 22 miles per gallon in the city. It means that the number of gallons needed is

8.6/22 = 0.39 gallons

Cost of gas = $1.98/gallon

Cost of 0.39 gallons =

1.98 × 0.39 = $0.77

Total cost = 4.77 + 0.77 = $5.54

Therefore, it is cheaper going to the further store. The amount that the cheaper option saves is

8.86 - 5.54 = $3.32

if g is the midpoint of ab, classify each triangle by its angles and sides

if g is the midpoint of ab, classify each triangle by its angles and sides

Answers

Answer:

CFE: Right triangle.

BCE: Acute

BFG: Equilateral

GAF: Obtuse

Step-by-step explanation:

Remember the types of triangles, first the CFE creates a right angle, which is a 90º angle between two of the sides that would be where F is located, so that would be a right triangle.

BCE is an acute triangle since all of its angles are lower than 90º so you don't have any larger than 90º angles, and its sides are not equal to eachother, so different sides and angles below 90º is an acute triangle.

BFG is an equilateral triangle since all of its sides are equal, and it is demonstrated in the figure by putting a little line in the middle of the sides that means that the sides are equal since the three sides of the triangle have them they are all equal making it an equilateral triangle.

GAF is an obtuse triangle, since all of its side are different and it has an angle larger than 90º that creates an obtuse triangle because of its obtuse angle.

Each of the triangles are classified as;

ΔCFE: Right angle triangle.

ΔBEC: Acute triangle

ΔBFG: Equilateral triangle

ΔGAF: Obtuse triangle

1) For the triangle ΔCFE, we can see that it has a right angle at point F. Thus, ∠CFE = 90°. Therefore, we can call ΔCFE right angled triangle.

2) For the triangle ΔBEC, we can see that the three angles namely;∠BEC, ∠BCE, ∠EBC are all less than 90°. Any triangle where the three angles are less than 90° is called acute triangle.

3) For the triangle ΔBFG, we can see that the three sides are equal. Any triangle with it's 3 sides equal is called equilateral triangle.

4) For the triangle ΔGAF, we can see that one of the angles which is ∠G is greater than 90° and any triangle with one of its's angles greater than 90° is called obtuse triangle.

Read more at; https://brainly.com/question/2873413

i need help asap
than you!

i need help asapthan you!

Answers

The highest height for the daily rainfall were for 5 and 6 inches

How to Interpret Dot Plots?

Dot plots are used to present data in the form of points or small circles. It is similar to a simplified histogram or bar graph in that the height of the bar made up of points represents the numerical value of each variable. Dot plots are used to represent small amounts of data.

From the given dot plot, we see the number of times for each height of rainfall.

Thus, we see that the highest number of times of rainfall height was from that of 5 and 6 inches.

Thus, we conclude those were the highest heights for the daily rainfall.

Read more about Dot plots at: https://brainly.com/question/24309209

#SPJ1

Please look at the photo for the question. Thank you!

Please look at the photo for the question. Thank you!

Answers

The function g(x) = x² + 4x has a: A. minimum.

The minimum value occur at x = -2.

The function's minimum value is -4.

How to determine the axis of symmetry and vertex of a quadratic function?

In Mathematics, the axis of symmetry of a quadratic function can be calculated by using this mathematical equation:

Axis of symmetry = -b/2a

Where:

a and b represents the coefficients of the first and second term in the quadratic function.

For the given quadratic function g(x) = x² + 4x, we have:

a = 1, b = 4, and c = 0

Axis of symmetry, Xmax = -b/2a

Axis of symmetry, Xmax = -(4)/2(1)

Axis of symmetry, Xmax = -2

Next, we would determine vertex as follows;

g(x) = x² + 4x

g(-2) = -(-2)² + 4(-2)

g(-2) = -4.

Read more on quadratic functions here: brainly.com/question/14201243

#SPJ1

terry buys an orange for 43p. He pays with £1 coin how much change does he get?

Answers

Answer:

57p

Step-by-step explanation:

so 1 pound is just 1.00 so

1.00-0.43=0.57

so terry will get 57p change

If you flip two coins 68 times, what is the best prediction possible for the number of times both coins will land on heads?the number of times it will land on tails?

Answers

If you flip two coins 68 times, the best prediction for the number of times both coins will land on heads is 17.

If you flip two coins 68 times, the best prediction for the number of times both coins will land on tails is 17.

What is the probability of getting two heads?

The possible outcomes when two coins are flipped are;

head - head = HH

tail - tail = TT

Head and tail = HT

Tail and head = TH

The probability of getting two heads = 1/4

If you flip two coins 68 times, the best prediction for the number of times both coins will land on heads is calculated as;

Expected value = (68 flips) x (1/4 probability of getting HH) = 17

The probability of getting two tails = 1/4

Expected value = 68 x 1/4 = 17

Learn more about probability here: https://brainly.com/question/24756209

#SPJ1

WORTH 67 POINTS!! PLEASE HELP QUICK!!


A.
B.
C.
D.

WORTH 67 POINTS!! PLEASE HELP QUICK!!A. B.C.D.

Answers

Step-by-step explanation:

When m > -3.1, the line should extend towards the right and the point at 3.1 should be an empty circle. (as m = 3.1 is not included in the solution set)

Hence the answer is Option D.

P.S. The reason why A is wrong is because the number line is wrongly labelled. -3.3, -3.2 and -3.1 are all less than -3 and should be on the left of the number line.

Sadie can't wait to make chocolate chip zucchini bread with zucchini from her garden. Her recipe calls for 8 ounces of chocolate chips per loaf. If she has enough zucchini to make 4 loaves of zucchini bread, how many pounds of chocolate chips does she need?

Answers

Answer: 2 pounds

Step-by-step explanation:

So if Sadie needs 8 ounces for one loaf she needs 32 ounces for 4 loaves.

32 ounces is equal to 2 pounds.

HELP PLS MIGHT GIVE BRAINLIST BUT ONLY IF 2 PEOPLE ANSWER!

HELP PLS MIGHT GIVE BRAINLIST BUT ONLY IF 2 PEOPLE ANSWER!

Answers

the answer to the question is b.
yes the answer is B indeed

GIVING BRAINLIST PLEASE HELP!!!

GIVING BRAINLIST PLEASE HELP!!!

Answers

The probability that a randomly selected point within the circle would fall in the red- shaded area is 45. 833 %

How to find the probability ?

The arc that is covered by the red - shaded area in the circle has a degree measure of 165 degrees. This is out of the total circle angle measure of 360 degrees.

This therefore means that the probability that a randomly selected point within the circle would fall in the red- shaded area can be found to be :

= Angle measure of red - shaped area / Total area x  100 %

= 165 / 360 x 100 %

=0. 45833 x 100 %

= 45. 833 %

Find out more on probability at https://brainly.com/question/22690728

#SPJ1

SOMEONE ANYONE PLEASE HELP!!!

SOMEONE ANYONE PLEASE HELP!!!

Answers

The graph of g(x) is obtained from the graph of f(x) by the following transformations:

- A horizontal stretch by a factor of 9. This is because the graph of g(x) is 9 times wider than the graph of f(x).

- A vertical translation down by 2 units. This is because the graph of g(x) is 2 units lower than the graph of f(x).

In other words, to obtain the graph of g(x) from the graph of f(x), we stretch the graph horizontally by a factor of 9 and then translate it down by 2 units.

Here is a more detailed explanation of the transformations:

- Horizontal stretch by a factor of 9: To stretch the graph horizontally by a factor of 9, we multiply all of the x-coordinates by 9. This means that every point on the graph of f(x) will be moved 9 units to the right on the graph of g(x).

- Vertical translation down by 2 units: To translate the graph down by 2 units, we subtract 2 from all of the y-coordinates. This means that every point on the graph of f(x) will be moved 2 units down on the graph of g(x).


Please helppppppppppppp

Please helppppppppppppp

Answers

The line DB is 8cm which is made up of DE and EB which are equal to each other, thus DE and DB are both 4 cm.

Secondly, since AC and DB are perpendicular, that means angle DEC and angle DEA are ninety degrees.

Thus using the Pythagorean theorem, we can find the length of AE and EC which we can add up to find the length of AC.

 

           \(AE = \sqrt{AD^2-DE^2} =\sqrt{5^2-4^2} =\sqrt{25-16} =\sqrt{9}=3\\ \\EC=\sqrt{DC^2-DE^2}=\sqrt{6^2-4^2}=\sqrt{36-16} =\sqrt{20} =2\sqrt{5} =4.47\)

By adding AE and EC, we get that the length of AE and EC is 7.47 or as approximated to the nearest tenth 7.5.

Hope that helps!

Which of the following inequalities has a solution x≥−3?(1 point)

x6≤x2−1

3(x−1)≤4x

x+4≥x3

x≥x+32

Answers

The answer would be B

Determine how much interest you would earn on the following investment:
$190,000 invested at a 6.9% interest rate for 9 months.

Answers

$9832.5

(190000 * 9 * 6.9%) / 12 = 9832.5

What is the answers to Part A, B, and C ?

What is the answers to Part A, B, and C ?

Answers

Part a: The data points appear to follow an exponential pattern. This is because the balance is increasing at a rate that is proportional to the current balance.

How to explain the information

Part b: The equation of the best fit is y = 50(1.06)^x. This can be found using a variety of methods, including graphing the data points and fitting a curve to them, or using a statistical software package.

Part c: When x = 32, y = 50(1.06)^32 = $2,499.82.

Years since 1990, x 0 5 10 15 20 25 30

Balance, y $50 $62.31 $77.65 $96.76 $120.59 $150.27 $187.27 $2,499.82

The equation of the fitted curve is y = 50(1.06)^x.

Learn more about equations on

https://brainly.com/question/2972832

#SPJ1

3) What type of correlation would temperature
and ice cubes have?

Answers

temperature causes ice cubes to melt, or stay in the same state- temperature can impact state of matter in water, making ice cubes at 0 degrees Celsius

The points ​(​12,14​) and ​(42,​49​) form a proportional relationship. Find the slope of the line through the points. Then use the slope to graph the line.

Answers

Answer: 5/2

Step-by-step explanation:

49 - 42/ 14 - 12

please help me babes i’m back at it again lol help

please help me babes im back at it again lol help

Answers

hello,

so first you want to make it so the two fraction coefficients have the same denominator
you would have to change -2/3 to -4/6

add the two like terms
-5/6e- 4/6e = -9/6e

solve for e
-9/6e = -24
-9e = -144
e = 16

hope this helped :)


Graph function. Label vertex and axis of symmetry. Y=x2-10x+8

Answers

The vertex is (5, 17) and axis of symmetry is 5.

The graph is attached below.

What is Graph?

The graph is simply a structured representation of the data. It aids in our comprehension of the data. The numerical information gathered through observation is referred to as data.

In a line graph, the information or data is represented as a series of markers, or dots, and is then connected to one another by a straight line.

Given a parabola in standard form y= ax² + bx + c

So, x-coordinate of the vertex = -b/2a

x vertex = 10/ 2= 5

and, y vertex

= (5)² - 10(5) + 8

= 25 - 50 + 8

= 17

Thus, the vertex is (5, 17) and axis of symmetry is 5.

Learn more about Graph here:

https://brainly.com/question/17267403

#SPJ1

Graph function. Label vertex and axis of symmetry. Y=x2-10x+8

Which set of values below is a part of the solution set to the inequality 3.5p+ 14 > 7p? Select all that apply.

Answers

Solution of the inequality is p < 4.

What is inequality?

Inequalities are the mathematical expressions in which both sides are not equal. In inequality, unlike in equations, we compare two values.

Given inequality,

3.5p + 14 > 7p

Adding -7p on both sides

3.5p + 14 - 7p > 7p - 7p

-3.5p + 14 > 0

-3.5p > -14

Multiplying -1 on both sides, inequality get reversed.

3.5p < 14

p < 4

Hence, p < 4 is the solution of given inequality.

Learn more about inequality here:

https://brainly.com/question/12516731

#SPJ1

3) 21а⁹ - ба⁴
Factor by GCF​

Answers

\( \: \: \: \: \: \: \)

\( = 3a ^{4} \times (7 {a}^{5} - 2)\)

Step-by-step explanation:

\(21 {a}^{9} - 6 {a}^{4} \)

factor out 3 a⁴ from the expression

\( = 3 {a}^{4} \times (7 {a}^{5} - 2)\)

hope it helps

\( \: \: \: \: \: \: \)

\(\frac{6-\sqrt{8} }{\sqrt{2}-1 }\)

Answers

Answer:

  2 +4√2

Step-by-step explanation:

Perhaps you want the simplified form of (6-√8)/(√2 -1).

Conjugate

The denominator can be rationalized by multiplying numerator and denominator by the conjugate of the denominator:

  \(\dfrac{6-\sqrt{8}}{\sqrt{2}-1}=\dfrac{(6-\sqrt{8})(\sqrt{2}+1)}{(\sqrt{2}-1)(\sqrt{2}+1)}=\dfrac{6\sqrt{2}+6-\sqrt{16}-\sqrt{8}}{2-1}=\boxed{2+4\sqrt{2}}\)

__

Additional comment

The conjugate of the denominator is the same pair of terms with the sign between them changed. The product of the binomial and its conjugate is then the difference of squares. Since the square of a square root eliminates the radical, multiplying by the conjugate has the effect of removing the radical from the denominator.

The same "difference of squares" relation can be used to remove a complex number from the denominator.

  (a -b)(a +b) = a² -b²

In general, the differences of terms of the same power can be factored. This means that denominators with this form can be "rationalized" by taking advantage of that factoring.

<95141404393>

[tex]\frac{6-\sqrt{8} }{\sqrt{2}-1 }[/tex]

Answer:

\(4\sqrt{2}+2\)

-----------------------

Simplify the expression in steps:

\(\cfrac{6-\sqrt{8} }{\sqrt{2}-1 } =\)

\(\cfrac{6-2\sqrt{2} }{\sqrt{2}-1 } =\)

\(\cfrac{2(3-\sqrt{2} )(\sqrt{2} +1)}{(\sqrt{2}-1)(\sqrt{2}+1) } =\)

\(\cfrac{2(3\sqrt{2}+3-(\sqrt{2}^2) -\sqrt{2} )}{(\sqrt{2})^2-1 } =\)

\(\cfrac{2(2\sqrt{2}+3-2) }{2-1} =\)

\(\cfrac{2(2\sqrt{2}+1) }{1} =\)

\(4\sqrt{2}+2\)

The admission fee at an amusement park is 20$ for children and 35$ adults. On a certain, day 264 people entered the park, and the admission fees collected totaled $6780. How many children and how many adults were admitted?

Answers

Answer:

100 Adults and 164 Children

Step-by-step explanation:

To solve this we will need to write two equations to solve for the two unknowns. Firstly, we know that tickets are 20 for children and 35 for adults, and that the total price was 6780. We can write an expression to represent this. 6780 is the total price, this also means it is the price of all the adults + the price of all the children. The total price of the adults tickets is the price of each ticket multiplied by the number of adults, so the total price of adult tickets can be represented by: 35A, 35 being the ticket price per adult, and A being the number of adults. Similarly the total children's price can be expressed as such: 20C, 20 being the price per child, and C being the number of children. Since we know that these two values total to 6780, we can now form an equation:

35A (total adult price) + 20C (total children price) = 6780

35A+20C=6780

Now we need another expression so we can substitute for one of the values. The other piece of information we are given, is that a total of 264 people entered the park. This means that the total number of adults + the total number of children = 264. Since we already have variables for the numbers of adults and children we now have our second equation:

A (number of adults) + C (number of children) = 264

A+C=264

Now we can use this second equation to substitute for one of the values in the first equation. Let's substitute for children:

If we rearrange the second expression we will get:

A+C-A=264-A

C=264-A

So now we substitute this expression into our first formula:

35A+20C=6780

C=264-A

35A+20(264-A)=6780

Now since we only have one unknown, we can simplify, expand and solve!

35A+20*264-20*A=6780

35A+5280-20A=6780

35A-20A+5280-5280=6780-5280

15A=1500

15A/15=1500/15

A= 100

A total of 100 adults were admitted.

Now we can use the number of adults to find the number of children using our second formula:

C=264-A

C=264-100

C=164

And there we are! A total of 100 adults and 164 children were admitted.

Hope this helped!

Other Questions
please please help me PLEASE HELP WITH THIS! A cannonball is fired into the air with an initial vertical velocity of 128 feet per second. The release point is 6 feet above the ground. The function h =-16t2+128t+6 represents the height h (in feet) of the cannonball after t seconds. a) find the height of the cannonball each second after it is fired b) use the graph of the model to determine how long the cannonball is in the air c graph help me pls What is the approximate volume of the cylinder? A three-column table is given. Part 6 B D Part 10 25 35 Whole A C 56 What is the value of C in the table? 15 35 40 46 Given: cos = 5/13 where 0 < 90Find tan 2 Guys please help asap I NEED HELP ASAP please and thankyou;) Question 7 (10 points)(MCNew Technology Leads to Bigger CitiesIn the 1800s, the United States was still a very young nation, trying to solidify its identity. The Industrial Revolution began in Great Britain, a fastdevelopment of society following the introduction of machines. The United States was slower than Great Britain to fully embrace the changes.Yet key technological developments caused a rapid growth in American urban areas.Better farming methods and tools in the 1800s increased food production. Americans were able to grow enough food for their families as wellas to sell. The abundance caused food prices to fall.The expansion of cotton and the growth of textile factories in northern states helped produce the first wave of American industry. More peopleturned to work in northern factories as a way to support their families. Thousands of immigrants to the United States also settled in or nearport cities, looking for work. Even today, the need for work is a common reason people move to urban areas.As a result, cities grew in numbers of people and physical space. As more people and businesses moved in, they needed buildings for living andworking. They needed ways to move around the city. We call this process urbanization.In 1820, the United States had only a few cities of 10,000 residents or more. About seven percent of U.S. residents lived in urban areas. Thenumber of cities with more than 10,000 people grew quickly over the next 40 years, especially in the Northeast and Midwest. By 1860, about 20percent lived in cities. Philadelphia and New York City were the most populated cities in 1860 and would soon reach one million residents.The urbanization of the United States quickened due to technology improvements. Without innovations in food production, the factories couldnot have grown so quickly. The trend quickened after 1860 and continued throughout the 21st century as well. By 2007, more Americans livedin or near cities than they did in rural areas.Select a sentence from the body of this article that can be removed without affecting the author's explanation. Place the sentence in quotesand explain why it is an unnecessary detail.(10 points) Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG The dynamic developmental model states that the accelerated growth of the _________ relative to the _________ during adolescence explains why teens seem to make more risky choices with less forethought than adults. What type of test has the supreme court relied upon in order ot distingusih stop from nostops? Exercise 1 Draw two lines under the simple predicate in each sentence. Then write the tense of the verb in the space provided.Women had not received the right to vote yet. To draw a graph for y = 3/4x + 7, a person can draw a point at x of 0 and y of ___, a second point by going up 3 and over ___, and then draw a line through the points.A: 3,7B: 4,7C: 7,3D: 7,4 When the police lawfully arrest the occupant of a vehicle, they have had the right to search the passenger compartment of that vehicle. A 2009 U.S. Supreme Court decision limited that authority to two circumstances which include the following:Multiple ChoiceIf the police can place a GPS tracker on the vehicle in an effort to see if a crime has been or may be committedA lawful arrest for a routine traffic stop occurs within a five-mile radius of a recently committed crimeWhen an officer reasonably believes that the vehicle contains evidence relevant to the crime for which the occupant of the vehicle may be arrestedWhen the exclusionary rule can be properly applied to all the evidence collected which of the following is supported by research on dynamic assessment? group of answer choices dynamic assessments have been criticized for being more culturally biased than traditional intelligence tests. children's capacity to transfer what they have learned to novel problems contributes substantially to gains in intelligence test performance. most experts believe that dynamic assessment provides a more accurate prediction of academic achievement and vocational success than traditional intelligence tests. in some instances, dynamic assessment can underestimate the abilities of ethnic minority children. Read the passage.excerpt from Queen of the Falls by Chris Van AllsburgThe men rowed away from the island, drawing close to the "Point of No Return," a place where the river ran so quickly on its way to the falls that no boat could escape its pull.Fred Truesdale tapped on the barrel with his oar and told Annie he was going to cut the rope. Her muffled voice answered back, "All righty." The line was cut and the two boatmen rowed with all their strength, fighting the fierce current that quickly stole the barrel away.QuestionBased on the details in the passage, what can readers infer about the task of placing Annie's barrel in the river?ResponsesIt does not happen as planned.It does not happen as planned.It is the least risky part of the stunt.It is the least risky part of the stunt.It is difficult and dangerous.It is difficult and dangerous.It is not something Fred wants to do Question 7 of 10How does fractional reserve banking increase the money supply?O A. By automatically converting foreign currencies into U.S. dollars ondepositO B. By guaranteeing that all deposits are held in reserve as cash at alltimesO C. By using deposited money to make loans without reducing thevalue of the depositsO D. By giving banks the authority to print their own money in aneconomic emergencySUBMIT Please help me will give points Does a Snickers candy bar (65g,325kcal) provide enough energy to climb from Zermatt (elevation 1660m) to the top of the Matterhorn (4478m), or might you need to stop at Hdrnli Hut (3260m) to eat another one? Imagine that you and your gear have a mass of 75 kg, and that all of your work is done against gravity (that is, you are just climbing straightup). Remember from your introductory physics course the equation below where g is acceleration due to gravity (9.8m/sec2). One joule (J) is 1kg m^2/sec^2 and there are 4.l kJ per kcal. What assumptions made here will greatly underestimate how much candy you need? Choose the sentence that is written Incorrectly.James Webb is a former Secretary of the Navy who has written a book about his experiences.The manager maintained that the customer is always right.Entering my neighbor's home and being impressed by the beautiful furnishings.I would like to go camping this weekend instead of studying.